Host nucleic acid removal method for high-throughput sequencing

By combining treatment with saponins, NaCl, magnesium chloride, and Benzonase enzymes, along with lysozyme and proteinase K, the problem of host nucleic acid interference in high-throughput sequencing was solved, achieving efficient removal of host nucleic acids and improving the detection rate and quantity of pathogenic microorganism gene sequences.

CN121362820APending Publication Date: 2026-01-20ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511591743.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-03
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

In high-throughput sequencing technology, interference from the host's gene sequence leads to a significant decrease in the detection rate and number of pathogenic microorganisms' gene sequences. Existing host removal methods are insufficient in terms of universality and applicability.

Method used

Samples were treated with a combination of saponin solution, NaCl, magnesium chloride, and Benzonase enzyme, combined with lysozyme, binding buffer, and proteinase K. This multi-step process removed host nucleic acids and improved the detection rate of exogenous nucleic acids.

Benefits of technology

It effectively removes host nucleic acid, improves the coverage depth and breadth of pathogenic microorganism gene sequences, and significantly increases the detection rate and quantity of pathogenic microorganism gene sequences. It is suitable for tissue and blood samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362820A_ABST
    Figure CN121362820A_ABST
Patent Text Reader

Abstract

The invention provides a host nucleic acid removal method for high-throughput sequencing, and belongs to the field of pathogenic microorganism detection. By limiting the types and use concentrations of reagents, host nucleic acid substances are ensured to be fully removed. In a high host background sample, the method is suitable for tissues and blood, background host nucleic acid can be effectively reduced, and the detection rate and the detection quantity of pathogenic microorganism gene sequences are improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of pathogenic microorganism detection, and particularly relates to a host nucleic acid removal method for high-throughput sequencing. BACKGROUND

[0002] When high-throughput sequencing technology faces a high host background sample, it is easy to be disturbed by the gene sequence of the host, resulting in that most of the detected gene sequences are the gene sequences of the host, and the detection rate and number of the gene sequences of pathogenic microorganisms are greatly reduced; therefore, host removal is a necessary link when facing such a sample.

[0003] The host removal methods used in different studies are not unified, and the main host removal methods at present include filtering, centrifugation, differential lysis combined with nuclease, hybridization probe, and the results given by these methods in different laboratories are quite different, and most of them are limited in relatively single samples, and there are few studies on host nucleic acid removal methods with strong universality, wide application range and good removal effect. Therefore, it is of important research and application value to explore and optimize a host nucleic acid removal method with strong universality, wide application range and good removal effect under a high host background sample. SUMMARY

[0004] Therefore, the purpose of the present application is to provide a host nucleic acid removal method for high-throughput sequencing.

[0005] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical scheme: The present application provides a host nucleic acid removal method for high-throughput sequencing, comprising the following steps: 1) mixing a sample with a saponin solution to obtain a sample solution; 2) mixing the sample solution with water, then mixing with NaCl with a final concentration of 0.03-0.1 M to obtain a sample lysis solution, centrifuging the sample lysis solution to discard the supernatant, then diluting with a buffer to obtain a purified solution; 3) mixing the purified solution, magnesium chloride with a final concentration of 1-3 mM and Benzonase enzyme with a final concentration of 2-4 U / μL to obtain a digestion solution; 4) mixing the digestion solution with blood RNA stabilizing solution for enzyme inactivation to obtain a sample with removed host nucleic acid.

[0006] Preferably, the volume ratio of the sample to the saponin solution in step 1) is 1:0.5-3; The mass concentration of the saponin solution is 3%-6%; The mixing time in step 1) is 5-15 min, and the mixing temperature is 16-28℃.

[0007] Preferably, the volume ratio of the sample solution to water in step 2) is 1-3:1. The mixing time of the sample solution and water is 15-60 s, and the mixing temperature is 16-28℃. The centrifugal force of the centrifugation is 5000-15000 g, and the centrifugation time is 1-5 min. The volume ratio of the sample solution to the buffer is 1-3:1.

[0008] Preferably, the mixing temperature in step 3) is 35-40℃, and the mixing time is 20-40 min.

[0009] Preferably, the enzyme inactivation temperature in step 4) is 60-80℃, and the enzyme inactivation time is 20-40 min.

