Bacillus safensis with high lipase activity and application thereof in degradation of biodegradable mulching film and growth promotion of crops

Abstract

The invention discloses bacillus safensis with high lipase activity and application of the bacillus safensis in degradation of biodegradable mulching films and growth promotion of crops, and belongs to the technical field of agricultural microorganisms and biodegradable materials. According to the present invention, the bacterial strain is bacillus safeensis STX-S1, and is preserved in the China Center for Type Culture Collection on September 15, 2025, and the preservation number is CCTCC NO: M 20252036; the lipase can be stably secreted under neutral to weakly acidic and weakly alkaline conditions; a PBAT or PLA film can be efficiently degraded, the biodegradable mulching film is degraded, and the growth of crops is promoted.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural microorganisms and biodegradable materials, and more particularly, to a Bacillus safensis with high lipase activity and its application in biodegradable mulch degradation and crop growth promotion. BACKGROUND

[0002] With the wide use of plastic mulch in agriculture, the problem of residual film pollution is becoming increasingly serious. Traditional polyethylene (PE) mulch is difficult to degrade naturally, leading to deterioration of soil physical and chemical properties and decline of farmland quality. In recent years, although biodegradable mulch such as PBAT and PLA has been gradually promoted, it has exposed problems such as slow degradation rate and susceptibility to environmental factors in actual application in the field, limiting its large-scale promotion and application.

[0003] Studies have shown that lipase (Lipase) and esterase (Esterase) play a key role in the cleavage of ester bonds in biodegradable plastics. Therefore, screening functional microorganisms with high lipase activity that can effectively decompose PBAT / PLA is the key to promoting the complete degradation of biodegradable mulch.

[0004] On the other hand, Bacillus spp. strains not only produce a variety of degrading enzymes, but also have functions such as secreting plant hormones, improving rhizosphere microecology, and promoting crop growth. However, the Bacillus reported in the prior art is mostly Bacillus subtilis and Bacillus amyloliquefaciens, and there is still a lack of systematic research on the lipase activity and mulch degradation application of Bacillus safensis. SUMMARY

[0005] The present application aims to overcome the shortcomings of the prior art and provide a Bacillus safensis with high lipase activity and its application in biodegradable mulch degradation and crop growth promotion. The strain can efficiently degrade PBAT or PLA biodegradable mulch and promote the growth of crops such as rice, solving the problems of slow degradation rate and single function of existing mulch.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] A Bacillus safensis with high lipase activity, the strain is Bacillus safensis STX-S1, which was preserved in China Center for Type Culture Collection on September 15, 2025, with the preservation number CCTCC NO: M 20252036.

[0008] The 16S rDNA sequence of the strain is shown as SEQ ID NO. 1.

[0009] The strain is further provided by the application, and the strain is obtained by the following method: the collected soil sample is added to sterile water, and gradient dilution is performed to obtain 10 -1 ~10 -5 Dilution liquid of dilution degree 10 -3 、10 -4 、10 -5 The dilution liquid is coated on LB solid culture medium containing 10 g / L olive oil and 1 g / L Triton X-100 for culture, and the obtained single colony is cultured by LB liquid culture medium.

[0010] The application further provides that the culture temperature is 25-30 DEG C and the culture time is 24-72 h when the strain is cultured in LB solid culture medium containing 10 g / L olive oil and 1 g / L Triton X-100.

[0011] The application further provides that the culture temperature is 25-28 DEG C and the culture time is 12-48 h when the strain is cultured by LB liquid culture medium.

[0012] A Bacillus safensis with high lipase activity is applied to biodegradation of mulch film and promotion of crop growth.

