Method of characterizing biomolecule of interest

Abstract

The invention provides a method for characterizing a target biomolecule, a connection method or a preparation method of a sequencing library, an activated linker, a method for preparing the activated linker, a kit for nanopore sequencing and application of the activated linker in nanopore sequencing.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of sequencing, in particular to a method for characterizing a target biomolecule, a ligation method or a method for preparing a sequencing library, an activated linker, a method for preparing an activated linker, a kit for nanopore sequencing, and the use of an activated linker in nanopore sequencing. BACKGROUND

[0002] With the rapid development of life sciences, high-throughput sequencing technology is becoming more and more mature, and plays an increasingly important role in scientific research, medical treatment, disease control and other fields. Compared with traditional Sanger sequencing method, second-generation sequencing technology and third-generation sequencing technology based on single molecule technology have advantages in sequencing throughput, use cost and reaction time, and have gradually become the mainstream in the market. In the library construction process of second-generation and third-generation sequencing, specific nucleic acid adapters need to be connected to target biomolecules to facilitate subsequent bridge amplification (Illumina NGS) or guide nucleic acids through nanopores (nanopore sequencing), so library construction is a key link that affects sequencing quality and throughput.

[0003] Traditional library construction work relies on DNA ligase (e.g., T4 DNA ligase, T7 DNA ligase, Taq DNA ligase, etc.) to connect sequencing adapters or sequencing adapter precursors to blunt ends or sticky ends of nucleic acids to be tested. After the reaction is terminated, the excess enzyme and unreacted adapter are removed by purification, so that the target biomolecule becomes an object that can be amplified or directly sequenced. The library construction technology based on DNA ligase has many defects: 1) This method requires that the 5' end of the nucleic acid to be tested has a phosphorylation modification and the 3' end has an adenosine overhang, which increases the difficulty and complexity of library preparation; 2) The addition of polyethylene glycol can significantly improve the ligation speed and efficiency of DNA ligase, but increases the self-ligation probability of the adapter and the target product, causing a decrease in detection throughput and accuracy; 3) After the reaction is completed, the DNA ligase needs to be inactivated by heat denaturation, and a purification step is needed to remove free ligase and adapters, increasing the operation difficulty and length.

[0004] The main workflow of the existing technical solution is: 1) end repair-phosphorylation-3' end A addition reaction (1 hour) on the sample to be tested; 2) magnetic bead purification to recover nucleic acid fragments (30 minutes); 3) ligation of adapters by DNA ligase (10 minutes); 4) magnetic bead purification to recover nucleic acid library (30 minutes). The library construction time of more than 2 hours cannot meet the user's demand for rapid library construction.

[0005] Compared with DNA ligase, topoisomerase has obvious advantages in reaction speed and ligation efficiency. In theory, topoisomerase can be used to connect sequencing adapters to the ends of nucleic acid molecules to be detected to complete sequencing library construction. However, the difficulty lies in that the adapter with a 5' end overhanging sticky end cannot be directly connected to the sample with a blunt end or a 3' A-added sample, which greatly limits its practicability in library construction. In addition, the 40-minute library construction time (10 minutes for adapter connection and 30 minutes for magnetic bead purification) still cannot meet the user's demand for rapid library construction.

[0006] Therefore, there is a continuous need in the art to provide a method for characterizing a target biomolecule, which can overcome one or more of the above-mentioned defects. SUMMARY

[0007] To solve the above technical problems, the present inventors have creatively designed a method for characterizing a target biomolecule. By using this method, compared with directly purifying the ligation product, the time for preparing the sequencing library is short, the operation is simple, the loss of the ligation product is reduced, and compared with not purifying the ligation product and not performing solid-phase treatment, the efficiency of nanopore sequencing of the target biomolecule can be improved.

[0008] In a first aspect of the present disclosure, a method for characterizing a target biomolecule can be provided, comprising:

[0009] providing conditions for connecting the target biomolecule and the adapter using topoisomerase to obtain a first liquid phase product,

[0010] removing free topoisomerase, and / or topoisomerase-bound adapters, and / or topoisomerase-bound target biomolecules in the first liquid phase product by solid-phase topoisomerase to obtain a second liquid phase product,

[0011] contacting the second liquid phase product or a third product containing the target biomolecule after purification thereof with a pore, allowing the target biomolecule to pass through and move relative to the pore, and obtaining one or more measurement values representing one or more characteristics of the target biomolecule.

[0012] In a second aspect of the present disclosure, a ligation method or a method for preparing a sequencing library can be provided, comprising:

[0013] providing conditions for connecting the target biomolecule and the adapter using topoisomerase to obtain a first liquid phase product,

[0014] removing free topoisomerase, and / or topoisomerase-bound adapters, and / or topoisomerase-bound target biomolecules in the first liquid phase product by solid-phase topoisomerase to obtain a second liquid phase product.

[0015] In a third aspect of the present disclosure, an activated adaptor can be provided, comprising a first segment and a second segment, the 3' end of the first segment comprising the topoisomerase recognition sequence, the topoisomerase recognition sequence being covalently coupled to the topoisomerase, the 5' end of the second segment comprising at least a portion of the reverse complement of the topoisomerase recognition sequence and optionally additional sequences, the topoisomerase recognition sequence and the at least a portion of the reverse complement of the topoisomerase recognition sequence annealing to form a first duplex structure,

[0016] wherein the topoisomerase has an activity of linking a target biomolecule to the 3' end of the first segment, the target biomolecule comprising a hydroxyl group at the 5' end.

[0017] In a fourth aspect of the present disclosure, a method for preparing the activated adaptor of the third aspect of the present disclosure can be provided, the method comprising: reacting a topoisomerase with a first duplex, wherein the first duplex comprises a topoisomerase recognition sequence and a reverse complement of the topoisomerase recognition sequence, the topoisomerase recognition sequence and the reverse complement of the topoisomerase recognition sequence annealing to form a second duplex structure.