[0010] The present application provides a method for improving the detection rate of exogenous nucleic acid, comprising the following steps: S1. Mixing the sample from which the host nucleic acid is removed with lysozyme at a final concentration of 0.1-1 mg / mL to obtain a lysis solution containing exogenous nucleic acid; S2. Mixing the lysis solution containing exogenous nucleic acid, Binding buffer and proteinase K, and then mixing with isopropanol to obtain a DNA extraction solution; S3. Washing the DNA extraction solution 2-7 times to obtain a sample enriched with exogenous nucleic acid.

[0011] Preferably, the mixing temperature in step S1 is 35-40℃, and the mixing time is 10-20 min.

[0012] Preferably, the volume ratio of the lysis solution containing exogenous nucleic acid, Binding buffer, proteinase K and isopropanol in step S2 is 150-250:150-250:20-60:80-120. The mixing temperature of the lysis solution containing exogenous nucleic acid, Binding buffer and proteinase K is 60-80℃, and the mixing time is 5-20 min.

[0013] Preferably, the centrifugal force of the centrifugation in step S3 is 5000-10000 g, and the centrifugation time is 0.5-2 min. Preferably, the washing comprises the following steps: washing with a buffer for 2-5 times, centrifuging to discard the supernatant, then treating with water at 60-80℃ for 2-4 min, centrifuging to discard the supernatant, and obtaining a sample enriched with exogenous nucleic acid.

[0014] Compared with the prior art, the present application has the following beneficial effects: The application provides a host nucleic acid removal method for high-throughput sequencing, which ensures that host nucleic acid substances are sufficiently removed by limiting the types and use concentrations of reagents, can effectively improve the coverage depth and coverage breadth of pathogenic microorganism gene sequences, and efficiently and quickly improves the detection rate and detection quantity of pathogenic microorganism gene sequences in high host background samples. In high host background samples, the method is suitable for tissues and blood, can effectively reduce background host nucleic acids, and improve the detection rate and detection quantity of pathogenic microorganism gene sequences. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Figure 1 is a qPCR detection result chart of the control group and the experiment of the mouse lung tissue and two detection bacteria in Example 1; Figure 2 Figure 2 is a qPCR detection result of the control group and the experiment of the mouse liver tissue and two detection bacteria in Example 2; Figure 3 Figure 3 is a qPCR detection result of the control group and the experiment of the mouse blood and two detection bacteria in Example 3; Figure 4 Figure 4 is a qPCR detection result of the comparative experiment of the method of Example 1 and the commercial kit HostZERO™ Microbial DNA Kit (item number: D4310) in Comparative Example 1. DETAILED DESCRIPTION

[0016] The application provides a host nucleic acid removal method for high-throughput sequencing, which includes the following steps: 1) mixing the sample with a saponin solution to obtain a sample solution; 2) mixing the sample solution with water, then mixing with NaCl with a final concentration of 0.03-0.1 M to obtain a sample lysis solution, centrifuging the sample lysis solution to discard the supernatant, then diluting with a buffer to obtain a purified solution; 3) mixing the purified solution, magnesium chloride with a final concentration of 1-3 mM, and Benzonase enzyme with a final concentration of 2-4 U / μL to obtain a digestion solution; 4) mixing the digestion solution with blood RNA stabilizing solution for enzyme inactivation to obtain a sample with removed host nucleic acids.

[0017] In the present application, the sample is mixed with saponin solution to obtain sample solution; the sample includes tissue or blood, preferably liver, lung or blood; the volume ratio of the sample to saponin solution is preferably 1:0.5-3, further preferably 1:0.7-2, and more preferably 1:1; the mass concentration of the saponin solution is preferably 3%-6%, further preferably 4%-5%, and more preferably 4.4%; the mixing time is preferably 5-15 min, further preferably 7-12 min, and more preferably 10 min; and the mixing temperature is preferably 16-28℃, further preferably 20-26℃, and more preferably 24℃.