[0013] In summary, the application has the following beneficial effects:

[0014] The obtained strain can be produced on a large scale by liquid fermentation, has low cost and is easy to popularize, has strong environmental adaptability, can stably secrete lipase under neutral to weak acidic and weak alkaline conditions, can efficiently degrade PBAT or PLA film (the film mass loss rate is more than 40% within 30 days, which is significantly better than ordinary Bacillus (about 15-25%)), significantly reduces agricultural residual film pollution, promotes crop growth, has the characteristics of non-toxicity and non-pathogenicity, can be directly used in an agricultural ecosystem, and has wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 It is a colony morphology diagram of Bacillus safensis STX-S1.

[0016] Figure 2 It is a staining microscopic examination diagram of Bacillus safensis STX-S1.

[0017] Figure 3 It is a phylogenetic tree diagram of Bacillus safensis STX-S1.

[0018] Figure 4A comparison chart of rice growth to reflect the growth-promoting effect of Bacillus safensis STX-S1 on rice seedlings. DETAILED DESCRIPTION

[0019] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the protection scope of the present application.

[0020] Example 1: Strain screening and identification

[0021] 10 g of soil samples collected from the mountainous area of Fusheng Wufengling, Yuecheng District, Shaoxing City, Zhejiang Province were added to 100 mL of sterile water, and then uniformly shaken at 28°C and 200 rpm. Gradient dilution was performed, and 10 mL of dilution liquid was obtained. -1 ~10 -5 Dilution liquid; 100 µl of dilution liquid with dilution of 10 -3 , 10 -4 , 10 -5 was taken and spread on LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100. Inverted culture was performed at 28°C for 48 h (according to the need, the culture temperature can be adjusted to 25-30°C, and the culture time can be adjusted to 24-72 h). The growth of the strain and the formation of transparent circles were observed. Colonies with a transparent circle diameter ≥10 mm were picked and separated and purified by streaking method to obtain single colonies. The single colonies were inoculated into LB liquid medium and cultured at 28°C and 200 r / min on a shaker for 24 h (according to the need, the culture temperature can be adjusted to 25-28°C, the culture time can be adjusted to 12-48 h, and the shaker speed can be adjusted to 150-200 r / min). Then the bacterial liquid was transferred to 25% glycerol and stored at -80°C.

[0022] The colonies were positive under Gram staining microscopic examination. The strain cells were rod-shaped and had spores. The colony morphology of Bacillus safensis STX-S1 is shown in Figure 1 , and the staining microscopic examination chart is shown in Figure 2 . The 16S rDNA sequence of the screened strain was sequenced by Beijing Qikang Biological Technology Co., Ltd. Hangzhou Branch, and the 16S rDNA sequence was as follows:

[0023]

[0024] ATGATTGGGGTGAAGTCGTACAGG (SEQ ID NO. 1).

[0025] The sequencing results were submitted to the NCBI database for BLAST analysis, and the phylogenetic tree of Bacillus safensis STX-S1 is shown in Figure 3 , and the strain was identified as Bacillus safensis, named Bacillus safensis STX-S1. The Bacillus safensis STX-S1 was preserved in the China Center for Type Culture Collection on September 15, 2025, with the preservation number CCTCC NO: M 20252036 and the preservation address being Wuhan, China, Wuhan University.

[0026] The Bacillus safensis STX-S1 strain was inoculated in 100 mL of LB liquid medium with pH = 7 (pH adjusted by NaOH) and cultured in a 28°C, 200 rpm shaker for 24 h for strain activation. Then, the activated liquid was inoculated into 50 mL of LB medium containing 10 g / L olive oil and 1 g / L Triton X-100 with pH = 7 at a strain inoculation amount of 1%, and was placed in a 15°C, 20°C, 28°C, 37°C, 45°C, and 50°C shaker for culture at 200 rpm. Every 2 h, the OD 600 of the bacterial liquid was measured, and 3 repeated experiments were set. The results showed that the growth of Bacillus safensis STX-S1 had a significant lag phase under the condition of 15°C culture; the growth of Bacillus safensis STX-S1 was good under the conditions of 20°C, 28°C, 37°C, and 45°C culture, and there was no obvious growth lag phase; and the growth of Bacillus safensis STX-S1 was greatly affected under the condition of 50°C culture, and the OD 600 almost did not increase.