[0018] In a fifth aspect of the present disclosure, a kit for nanopore sequencing can be provided, comprising the activated adaptor of the third aspect of the present disclosure or prepared by the method of the fourth aspect of the present disclosure.

[0019] In a sixth aspect of the present disclosure, the use of the activated adaptor of the third aspect of the present disclosure or prepared by the method of the fourth aspect of the present disclosure in nanopore sequencing can be provided. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present disclosure, the drawings needed to be used in the specific implementation manner description will be briefly introduced as follows.

[0021] Figure 1 A schematic diagram of a method for preparing a sequencing library according to some embodiments of the present disclosure is shown.

[0022] Figure 2 A schematic diagram of a method for preparing an activated adaptor according to some embodiments of the present disclosure is shown.

[0023] Figure 3 The results of detecting the efficiency of preparing the activated adaptor in Example 1 are shown.

[0024] Figure 4The figure shows the relationship between the amount of PNK added and the efficiency of activated linker preparation. A. The pre-activated linker (also known as "pre-activated linker") used in this experiment, activated linker and activation process. B. Different amounts of PNK (0-40 U) were added to the linker activation system, and after the reaction was completed, the bands were separated by denaturing polyacrylamide gel electrophoresis to detect the efficiency of linker activation. C. The activation efficiency was quantitatively analyzed by calculating the gray scale of the product. The abscissa is the amount of PNK added, and the ordinate is the efficiency of linker activation.

[0025] Figure 5 The figure shows the preparation of blunt-end activated linkers and 3' end T overhanging sticky-end activated linkers according to some embodiments of the present disclosure.

[0026] Figure 6 The figure shows the preparation results of blunt-end and sticky-end activated linkers according to some embodiments of the present disclosure.

[0027] Figure 7 The figure shows the connection of activated linkers and test DNA according to some embodiments of the present disclosure.

[0028] Figure 8 The figure shows the connection results of sticky-end activated linkers and test DNA according to some embodiments of the present disclosure.

[0029] Figure 9 The figure shows the connection results of blunt-end activated linkers and test DNA according to some embodiments of the present disclosure.

[0030] Figure 10 The figure shows the second linker-activated linker-test DNA connection reaction according to some embodiments of the present disclosure.

[0031] Figure 11 The figure shows the activated linker-test DNA connection reaction according to some embodiments of the present disclosure.

[0032] Figure 12 The figure shows the difference in the flow of traditional library construction method and library construction method of the present disclosure.

[0033] Figure 13 The figure shows the method for preparing modified activated sequencing linkers according to some embodiments of the present disclosure.

[0034] Figure 14 The figure shows the results of purifying modified activated sequencing linkers by HPLC. A. The purification results of sticky-end products, peak 3 is the target product peak; B. The purification results of blunt-end products, peak 3 is the target product peak.

[0035] Figure 15The purity detection results of the product obtained by the ligation method according to some embodiments of the present disclosure are shown. A. The results after the sticky end product is connected with the linker and purified, peak 1 represents the free activated linker, peak 2 represents the target nucleic acid to be connected, peak 3 represents the single-end ligation product, peak 4 represents the double-end ligation product, blue represents the product before magnetic bead purification, and red represents the product after magnetic bead purification; B. The results after the blunt end product is connected with the linker and purified, peak 1 represents the free activated linker, peak 2 represents the target nucleic acid to be connected, peak 3 represents the single-end ligation product, peak 4 represents the double-end ligation product, blue represents the product before magnetic bead purification, and red represents the product after magnetic bead purification.

[0036] Figure 16 The scheme diagram of the ligation method according to some other embodiments of the present disclosure is shown.

[0037] Figure 17 The purity detection results of the product obtained by the ligation method according to some other embodiments of the present disclosure are shown. Peak 1 represents the free activated linker, peak 2 represents the target nucleic acid to be connected, peak 3 represents the single-end ligation product, and peak 4 represents the double-end ligation product. A, the ligation product of the blunt end nucleic acid and the linker; B, the ligation product of the sticky end nucleic acid and the linker. DETAILED DESCRIPTION

[0038] Unless otherwise indicated, the use of all numbers in the present description and claims is to be understood as being modified in all instances by the term "about" or "approximately". Thus, for example, "about 30" or "approximately 30" is to be understood as not being a literal 30, but rather 30 + / - a suitable experimental error for the particular parameter as would be understood by one of ordinary skill in the art to which the disclosure pertains. Similarly, the use of "substantially" is to be understood as not being literal, but rather "substantially" is to be understood as "essentially" or "for all practical purposes”. In addition, the use of "at least” or "at most” is to be understood as not being a literal inclusion of the upper or lower limit, respectively, but rather the use of "at least” or "at most” is to be understood as "greater than or equal to" or "less than or equal to”, respectively, as would be understood by one of ordinary skill in the art to which the disclosure pertains.

[0039] Notwithstanding that the numerical ranges and parameters setting forth the broadest scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Every numerical range given throughout this specification will include every narrower numerical range falling within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0040] As used herein, unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation.

[0041] In a first aspect of the present disclosure, a method for characterizing a target biomolecule can be provided, comprising:

[0042] providing conditions for a topoisomerase to link the target biomolecule and the linker, to obtain a first liquid phase product,

[0043] removing free topoisomerase, and / or topoisomerase-bound linker, and / or topoisomerase-bound target biomolecule in the first liquid phase product by solidifying the topoisomerase, to obtain a second liquid phase product,

[0044] contacting the second liquid phase product or a third product containing the target biomolecule after purification thereof with a pore, allowing the target biomolecule to pass through and move relative to the pore, and obtaining one or more measurement values representing one or more characteristics of the target biomolecule.

[0045] As used herein, a "target biomolecule" can include any biomolecule that needs to be sequenced. In some embodiments of the disclosure, the target biomolecule includes a polynucleotide, a polypeptide, a polysaccharide, a lipid. In some embodiments, the target biomolecule is DNA or RNA. In some embodiments, the target biomolecule includes a fully double-stranded polynucleotide, a partially double-stranded polynucleotide, or a single-stranded polynucleotide.