[0018] In the present application, the sample solution is mixed with water, and then mixed with NaCl with a final concentration of 0.03-0.1 M to obtain sample lysate, the sample lysate is centrifuged to discard the supernatant, and then diluted with buffer to obtain purified solution; the volume ratio of the sample solution to water is preferably 1-3:1, further preferably 1.5-2.5:1, and more preferably 1.8:1; the mixing time of the sample solution and water is preferably 15-60 s, further preferably 20-45 s, and more preferably 30 s; the mixing temperature is preferably 16-28℃, further preferably 20-26℃, and more preferably 24℃; the final concentration of NaCl is 0.03-0.1 M, preferably 0.04-0.08 M, and further preferably 0.06 M; the centrifugal force is preferably 5000-15000 g, further preferably 8000-12000 g, and more preferably 10000 g; the centrifugation time is preferably 1-5 min, further preferably 2-4 min, and more preferably 3 min; and the volume ratio of the sample solution to buffer is preferably 1-3:1, further preferably 1.5-2.5:1, and more preferably 1.8:1.

[0019] In the present application, the purified solution, magnesium chloride with a final concentration of 1-3 mM, and Benzonase enzyme with a final concentration of 2-4 U / μL are mixed to obtain digestion solution; the final concentration of magnesium chloride is 1-3 mM, preferably 1.5-2.5 mM, and further preferably 2 mM; the final concentration of Benzonase enzyme is 2-4 U / μL, preferably 2.5-3.5 U / μL, and further preferably 3 U / μL; the mixing temperature is preferably 35-40℃, further preferably 36-38℃, and more preferably 37℃; and the mixing time is preferably 20-40 min, further preferably 25-35 min, and more preferably 30 min.

[0020] In the present application, the digestive juice is mixed with the blood RNA stabilizing solution for enzyme inactivation to obtain a sample with host nucleic acids removed; the volume ratio of the digestive juice to the blood RNA stabilizing solution is preferably 1:100-500, further preferably 1:200-400, and more further preferably 1:300; the temperature for enzyme inactivation is preferably 60-80℃, further preferably 65-75℃, and more further preferably 70℃; and the time for enzyme inactivation is preferably 20-40 min, further preferably 25-35 min, and more further preferably 30 min.

[0021] The present application provides a method for improving the detection rate of exogenous nucleic acids, comprising the following steps: S1. mixing the sample with host nucleic acids removed with lysozyme at a final concentration of 0.1-1 mg / mL to obtain a lysis solution containing exogenous nucleic acids; S2. mixing the lysis solution containing exogenous nucleic acids, Binding buffer and proteinase K, and then mixing with isopropanol to obtain a DNA extraction solution; S3. washing the DNA extraction solution 2-7 times to obtain a sample enriched with exogenous nucleic acids.

[0022] In the present application, the sample with host nucleic acids removed is mixed with lysozyme at a final concentration of 0.1-1 mg / mL to obtain a lysis solution containing exogenous nucleic acids; the temperature for mixing is preferably 35-40℃, further preferably 36-38℃, and more further preferably 37℃; the time for mixing is preferably 10-20 min, further preferably 12-18 min, and more further preferably 15 min; and the concentration of lysozyme is 0.1-1 mg / mL, further preferably 0.3-0.8 mg / mL, and more further preferably 0.5 mg / mL.

[0023] In the present application, the lysis solution containing exogenous nucleic acids, Binding buffer and proteinase K are mixed, and then mixed with isopropanol to obtain a DNA extraction solution; the volume ratio of the lysis solution containing exogenous nucleic acids, Binding buffer, proteinase K and isopropanol is preferably 150-250:150-250:20-60:80-120, further preferably 180-220:180-220:30-50:90-110, and more further preferably 210:200:40:100; the temperature for mixing the lysis solution containing exogenous nucleic acids with Binding buffer and proteinase K is preferably 60-80℃, further preferably 65-75℃, and more further preferably 70℃; and the time for mixing is preferably 5-20 min, further preferably 7-15 min, and more further preferably 10 min.

[0024] In the present application, the cleaning preferably comprises the following steps: washing with a buffer for 2-5 times, centrifuging to discard the supernatant, treating with 60-80℃ water for 2-4 min, and then centrifuging to discard the supernatant, thereby obtaining a sample enriched with foreign nucleic acids. Before the buffer cleaning, a centrifuging step is further included, and the centrifugal force of the centrifuging is preferably 5000-10000 g, further preferably 6000-9000 g, and more preferably 8000 g, and the centrifuging time is preferably 0.5-2 min, further preferably 0.7-1.5 min, and more preferably 1 min. The buffer washing is washing with Inhibit Buffer first, and then washing with Wash Buffer, and the washing times of the Inhibit Buffer are preferably 1-2 times, further preferably 1 time, and the washing times of the Wash Buffer are preferably 2-4 times, further preferably 3 times. During the washing with the buffer, the centrifugal force of each washing is preferably 5000-10000 g, further preferably 6000-9000 g, and more preferably 8000 g, and the centrifuging time is preferably 0.5-2 min, further preferably 0.7-1.5 min, and more preferably 1 min. After the washing with the buffer, the centrifugal force of centrifuging to discard the supernatant is preferably 10000-15000 g, further preferably 12000-14000 g, and more preferably 13000 g, and the centrifuging time is preferably 5-15 s, further preferably 8-12 s, and more preferably 10 s.