[0027] The Bacillus safensis STX-S1 strain was inoculated in 100 mL of LB liquid medium with pH = 7 (pH adjusted by NaOH) and cultured in a 28°C, 200 rpm shaker for 24 h for strain activation. Then, the activated liquid was inoculated into 50 mL of LB medium containing 10 g / L olive oil and 1 g / L Triton X-100 with pH values of 4, 5, 6, 7, 8, 9, 10, and 11 (adjusted to the required pH by NaOH) at a strain inoculation amount of 1%, and was placed in a 28°C, 200 rpm shaker for culture for 48 h. Every 2 h, the OD 600, set 3 repeated experiments. The results show that: when pH is 6~9, the strains can grow normally and maintain a high growth; and when pH is less than 6 and greater than 9, the growth of the strain is obviously inhibited.

[0028] Bacillus safensis STX-S1 strain was inoculated in 100mL LB liquid medium with pH=7, and was cultured in a 28℃, 200rpm shaking bed for 24h for strain activation, and an activation liquid was obtained; the activation liquid was inoculated into an enzyme production medium (prepared by 20g of bean cake powder, 20g of corn syrup, 10g of soluble starch, 5g of K2HPO4, 5g of NaNO3, pH=7.5) at a strain inoculation amount of 1%, and was cultured in a 28℃, 200r / min shaking flask for 72h; the fermentation liquid was centrifuged at 4℃, 8000r / min for 10min, and the supernatant was collected as a crude enzyme liquid for detection. The fat digestion enzyme was detected by a kit, and the activity of the fat digestion enzyme in the crude enzyme liquid was detected. The results show that the lipase activity of Bacillus safensis STX-S1 in the crude enzyme liquid is 127U / mL.

[0029] Example 2 Application of Bacillus safensis STX-S1 in degrading mulch

[0030] Bacillus safensis STX-S1 strain was inoculated in 100mL LB liquid medium with pH=7, and was cultured in a 28℃, 200rpm shaking bed for 24h for strain activation, and an activation liquid was obtained; 3 pieces of PBAT mulch fragments cut into 5×5mm and sterilized were added to LB solid medium containing 10g / L olive oil and 1g / L Triton X-100 with pH=7, and the activation liquid was added at a strain inoculation concentration of 10 8 CFU / mL, and was cultured in a constant temperature shaking bed at 28℃, 2000r / min for 30d.

[0031] After 30d, the mulch was taken out, the surface excess medium was washed with sterile water, the degraded PBAT film pieces were washed in a 2%(w / v) sodium dodecyl sulfate (SDS) solution with oscillation (180r / min) for 4h, and were repeatedly washed with sterile water for multiple times, and were dried in an oven at 60℃, then the mass of the degraded PBAT mulch was measured, and the following formula was used to calculate: mulch weight loss rate (%)=(weight of mulch before degradation-weight of mulch after degradation) / weight of mulch before degradation×100%. The calculation shows that the mulch weight loss rate is 41.5%.

[0032] Example 3 Application of Bacillus safensis STX-S1 in promoting growth of rice seedlings

[0033] (1) Bacillus safensis STX-S1 was inoculated into LB liquid medium with pH=7, and cultured in a 28℃, 200rpm shaker, to obtain 3×10 7 CFU / g of Bacillus safensis STX-S1 bacterial liquid.

[0034] (2) Zhejiang 27 rice seeds were soaked in 1wt% sodium hypochlorite solution for 10min, and then divided into two groups. One group of rice seeds was soaked in the Bacillus safensis STX-S1 bacterial liquid of step (1) for 4h, as the treatment group, and the other group of rice seeds was soaked in sterile water for 4h, as the blank control group. Then, the two groups of rice seeds were washed with sterile water, and the washed seeds were placed in a glass dish containing wet absorbent paper, and germinated in the dark at 37℃ for 2 days.