[0046] The linking can be performed under any conditions that allow the linker to be linked to the target biomolecule through the action of the topoisomerase. In some embodiments of the disclosure, the linking reaction is performed under conditions in which the topoisomerase is active. In some embodiments of the disclosure, the conditions, such as temperature, for performing the linking reaction include 0°C-50°C, 0°C-45°C, 0°C-40°C, 4°C-40°C, 4°C-39°C, 4°C-38°C, 4°C-37°C, 10°C-40°C, 15°C-40°C, 20°C-40°C, 25°C-40°C, 30°C-40°C, 35°C-40°C, 35°C-40°C, 37°C-40°C, 10°C-39°C, 15°C-39°C, 20°C-39°C, 25°C-39°C, 30°C-39°C, 35°C-39°C, 36°C-39°C, 37°C-39°C, 10°C-38°C, 15°C-38°C, 20°C-38°C, 25°C-38°C, 30°C-38°C, 35°C-38°C, 36°C-38°C, 37°C-38°C, 10°C-37°C, 15°C-37°C, 20°C-37°C, 25°C-37°C, 30°C-37°C, 35°C-37°C, 36°C-37°C, or about 37°C.

[0047] Under appropriate conditions, the linker is linked to the end of the target biomolecule through the action of the topoisomerase coupled to the topoisomerase recognition sequence in the linker, while the topoisomerase is released.

[0048] In some embodiments of the disclosure, the linker is attached at both ends of the target biomolecule. In some embodiments of the disclosure, the linker is attached at only one end of the target biomolecule.

[0049] In some embodiments of the disclosure, the molar ratio of the linker to the target biomolecule is 1:100 to 100:1, 1:50 to 50:1, 1:20 to 20:1, 1:10 to 10:1, 1:10 to 5:1, 1:10 to 4:1, 1:10 to 3:1, 1:10 to 2:1, 1:10 to 1:1, 1:5 to 10:1, 1:5 to 5:1, 1:5 to 4:1, 1:5 to 3:1, 1:5 to 2:1, 1:5 to 1:1, 2:5 to 10:1, 2:5 to 5:1, 2:5 to 4:1, 2:5 to 3:1, 2:5 to 2:1, 2:5 to 1:1, 4:5 to 10:1, 4:5 to 5:1, 4:5 to 4:1, 4:5 to 3:1, 4:5 to 2:1, 4:5 to 1:1, 8:5 to 10:1, 8:5 to 5:1, 8:5 to 4:1, 8:5 to 3:1, 8:5 to 2:1, 8:5 to 1:1, 1:4 to 10:1, 1:4 to 5:1, 1:4 to 4:1, 1:4 to 3:1, 1:4 to 2:1, 1:4 to 1:1, 1:3 to 10:1, 1:3 to 5:1, 1:3 to 4:1, 1:3 to 3:1, 1:3 to 2:1, 1:3 to 1:1, 1:2 to 10:1, 1:2 to 5:1, 1:2 to 4:1, 1:2 to 3:1, 1:2 to 2:1, 1:2 to 1:1, 1:1 to 10:1, 1:1 to 5:1, 1:1 to 4:1, 1:1 to 3:1, 1:1 to 2:1, 1:1 to 1:1, 2:1 to 10:1, 2:1 to 5:1, 2:1 to 4:1, 2:1 to 3:1, 3:1 to 10:1, 3:1 to 5:1, 3:1 to 4:1, 4:1 to 10:1, 4:1 to 5:1, or 5:1 to 10:1.

[0050] In some embodiments of the disclosure, the linker and the target biomolecule each have a cohesive end. In some embodiments of the disclosure, the linker and the target biomolecule each have a blunt end.

[0051] In some embodiments of the disclosure, the molar ratio of the linker having a cohesive end to the target biomolecule having a cohesive end is 1:1 to 3:1. In some embodiments of the disclosure, the molar ratio of the linker having a cohesive end to the target biomolecule having a cohesive end is 2:1.

[0052] In some embodiments of the disclosure, the molar ratio of the linker having a blunt end to the target biomolecule having a blunt end is 3:1 to 5:1. In some embodiments of the disclosure, the molar ratio of the linker having a blunt end to the target biomolecule having a blunt end is 4:1.

[0053] The ligation of the adapters according to some embodiments of the disclosure to the DNA to be tested is shown in Figure 7 as shown, including ligation of an adapter with a sticky end to a target biomolecule with a sticky end, and ligation of an adapter with a blunt end to a target biomolecule with a blunt end.

[0054] In some embodiments of the disclosure, the topoisomerase is bound to the surface of the solid phase material.

[0055] In some embodiments of the disclosure, the solid phase material includes, but is not limited to, magnetic beads, silica, silicates, organic materials.

[0056] In some embodiments of the disclosure, the solid phase material includes magnetic beads, and the separation of the solid phase liquid phase components (removal of the solid phase material) is achieved using the interaction of the magnetic beads with a magnetic field.

[0057] In some embodiments of the disclosure, the separation (removal of the solid phase material) is achieved by a gravitational field or by filtration.

[0058] In some embodiments of the disclosure, the throughput and / or the time length of characterizing the target biomolecule is increased.

[0059] In some embodiments of the disclosure, the pores are nanopores, and / or biological pores, solid state pores, or hybrid biological and solid state pores.

[0060] In some embodiments of the disclosure, the biological pores are preferably derived from hemolysin, leukocidin, CsgG, Mycobacterium smegmatis porin A (MspA), porin B, porin C, porin D, outer membrane porin F, outer membrane porin G, outer membrane phospholipase A, Neisseria autotransporter lipoprotein, and WZA.

[0061] In some embodiments of the disclosure, the solid state pores are preferably derived from graphene nanopores, MoS2 nanopores, BN nanopores, or PA63 nanopores.