[0025] In the present application, after the centrifuging to discard the supernatant, the sample is treated with 60-80℃ water for 2-4 min, and then centrifuged to discard the supernatant, thereby obtaining a sample enriched with foreign nucleic acids. The water is preferably non-ribonuclease water, the temperature of the water is preferably 60-80℃, further preferably 65-75℃, and more preferably 70℃, the treatment is mixing the sample obtained after the centrifuging to discard the supernatant with the water and standing, the treatment time is preferably 2-4 min, further preferably 2.5-3.5 min, and more preferably 3 min, and after the treatment, the sample is centrifuged to discard the supernatant again, the centrifugal force of the centrifuging is preferably 5000-10000 g, further preferably 6000-9000 g, and more preferably 8000 g, the centrifuging time is preferably 0.5-2 min, further preferably 0.7-1.5 min, and more preferably 1 min, thereby obtaining a sample enriched with foreign nucleic acids.

[0026] The technical solutions provided by the present application are described in detail below in combination with the embodiments, but they should not be understood as limiting the protection scope of the present application.

[0027] Material sources

[0028] 4.4% Saponin solution was purchased from Sigma, 47036-506-F; RNase-free water was purchased from Thermo Fisher Scientific, USA; 5M NaCl solution was purchased from Huyue, China; PBS solution was purchased from Thermo Fisher Scientific, USA; 0.1M MgCl2 solution was purchased from Huyue, China; Benzonase enzyme was purchased from Servicebio, G3461-50KU; Blood RNA stabilization solution was purchased from Bioteke, R0116; High pure PCR Template preparation kit (Roche) was purchased from Roche, Switzerland; TaKaRa TB Green Fast qPCR Mix kit was purchased from TaKaRa, RR430A.

[0029] Instruments: Tissue grinder was purchased from QIRUI; Biosafety cabinet BIO-II-Advance 4 was purchased from Telstar, Spain; Ultracentrifuge was purchased from Beckman, USA; qPCR instrument was purchased from Jeleme, China.

[0030] Example 1

[0031] (1) Preparation of tissue samples: Chose monoclonal bacteria (Klebsiella pneumoniae and Staphylococcus aureus) Klebsiella pneumoniae, 220 rpm; 37°C for 7h; 10 5-6 individuals / mL; Staphylococcus aureus, 220 rpm; 37°C for 7h; 10 5-6 individuals / mL Take a piece of mouse lung tissue 0.3g, add two kinds of bacteria liquid 650 μL each, mix well and grind; Take 200 μl as Saponin group.

[0032] (2) Host cell lysis: (2.1) Add 200 μL 4.4% Saponin solution to the Saponin group, incubate at room temperature for 10 minutes; (2.2) Add 220 μL RNase-free water, and incubate at room temperature for 30 seconds; (2.3) Add 8 μL of 5M NaCl, and mix well; (2.4) Centrifuge at 10000 g for 3 minutes, remove the supernatant, and add 200 μL of PBS buffer and mix well; (2.5) Take 100 μL as a control group and 100 μL as an experimental group, respectively; (3) Host nucleic acid removal (3.1) Add 2 μL of 0.1M magnesium chloride to the experimental group; (3.2) Add 2 μL of Benzonase enzyme (final concentration: 2-3 U / μL) to the experimental group, and incubate at 37°C for 30 minutes; (3.3) Add 300 μL of blood RNA stabilizing solution to the control group and the experimental group, and incubate at 70°C for 30 minutes to obtain samples with host nucleic acid removed; (4) Target nucleic acid extraction: The following reagents are from High pure PCR Template preparation kit (Roche).