[0035] (3) Peat and vermiculite were mixed in a volume ratio of 2:1 to form a substrate, and 600mL of the substrate was added to each of six rice pots. The germinated treatment group and blank control group rice seeds were planted in the rice pots, 10 seeds per pot, and each group had 3 pots. The rice was cultured under 16h light + 8h dark per day for 25 days. During the light culture period, the treatment group was treated with the Bacillus safensis STX-S1 bacterial liquid of step (1) once every 5 days, and the addition amount of each round was 60mL / pot. The blank control group was treated with sterile water once every 5 days, and the addition amount of each round was 60mL / pot.

[0036] (4) The rice plants cultured for 25 days were pulled out from the substrate, washed repeatedly with clean water, and the water on the rice plants was absorbed with absorbent paper. The root length, root fresh weight and seedling height of the treatment group and the blank control group were measured. The comparison of the growth of the treatment group and the blank control group is shown in Figure 4 . The results show that the average root length of the treatment group is 14.3cm (increased by 22.31% compared with the blank control group), the average root fresh weight is 0.15g (increased by 21.6% compared with the blank control group), and the average seedling height is 28.2cm (increased by 23.24% compared with the blank control group). The treatment group also has a 22.4% increase in the seedling index compared with the blank control group after 25 days of cultivation.

[0037] The LB liquid medium used in the embodiments of the present application is prepared by dissolving LB medium (powder, purchased from Hangzhou Baisi Biotechnology Co., Ltd.) in distilled water at a ratio of 25g:1000mL. The LB solid medium containing 10g / L olive oil and 1g / L Triton X-100 is prepared by adding agar, olive oil and Triton X-100 to the LB liquid medium, and the addition amount of agar in the LB solid medium is 2wt%. All the above prepared media are sterilized at 121℃ for 20min.

[0038] The fat digestion enzyme activity test kit used in the embodiments of the present application is purchased from Beijing Solabio Science and Technology Co., Ltd., and the model number is BC2340; the PBAT mulch is produced by Shaoxing Starch (Shaoxing) New Material Co., Ltd., and the brand is SDM-07.

[0039] The above only describes the preferred embodiments of the present application, and the protection scope of the present application is not limited to the above-described embodiments. Any technical solution falling within the concept of the present application shall fall within the protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, some improvements and refinements without departing from the principles of the present application shall also be considered as the protection scope of the present application.

Claims

1. A Bacillus safensis having high lipase activity, characterized in that, The strain is Bacillus safensis STX-S1, which was preserved in China Center for Type Culture Collection on September 15, 2025, and the preservation number is CCTCC NO: M 20252036.

2. Bacillus safensis having high lipase activity according to claim 1, characterized in that, The 16S rDNA sequence of the strain is shown as SEQ ID NO.

1.

3. The Bacillus safensis having high lipase activity according to claim 1, characterized in that, The strain is screened by the following method: the collected soil sample is added to sterile water, gradient dilution is performed to prepare 10 -1 ~10 -5 dilutions; the dilutions with dilution degrees of 10 -3 , 10 -4 , 10 -5 are taken, and are inoculated on LB solid culture medium containing 10 g / L olive oil and 1 g / L Triton X-100 for culture; the colonies are picked for separation and purification, and the obtained single colonies are cultured by LB liquid culture medium, and thus the strain is obtained.

4. The Bacillus safensis of claim 3, having high lipase activity, wherein, When cultured in LB solid medium containing 10 g / L olive oil and 1 g / L Triton X-100, the culture temperature is 25-30℃, and the culture time is 24-72 h.

5. The Bacillus safensis of claim 3, wherein the Bacillus safensis has high lipase activity. When cultured in LB liquid medium, the culture temperature is 25-28℃, and the culture time is 12-48 h.

6. Application of Bacillus safensis with high lipase activity as claimed in any one of claims 1-5 in biodegradation of mulch film and in crop growth promotion.

Images