[0062] In some embodiments of the disclosure, the means of solid phase immobilization of the topoisomerase includes binding the topoisomerase in the first liquid phase product, and / or the topoisomerase-bound adapters, and / or the topoisomerase-bound target biomolecules, to the surface of a solid phase material (e.g., a solid phase support).

[0063] Preferably, the means of solid phase immobilization of the topoisomerase further includes removal of the solid phase material obtained after the binding, and / or the method of binding the topoisomerase to the surface of the solid phase material includes a step of incubation.

[0064] Preferably, the topoisomerase binds to the surface of the solid phase material by at least one of the following ways:

[0065] (1) by binding of a first molecule associated with the topoisomerase and a second molecule associated with the solid phase material;

[0066] (2) by an anti-topoisomerase antibody provided on the surface of the solid phase material.

[0067] The first molecule and the second molecule can be any pair of molecules that can specifically bind, including but not limited to biotin / avidin (e.g. biotin / streptavidin, biotin / neutravidin), antibody / antigen, antibody / hapten, DNA / complementary DNA or RNA, enzyme / substrate, enzyme / inhibitor, enzyme / cofactor, receptor / ligand (e.g. hormone / hormone receptor, folate / folate receptor), lectin / carbohydrate, staphylococcal protein A / IgG, cation / anion, spy-tag / spy-catcher, strep-tag (and its mutants) / streptavidin (and its mutants).

[0068] In some embodiments of the present disclosure, the first molecule and the second molecule are biotin / avidin, biotin / biotin antibody, digoxin / digoxin antibody, or FAM / FAM antibody.

[0069] As used herein, "the first molecule and the second molecule are biotin / avidin" covers both "the first molecule is biotin and the second molecule is avidin" and "the first molecule is avidin and the second molecule is biotin". Similar expressions are interpreted in the same way.

[0070] In some embodiments of the present disclosure, a target biomolecule and a linker are connected using a topoisomerase under conditions in which:

[0071] Before the connection, i) at least one end of the target biomolecule or the linker comprises a recognition sequence and / or a recognition structure of the topoisomerase, and / or ii) the topoisomerase binds to at least one end of the target biomolecule or the linker and forms an activated molecule capable of being connected to the linker or an activated linker capable of being connected to the target biomolecule,

[0072] Optionally, in i) and / or ii), the topoisomerase is modified for binding to the surface of the solid phase material and retains the activity of forming the connection,

[0073] After the connection, a covalent connection of a single-stranded nucleic acid or a covalent connection of a double-stranded nucleic acid is formed between the end of the target biomolecule and the end of the linker,

[0074] Preferably, the connection does not add a DNA ligase.

[0075] As used herein, the term "activating linker" or "activating molecule" refers to a linker or molecule in which the 3' end of one strand comprises a topoisomerase recognition sequence that is covalently coupled to a topoisomerase, thereby enabling the activating linker to directly ligate to a target biomolecule of interest comprising a hydroxyl group at the 5' end without the aid of a DNA ligase.

[0076] In some embodiments of the present disclosure, the topoisomerase comprises a type I topoisomerase and / or a type II topoisomerase, preferably the type I topoisomerase comprises a type IB topoisomerase, more preferably the type IB topoisomerase comprises a vaccinia virus topoisomerase I, preferably the target for the modification of the topoisomerase for binding to the surface of the solid phase material is a thiol group.

[0077] Surprisingly, the inventors of the present application found that the thiol modification has minimal effect on the ligation activity of topoisomerase, such as vaccinia virus topoisomerase.

[0078] In some embodiments of the present disclosure, the activating linker or activating molecule in ii) comprises a first segment and a second segment, the 3' end of the first segment comprises the topoisomerase recognition sequence that is covalently coupled to the topoisomerase, the 5' end of the second segment comprises at least a portion of the reverse complement of the topoisomerase recognition sequence and optionally additional sequences, the topoisomerase recognition sequence and the at least a portion of the reverse complement of the topoisomerase recognition sequence anneal to form a first double-stranded structure,

[0079] wherein the topoisomerase has the activity of ligating a target biomolecule or a linker to the 3' end of the first segment, the target biomolecule or the linker comprising a hydroxyl group at the 5' end,

[0080] Preferably, the 3' end of the first segment of the activating linker or activating molecule is overhanging or missing one or more nucleotides compared to the 5' end of the second segment (i.e. a sticky end ligation product is obtained).

[0081] Surprisingly, the inventors of the present application found that topoisomerase has higher efficiency in sticky end ligation, as demonstrated by the results of Example 4 of the present application; and the throughput, total reads and effective pore time of the sticky end ligation product for nanopore sequencing are significantly higher, i.e. more favorable for improving the throughput of nanopore sequencing, as demonstrated by the results of Example 7 of the present application.

[0082] As used herein, the term "reverse complement" refers to the purine pyrimidine bases on the opposite, parallel strands of a polynucleotide that pair up as base pairs around the helix axis by hydrogen bonding according to the base complementarity rules. That is, adenine A on one strand forms a hydrogen bond with thymine T or uracil U on the other strand; and guanine G forms a hydrogen bond with cytosine C.

[0083] As used herein, the expression "the 3' end of segment X comprises an A sequence" means that the A sequence is located at the 3' end closest to the 3' end of segment X, and other sequences in segment X are located at the 5' end of the A sequence.

[0084] As used herein, the expression "the 5' end of segment Y comprises a B sequence" means that the B sequence is located at the 5' end closest to the 5' end of segment Y, and other sequences in segment Y are located at the 3' end of the B sequence.

[0085] In some embodiments of the present disclosure, the activated linker is connected at both ends of the target biomolecule in nanopore sequencing. In some embodiments of the present disclosure, the activated linker is connected at only one end of the target biomolecule in nanopore sequencing.