[0033] (4.1) Prepare a 1.5 mL centrifuge tube, and add 200 μL of sample; (4.2) Add 10 μL of lysozyme (10 mg / mL), and incubate at 37°C for 15 minutes; (4.3) Add 200 μL of Binding buffer and 40 μL of proteinase K (10 mg / mL), mix well, and incubate at 70°C for 10 minutes; (4.4) Add 100 μL of isopropyl alcohol and mix well; (4.5) Assemble the filter tube and the collection tube, and add the reaction solution to the filter tube, and centrifuge at 8000 g for 1 minute to discard the supernatant; (4.6) Discard the collection tube, assemble a new collection tube, add 500 μL of Inhibit Buffer, and centrifuge at 8000 g for 1 minute to discard the supernatant; (4.7) Discard the collection tube, assemble a new collection tube, add 500 μL of Wash Buffer, and centrifuge at 8000 g for 1 minute to discard the supernatant; (4.8) Discard the collection tube again, assemble a new collection tube, add 500 μL of Wash Buffer, and centrifuge at 8000 g for 1 minute to discard the supernatant; (4.9) Discard the collection tube, assemble a new collection tube, centrifuge at 13000 g for 10 seconds to discard the supernatant; (4.10) Discard the collection tube, put the filter tube into a 1.5 mL centrifuge tube, add 50 μL of 70°C nuclease-free water, stand for 3 minutes, centrifuge at 8000 g for 1 minute, discard the supernatant, and obtain a sample enriched in foreign nucleic acids; (5) Detect CT value Use the TaKaRa TB Green Fast qPCR Mix kit, refer to the instructions to configure the TB Green Fast qPCR Mix reaction system, and perform qPCR detection.

[0034] 5.1 Prepare 1.5 mL centrifuge tubes, and perform detection according to 8 reaction systems (one of which is a negative control group, and the negative control is a host nucleic acid sample added with nuclease-free water and directly treated according to steps (1)~(4.10)), and the configuration is as shown in Table 1: Table 1 Reaction system for detecting CT value

[0035] Primer: housekeeping gene primer

[0036] Mouse

[0037] m-Actb-F (SEQ ID NO. 1): GGCTGTATTCCCCTCCATCG

[0038] m-Actb-R (SEQ ID NO. 2): CCAGTTGGTAACAATGCCATGT

[0039] Klebsiella pneumoniae

[0040] p-Kp300-wzi-F1 (SEQ ID NO. 3): GGGTCATCCATCTGAGCCTG

[0041] p-Kp300-wzi-R1 (SEQ ID NO. 4): TGGTTGATACGGGCCAGAAC

[0042] Staphylococcus aureus

[0043] p-op1361-F (SEQ ID NO. 5): GCGATTGATGGTGATACGGTT

[0044] m-op1361-R (SEQ ID NO. 6): AGCCAAGCCTTGACGAACTAAAGC

[0045] (5.2) Put the prepared reaction system into eight continuous rows, and then add 2 μL of nucleic acid (add 2 μL of nucleic enzyme-free water for negative control) and mark; (5.3) After transient centrifugation, put into a qPCR instrument; (5.4) Machine operation; place the pcr tube in the qPCR instrument and set the temperature as follows: Hot cover temperature: 105℃ Step 1: Pre-denaturation 94℃ 30 seconds One cycle Step 2: PCR reaction 94℃ 5 seconds Annealing 60℃ 10 seconds 40 cycles Step 3: Check the melting curve analysis Check the scanning in the annealing stage, confirm that the program setting is correct, mark the corresponding sample, start the experiment, and get the CT value after the experiment.

[0046] Experimental results: as shown in Figure 1 In the mouse lung tissue sample, the mouse nucleic acid removal effect of the technical solution is more than 10 CT values, while the Klebsiella pneumoniae and Staphylococcus aureus are less affected and fluctuate within 0-2 CT values. The results show that the scheme removes most of the mouse nucleic acid and has little effect on the two detection bacteria, and achieves good host removal effect.

[0047] Example 2

[0048] Replace the mouse lung tissue in Example 1 with mouse liver tissue, and use the same amount, and other operations are the same as in Example 1.

[0049] The experimental results are shown in Figure 2 In the mouse liver tissue sample, the mouse nucleic acid removal effect of the technical solution is more than 10 CT values, while the Klebsiella pneumoniae and Staphylococcus aureus are less affected and fluctuate within 0-2 CT values. The results show that the scheme removes most of the mouse nucleic acid and has little effect on the two detection bacteria, and achieves good host removal effect.