[0086] In some embodiments of the present disclosure, the 5' end of the first segment in the activated linker comprises a loading region of a motor protein for controlling the translocation speed of the target biomolecule.

[0087] In some embodiments of the present disclosure, the motor protein comprises a polynucleotide binding protein or a protein translocase.

[0088] In some embodiments of the present disclosure, the polynucleotide binding protein comprises at least one of a DNA polymerase, an RNA polymerase, a helicase, an endonuclease, an exonuclease, a DNA protease, a topoisomerase, a nucleic acid translocase, a nucleic acid nicking enzyme, or any fusion protein thereof.

[0089] In some embodiments of the present disclosure, the protein translocase is an unfoldase, preferably an NTP-driven unfoldase, more preferably an AAA+ enzyme, most preferably a ClpX unfoldase, a VAT unfoldase, a PAN unfoldase, an AMA unfoldase, an MBA unfoldase, a SAMP unfoldase, a ClpA unfoldase, a ClpC unfoldase, or a ClpE unfoldase, or a functional mutant thereof.

[0090] In a second aspect of the present disclosure, a ligation method or a method for preparing a sequencing library can be provided, comprising:

[0091] providing a condition for connecting the target biomolecule and the linker using a topoisomerase to obtain a first liquid phase product,

[0092] The second liquid-phase product is obtained by removing the free topoisomerase and / or the topoisomerase-bound linker or the topoisomerase-bound target biomolecule in the first liquid-phase product through solid-phase topoisomerase.

[0093] In some embodiments of the present disclosure, the ligation method or the method for preparing a sequencing library further comprises the method of the first aspect of the present disclosure.

[0094] By using a solid-phase material and a combination of the first molecule and the second molecule or a combination of the topoisomerase and the anti-topoisomerase antibody (to bind the non-target biomolecule to the surface of the solid-phase material) in the ligation method, it is possible to quickly and conveniently remove the excess (free unreacted) linker and the free topoisomerase after the ligation reaction and byproducts, purify the ligation product of the activated linker and the target biomolecule, and separate and remove the target biomolecule-containing supernatant solution for subsequent reactions. The purification process can be completed in about 2 minutes. In contrast, the method in the prior art purifies the target product by adsorbing the target product on a solid-phase material, and then performing procedures such as rinsing, air-drying, and elution. The total time required is about 30 minutes. Therefore, the method of the present disclosure can meet the user's demand for rapid library construction.

[0095] In some embodiments of the present disclosure, the 5' end of the first segment or the 3' end of the second segment is modified with TCO (trans-cyclooctene).

[0096] In some embodiments of the present disclosure, the method further comprises adding a second duplex (or second linker), one strand of which is modified at the 3' end with TZ (tetrazine). In some embodiments of the present disclosure, the ligation method further comprises connecting the activated linker and the second linker together through a click chemistry reaction.

[0097] In some embodiments of the present disclosure, the second linker-activated linker-target DNA ligation reaction is as shown in Figure 10 In some embodiments of the present disclosure, the 5' end of the first segment or the 3' end of the second segment is modified with TCO (trans-cyclooctene).

[0098] In some embodiments of the present disclosure, the activated linker is connected to a rate-limiting enzyme (including but not limited to a helicase).

[0099] In some embodiments of the present disclosure, the activated linker-target DNA ligation reaction is as shown in Figure 11As shown in the figure, an activated adapter containing both helicase (elliptical) and topoisomerase (square-shaped) was constructed. This adapter was ligated to the blunt-end or sticky-end DNA to be tested under the mediation of topoisomerase, and then nanopore sequencing was performed under the rate-controlled action of helicase.

[0100] Traditional library preparation methods are based on the principle of forward purification: target molecules are bound to the surface of magnetic beads or other materials, while non-target molecules remain free in the solution. The solid-phase material is then separated, and finally, the target product on the material surface is eluted to obtain the purified product. The forward purification process includes steps such as magnetic bead binding, rinsing, drying, and elution, which is relatively cumbersome and takes more than 30 minutes. In contrast, the method disclosed in this paper is based on negative screening: non-target molecules are bound to the surface of magnetic beads or other solid-phase materials, and after separation and removal, the supernatant containing the target nucleic acid is directly aspirated for subsequent reactions. This approach is simple and rapid, completing the purification process in approximately 2 minutes. The differences in the procedures between traditional library preparation methods and the library preparation method disclosed in this paper are as follows: Figure 12 As shown.

[0101] Methods for preparing sequencing libraries according to some embodiments of this disclosure, such as Figure 1 As shown. The library construction process based on topoisomerase consists of four steps: 1) Activated adapter preparation. The topoisomerase recognizes and cleaves the C / TCCTT site on the adapter and covalently binds to the 3' phosphate group of the cleavage site through its own tyrosine hydroxyl group, forming an activated adapter; 2) Sample processing. The DNA to be tested is subjected to end repair-dephosphorylation treatment to form blunt-ended double-stranded DNA with 5' hydroxyl groups; 3) Adapter ligation. The 5' hydroxyl group of the DNA to be tested attacks the phosphate group at the 3' end of the activated adapter, forming a stable phosphodiester bond, and the topoisomerase detaches from the activated adapter; 4) The TCO group at the 3' end of the second adapter reacts with the TZ group at the 5' end of the activated adapter through click chemistry to form a stable covalent link. This product can be directly used for nanopore sequencing after purification.

[0102] Preparation and use of biotin-modified activated linkers according to some embodiments of this disclosure, wherein:

[0103] A. React topoisomerase with NHS-PGE12-biotin molecules, and use the principle of NHS reacting with free primary amines of proteins to couple the biotin group to the surface of the topoisomerase protein.

[0104] B. An activated sequencing adapter is prepared using a modified topoisomerase, which is then linked to the DNA to be tested, releasing the free topoisomerase.

[0105] C. The reacted system is incubated with streptavidin-coated magnetic beads, wherein free topoisomerase and unreacted activated sequencing adaptor are adsorbed to the magnetic beads, and the supernatant after magnetic field adsorption can be directly used for sequencing reaction.

[0106] A method for preparing a sequencing library according to a particular embodiment of the present disclosure, wherein:

[0107] A. Biotin groups are modified on the surface of topoisomerase by NHS and protein amine reaction principle;

[0108] B. An activated adaptor is prepared using topoisomerase modified with biotin and is combined with streptavidin-modified magnetic beads;

[0109] C. The magnetic beads combined with the activated adaptor are used for ligation with DNA to be tested. Free magnetic beads and unreacted adaptors are precipitated by magnetic field adsorption, and the supernatant is directly used for subsequent sequencing reaction.

[0110] In a third aspect of the present disclosure, an activated adaptor can be provided, comprising a first segment and a second segment, the 3' end of the first segment comprising the topoisomerase recognition sequence, the topoisomerase recognition sequence being covalently coupled to the topoisomerase, the 5' end of the second segment comprising at least a portion of the reverse complement of the topoisomerase recognition sequence and an optional additional sequence, the topoisomerase recognition sequence and the at least a portion of the reverse complement of the topoisomerase recognition sequence annealing to form a first double-stranded structure,

[0111] wherein the topoisomerase has an activity of linking a target biomolecule to the 3' end of the first segment, the target biomolecule comprising a hydroxyl group at the 5' end.

[0112] In some embodiments of the present disclosure, the topoisomerase is bound to the surface of a solid phase material.

[0113] In some embodiments of the present disclosure, the topoisomerase is bound to the surface of the solid phase material by at least one of the following ways:

[0114] (1) by binding of a first molecule connected to the topoisomerase and a second molecule connected to the solid phase material;

[0115] (2) by an anti-topoisomerase antibody provided on the surface of the solid phase material.

[0116] In some embodiments of the present disclosure, the type I topoisomerase comprises a type IB topoisomerase, more preferably, the type IB topoisomerase comprises a vaccinia virus topoisomerase I, more preferably, the target of the first molecule connected to the topoisomerase is a thiol group;

[0117] and / or the 5' end of the first segment comprises a loading region of a motor protein;

[0118] and / or the 3' end of the first segment in the activated linker is overhanging or missing one or more nucleotides compared to the 5' end of the second segment (i.e. a sticky end ligation results in a ligation product).

[0119] In a fourth aspect of the present disclosure, a method for preparing the activated linker of the third aspect of the present disclosure can be provided, the method comprising: reacting a topoisomerase with a first duplex, wherein the first duplex comprises a topoisomerase recognition sequence and a reverse complement of the topoisomerase recognition sequence, the topoisomerase recognition sequence and the reverse complement of the topoisomerase recognition sequence annealing to form a second duplex structure.

[0120] As used herein, the term "duplex" refers to a product formed between two nucleic acid strands or two portions of a nucleic acid strand by sequence reverse complementation. In addition to the reverse complemented region, a duplex can also comprise a non-reverse complemented region, that is, a duplex can comprise a double-stranded region and a single-stranded region.

[0121] In some embodiments of the present disclosure, the method comprises: (1) annealing a first single-stranded DNA, a second single-stranded DNA, and a third single-stranded DNA to form a complex, wherein the 5' end of the second single-stranded DNA is reverse complementary to the first single-stranded DNA, and the 3' end of the third single-stranded DNA is reverse complementary to the first single-stranded DNA,

[0122] the sequence in the first single-stranded DNA that is reverse complementary to the 5' end of the second single-stranded DNA and the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA are continuous or are separated by one or more nucleotides,

[0123] the first single-stranded DNA comprises a topoisomerase recognition sequence, and the 5' end of the second single-stranded DNA and the 3' end of the third single-stranded DNA together comprise a reverse complement of the topoisomerase recognition sequence; and

[0124] (2) reacting a topoisomerase with the complex to obtain the activated linker,

[0125] the activated linker comprises a first segment and a second segment, the first segment and the second segment form a duplex, the 3' end of the first segment is reverse complementary to the 5' end of the second segment,

[0126] the 3' end of the first segment is flush with the 5' end of the second segment, or the 3' end of the first segment is overhanging or missing one or more nucleotides compared to the 5' end of the second segment,

[0127] the 3' end of the first segment comprises a topoisomerase recognition sequence, wherein the topoisomerase recognition sequence is covalently coupled to a topoisomerase.

[0128] In some embodiments of the present disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are continuous, or at least partially overlapping, preferably with 1 nucleotide overlapping. In some embodiments of the present disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence have 1, 2, 3, 4, or 5 nucleotide overlapping.

[0129] The method for preparing the activated linker according to some embodiments of the present disclosure is shown in Figure 2 The 56bp single-stranded DNA fragment (44bp before the cleavage site, 12bp after the cleavage site) with FAM and TET fluorescent modification at both ends was annealed with complementary DNA of different lengths (0-12bp bases extended from the cleavage site respectively). After the topoisomerase recognized the structure (T / CCCTT), it was cut and covalently bound to the 3' phosphate group of the cleavage site, forming an activated linker. The reaction product was separated by denaturing polyacrylamide gel electrophoresis, forming four independent bands: 1) single-stranded DNA that was not activated (with FAM and TET fluorescent modification); 2) single-stranded DNA coupled with topoisomerase (with FAM fluorescent modification alone); 3) small fragments cut off (with TET modification); 4) complementary DNA single-strand (without fluorescent modification). The preparation efficiency of the activated linker can be judged by the content change of each band.

[0130] The method for preparing the modified activated sequencing linker according to some embodiments of the present disclosure is shown in Figure 13 First, the active linker was prepared by the topoisomerase activation linker reaction as before, then biotin was covalently bound to the surface of the topoisomerase using the reaction characteristics of maleimide and sulfhydryl, and finally the motor protein was locked in the pore single-strand region of the activated linker to prepare the modified activated sequencing linker.