[0050] Example 3

[0051] Replace the mouse lung tissue in Example 1 with mouse blood, and the mouse blood is 1 mL, and other operations are the same as in Example 1.

[0052] The experimental results are shown in Figure 3As shown, in the mouse blood samples, the mouse nucleic acid removal effect of the present technical solution exceeds 10 CT values, and exceeds 35 CT values, while Klebsiella pneumoniae and Staphylococcus aureus are less affected, with fluctuations of 0-2 CT values, and the results show that the present solution basically removes mouse nucleic acid and has less effect on the two detection bacteria, and achieves good host removal effect.

[0053] In summary, when facing samples with high host background, the present application can basically remove host nucleic acid substances while having less effect on pathogenic microorganism nucleic acid substances, effectively removing host nucleic acid, improving the detection rate and number of pathogenic microorganism gene sequences, and the method is relatively stable and is expected to be used for further preclinical research.

[0054] Example 4

[0055] (1) Pick single clone bacteria (Klebsiella pneumoniae)

[0056] Klebsiella pneumoniae, 220 rpm; 37℃ culture for 7h; Take 1g of mouse lung tissue, add 1000 μL (10 5-6 Each of the two bacteria liquid, mix thoroughly; Take 200 μl as the Saponin group: Enter step 2, start the experimental process of the present patent; (2) Host cell lysis: (2.1) Add 200 μL of 4.4% saponin (Saponin) solution to the Saponin group, and incubate at room temperature for 10 minutes; (2.2) Add 220 μL of RNase-free water, and stand at room temperature for 30 seconds; (2.3) Add 8 μL of 5M NaCl, mix well; (2.4) Centrifuge at 10000 g for 3 minutes, remove the supernatant, and add 200 μL of PBS buffer and mix well; (3) Host nucleic acid removal (3.1) Add 4 μL of 0.1M magnesium chloride to the experimental group; (3.2) Add 4 μL of Benzonase enzyme (final concentration: 2-3U / μL) to the experimental group, and incubate at 37℃ for 30 minutes; (3.3) Add 600 μL of blood RNA stabilizing solution, incubate at 70℃ for 30 minutes, centrifuge at 10000g for 3min, remove the supernatant, add 200 μL of PBS buffer and mix well, to obtain the sample removed of host nucleic acid; Other steps are the same as in Example 1.

[0057] Comparative Example 1

[0058] Picked monoclonal bacteria (Klebsiella pneumoniae)

[0059] Klebsiella pneumoniae, 220 rpm; 37°C culture for 7h; Take 1g of mouse lung tissue, add two kinds of bacteria liquid each 1000 μL (10 5-6 copies / mL), mix and grind thoroughly; Take 200 μl as a control group: Take 200 μl as a commercial kit HostZERO™ Microbial DNA Kit group: Perform host removal experiment using the standard process of the commercial kit; Commercial kit host removal process: (1) Host cell lysis: (2.1) Add 1 mL Host DNA Depletion Solution to the commercial kit HostZERO™ Microbial DNA Kit group; (2.2) Incubate the above sample upside down at room temperature (20-30°C) for 15 min; (2.3) Centrifuge at 10000 g for 5 min; (2.4 Remove the supernatant and add 100 μL Microbail Selection Buffer to resuspend; (2.5) Add 1 μL Microbail Slection Enztme and mix well, incubate at 37°C for 30 min; (2.6) Add 20 μL Proteinase K and vortex for 10 seconds, incubate at 55°C for 10 min; (2.7) Add 100 μL DNA / RNA Shield (2X Concentrate) and incubate at room temperature (20-30°C) for 5 min; (2.8) Remove the supernatant and add 100 μL Microbail Selection Buffer to resuspend; Extract the target nucleic acid according to the instructions of the commercial kit.

[0060] Experimental Example 1

[0061] Compare the experimental results of Example 4 with those of Comparative Example 1. The extracted nucleic acids are detected by qPCR, and the removal effect of mouse nucleic acids is judged by the change of CT value. The sample to be tested in this example is mouse lung tissue, which is used to detect bacteria (Klebsiella pneumoniae).