[0131] In some embodiments of the disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are contiguous. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the sequence that is reverse complementary to the 3' end of the third single-stranded DNA is located at positions 56-66, at which time the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are considered to be contiguous. In some embodiments of the disclosure, the 5' end of the second single-stranded DNA comprises a reverse complement of the topoisomerase recognition sequence. In some embodiments of the disclosure, after the cleavage reaction occurs, the 3' end of the first segment is flush with the 5' end of the second segment. In some embodiments of the disclosure, the activation linker has a blunt end. As used herein, a "blunt end" means that the end of the double-stranded DNA does not have any additional nucleotide sequence, but ends directly with a base pair.

[0132] In some embodiments of the disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are at least partially overlapping. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the sequence that is reverse complementary to the 3' end of the third single-stranded DNA is located at positions 50-63, 51-63, 52-63, 53-63, 54-63, or 55-63, at which time the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are considered to be at least partially overlapping. In some embodiments of the disclosure, after the cleavage reaction occurs, the 3' end of the first segment is overhanging or missing one or more nucleotides compared to the 5' end of the second segment. In some embodiments of the disclosure, the activation linker has a sticky end. In some embodiments of the disclosure, the activation linker has a 3' overhanging or missing sticky end. As used herein, a "sticky end" means that the end of the double-stranded DNA has a single-stranded DNA sequence of a certain length, which can pair with the sticky end of another DNA molecule to form a junction.

[0133] In some embodiments of the disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence overlap by one nucleotide. For example, in the first single-stranded DNA, the topoisomerase recognition sequence is located at positions 50-55, and the sequence that is reverse complementary to the 3' end of the third single-stranded DNA is located at positions 55-63, at which time the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are considered to overlap by one nucleotide. In some embodiments of the disclosure, after the topoisomerase-mediated cleavage reaction, the 3' end of the first segment is overhanging or missing one nucleotide compared to the 5' end of the second segment.

[0134] In some embodiments of the disclosure, the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are separated by, for example, 1, 2, 3, 4, or 5 nucleotides.

[0135] Preparation of blunt-end activated adapters according to some embodiments of the disclosure is shown in Figure 5 wherein:

[0136] A. Schematic of blunt-end activated adapter preparation. The pre-activation adapter is formed by annealing three single-stranded DNA to form a double-stranded DNA product with a nick, which corresponds to the cleavage site. The topoisomerase recognizes the specific sequence to perform the cleavage-ligation reaction to form the activated adapter with a blunt end.

[0137] B. Schematic of activated adapter with 3' end T-overhang sticky end preparation. The pre-activation adapter is formed by annealing three single-stranded DNA to form a double-stranded DNA product with a nick, which is located one base downstream of the cleavage site in the complementary strand. The topoisomerase recognizes the specific sequence to perform the cleavage-ligation reaction to form the activated adapter with a 3' end T-overhang sticky end.

[0138] Topoisomerases are enzymes that modify the topological state of DNA via strand breakage and rejoining. Topoisomerases are classified as type I, which cleaves a single strand of a double-stranded nucleic acid molecule, including type IA and IB topoisomerases, and type II, which cleaves both strands of a nucleic acid molecule (a rotase). As disclosed herein, type I and type II topoisomerases, as well as catalytic domains and mutant forms thereof, can be used to generate the activated adapters provided herein.

[0139] Type IA and IB topoisomerases cleave one strand of a double-stranded nucleic acid molecule. Cleavage of a double-stranded nucleic acid molecule by a type IA topoisomerase produces a 5' phosphate and a 3' hydroxyl at the cleavage site, and the type IA topoisomerase covalently binds to the 5' end of the cleaved strand. In contrast, cleavage of a double-stranded nucleic acid molecule by a type IB topoisomerase produces a 3' phosphate and a 5' hydroxyl at the cleavage site, and the type IB topoisomerase covalently binds to the 3' end of the cleaved strand. Type IA topoisomerases include, for example, E. coli topoisomerase I and topoisomerase III, eukaryotic topoisomerase II, and the archaeal reverse rotase.

[0140] Type IB topoisomerases include nuclear Type I topoisomerases present in all eukaryotic cells and enzymes encoded by vaccinia and other cytoviruses. Eukaryotic Type IB topoisomerases are exemplified by enzymes expressed in yeast, fruit fly, and mammalian cells, including human cells. Viral Type IB topoisomerases are exemplified by enzymes produced by vertebrate poxviruses (vaccinia, Shope fibroma virus, ORF virus, fowlpox virus, and molluscum contagiosum virus), and an insect poxvirus (Melanoplus sanguinipes entomopoxvirus).

[0141] Type II topoisomerases include, for example, bacterial gyrase, bacterial DNA topoisomerase IV, eukaryotic DNA topoisomerase II, and T phage encoded DNA topoisomerases. Like Type IB topoisomerases, Type II topoisomerases have both cleavage and ligation activity. In addition, like Type IB topoisomerases, a substrate double stranded nucleic acid molecule can be prepared such that a Type II topoisomerase can form a covalent bond to one strand at the cleavage site. For example, calf thymus Type II topoisomerase can cleave a substrate double stranded nucleic acid molecule containing a 5' nicked topoisomerase recognition site located three nucleotides from the 5' end, resulting in the resolution of the three nucleotides located 5' to the cleavage site and the covalent binding of the topoisomerase to the 5' end of the double stranded nucleic acid molecule. Moreover, upon contact of such a Type II topoisomerase loaded double stranded nucleic acid molecule with a second nucleic acid molecule containing a 3' hydroxyl, the Type II topoisomerase can ligate the sequences together and then release from the reconstituted nucleic acid molecule.

[0142] In some embodiments of the present disclosure, the topoisomerase comprises a Type I topoisomerase and / or a Type II topoisomerase, preferably the Type I topoisomerase comprises a Type IB topoisomerase, more preferably the Type IB topoisomerase comprises a vaccinia virus topoisomerase I, more preferably the target for modification of the topoisomerase for binding to the surface of the solid phase material is a thiol group.