[0062] The experimental results are shown in Table 1. Figure 4 As shown in Table 1, the CT average values of the mice groups of the control group (described in Comparative Example 1), the Example 4 group (Saponin group), and the commercial kit group are 18.78, 30.42, and 25.50, respectively; and the CT average values of the Klebsiella pneumoniae group are 23.89, 22.80, and 23.31, respectively.

[0063] That is, the mouse nucleic acid removal effect of the present application is more than 10 CT values, and the mouse nucleic acid removal effect of the commercial kit HostZERO™ Microbial DNA Kit (article number: D4310) is within 7 CT values. In the Klebsiella pneumoniae group, both methods have a certain enrichment effect, and the enrichment effect of the present application group is better.

[0064] In summary, the method of the present application is superior to the commercial kit HostZERO™ Microbial DNA Kit (article number: D4310) in removing mouse hosts and enriching target bacteria.

[0065] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.

Claims

1. A method for host nucleic acid removal for high-throughput sequencing, characterized by, The method comprises the following steps: 1) mixing the sample with a saponin solution to obtain a sample solution; 2) mixing the sample solution with water, and then mixing with NaCl with a final concentration of 0.03-0.1 M to obtain a sample lysate, centrifuging the sample lysate to discard the supernatant, diluting with a buffer to obtain a purified solution; 3) mixing the purified solution, magnesium chloride with a final concentration of 1-3 mM, and Benzonase enzyme with a final concentration of 2-4 U / μL to obtain a digestion solution; 4) mixing the digestion solution with a blood RNA stabilizing solution to inactivate the enzyme, and obtaining a sample from which host nucleic acids are removed.

2. The method of dehosting nucleic acids of claim 1, wherein, In step 1), the volume ratio of the sample to the saponin solution is 1:0.5-3; The mass concentration of the saponin solution is 3%-6%; In step 1), the mixing time is 5-15 min, and the mixing temperature is 16-28℃.

3. The method of dehosting nucleic acids of claim 1, wherein, In step 2), the volume ratio of the sample solution to water is 1-3:1; The mixing time of the sample solution and water is 15-60 s, and the mixing temperature is 16-28℃; The centrifugal force of the centrifugation is 5000-15000 g, and the centrifugation time is 1-5 min; The volume ratio of the sample solution to the buffer is 1-3:

1.

4. The method of dehosting nucleic acids of claim 1, wherein, In step 3), the mixing temperature is 35-40℃, and the mixing time is 20-40 min.

5. The method of dehosting nucleic acids of claim 1, wherein, In step 4), the enzyme inactivation temperature is 60-80℃, and the enzyme inactivation time is 20-40 min.

6. A method for improving the detection rate of an exogenous nucleic acid, characterized by, The method comprises the following steps: S1. mixing the sample from which host nucleic acids are removed obtained by the method for removing host nucleic acids according to any one of claims 1-5 with lysozyme with a final concentration of 0.1-1 mg / mL to obtain a lysate containing foreign nucleic acids; S2. mixing the lysate containing foreign nucleic acids, Binding buffer, and proteinase K, and then mixing with isopropanol to obtain a DNA extraction solution; S3. washing the DNA extraction solution 2-7 times to obtain a sample rich in foreign nucleic acids.

7. The method of claim 6, wherein, In step S1, the mixing temperature is 35-40℃, and the mixing time is 10-20 min.

8. The method of claim 6, wherein, In step S2, the volume ratio of the lysate containing foreign nucleic acids, Binding buffer, proteinase K, and isopropanol is 150-250:150-250:20-60:80-120; The mixing temperature of the lysate containing foreign nucleic acids, Binding buffer, and proteinase K is 60-80℃, and the mixing time is 5-20 min.

9. The method of claim 6, wherein, In step S3, the centrifugal force of the centrifugation is 5000-10000 g, and the centrifugation time is 0.5-2 min.

10. The method of claim 9, wherein, The washing comprises the following steps: washing with a buffer for 2-5 times, centrifuging to discard the supernatant, treating with water at 60-80℃ for 2-4 min, centrifuging to discard the supernatant, and obtaining a sample rich in foreign nucleic acids.

Citation Information

Patent Citations

  • Kit for extracting microbial genome DNA from blood and method thereof

    CN110438120A

  • Method for selectively removing host nucleic acid in liquid biological sample

    CN112813137A