[0143] In some embodiments of the present disclosure, the third single-stranded DNA is ≥ 5 nt in length. In some embodiments of the present disclosure, the third single-stranded DNA is ≥ 6 nt, ≥ 7 nt, ≥ 8 nt, ≥ 9 nt, ≥ 10 nt, ≥ 11 nt, or ≥ 12 nt in length. In some embodiments of the present disclosure, the third single-stranded DNA is ≥ 12 bp in length.

[0144] In some embodiments of the disclosure, the second single-stranded DNA has a length of 10-140 nt. In some embodiments of the disclosure, the second single-stranded DNA has a length of 20-140 nt, 20-130 nt, 20-120 nt, 20-110 nt, 20-100 nt, 20-90 nt, 20-80 nt, 20-70 nt, 20-60 nt, 20-50 nt, 20-40 nt, 20-30 nt, 30-140 nt, 30-130 nt, 30-120 nt, 30-110 nt, 30-100 nt, 30-90 nt, 30-80 nt, 30-70 nt, 30-60 nt, 30-50 nt, 30-40 nt, 40-140 nt, 40-130 nt, 40-120 nt, 40-110 nt, 40-100 nt, 40-90 nt, 40-80 nt, 40-70 nt, 40-60 nt, 40-50 nt, 50-140 nt, 50-130 nt, 50-120 nt, 50-110 nt, 50-100 nt, 50-90 nt, 50-80 nt, 50-70 nt, 50-60 nt, 60-140 nt, 60-130 nt, 60-120 nt, 60-110 nt, 60-100 nt, 60-90 nt, 60-80 nt, 60-70 nt, 70-140 nt, 70-130 nt, 70-120 nt, 70-110 nt, 70-100 nt, 70-90 nt, 70-80 nt, 80-140 nt, 80-130 nt, 80-120 nt, 80-110 nt, 80-100 nt, 80-90 nt, 90-140 nt, 90-130 nt, 90-120 nt, 90-110 nt, 90-100 nt, 100-140 nt, 100-130 nt, 100-120 nt, or 100-110 nt.

[0145] In some embodiments of the disclosure, the method further comprises adding a reagent capable of phosphorylating the 5' end hydroxyl group to a 5' end phosphate group. The reagent capable of phosphorylating the 5' end hydroxyl group to a 5' end phosphate group includes, but is not limited to, a polynucleotide kinase (PNK).

[0146] In some embodiments of the disclosure, the first single-stranded DNA and the second single-stranded DNA are located on two different strands. In some embodiments of the disclosure, the first single-stranded DNA and the second single-stranded DNA are located on the same strand, i.e., the first single-stranded DNA and the second single-stranded DNA are 2 fragments on the same strand.

[0147] In some embodiments of the present disclosure, the first single-stranded DNA and the third single-stranded DNA are located on two different strands.

[0148] In some embodiments of the present disclosure, the second single-stranded DNA and the third single-stranded DNA are located on two different strands.

[0149] In some embodiments of the present disclosure, the first strand segment and the second strand segment are located on two different strands.

[0150] In a fifth aspect of the present disclosure, a kit for nanopore sequencing can be provided, which comprises the activated linker of the third aspect of the present disclosure or the activated linker prepared by the fourth aspect.

[0151] In a sixth aspect of the present disclosure, the use of the activated linker of the third aspect of the present disclosure or the activated linker prepared by the fourth aspect in nanopore sequencing can be provided.

[0152] The various embodiments and preferences described above can be combined with each other (as long as they are not inherently contradictory with each other), and the various embodiments formed by the combination are all considered part of the disclosure.

[0153] The technical solutions of the present disclosure will be described more clearly and explicitly in the form of examples combined with the examples. It should be understood that these examples are only for illustrative purposes, and are by no means intended to limit the protection scope of the present disclosure. The protection scope of the present disclosure is only limited by the claims.

[0154] Examples

[0155] Unless otherwise stated or obviously contradictory to the context, all percentages in the examples are mass percentages.

[0156] Example 1: Preparation of activated linker coupled with topoisomerase

[0157] 1. Preparation of pre-activated linker

[0158] 1) Synthesize the pre-activated linker DNA fragments respectively, the names and sequences are as follows:

[0159] Adaptor F: FAM- ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTT ATTCCGATAGTG (SEQ ID NO. 1) -TET

[0160] Adaptor R-0: AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT(SEQ ID NO. 2)

[0161] Adaptor R-1 : T AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 3)

[0162] Adaptor R-2 : AT AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 4)

[0163] Adaptor R-5 : GGAAT AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 5) Adaptor R-9 : TATCGGAAT AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 6) Adaptor R-12 : CACTATCGGAATAAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 7)

[0164] Adaptor nick : CACTATCGGAAT (SEQ ID NO. 8)

[0165] 2) Anneal adaptors according to the following list 1, 1x annealing buffer composition: 0.1 M Tris-HCl, 0.1 M NaCl, 0.05 M EDTA. Annealing conditions: 95°C for 2 minutes, decrease by 0.1 °C every 5 seconds until 25°C. Structure after annealing of adaptors is shown in Figure 2 .

[0166] Table 1. Nucleic acid components in each experimental group

[0167]

[0168] 2. Prepare the activation adaptor preparation system, the main components are: 10X topoisomerase reaction buffer (Tris-acetic acid 500Mm pH7.5, sodium chloride 1M, magnesium chloride 25mM, EDTA 1mM) 2ul, pre-activation adaptor 4pmol, vaccinia virus topoisomerase I (D6952, Biyun Tian) 1U, supplemented with deionized water to 20ul. The negative control group (NC) uses the double-stranded nucleic acid labeled 0bp in Table 1, and the topoisomerase in the system is replaced with deionized water, and the other components are consistent with the experimental group. The above reaction system is placed in a 37°C metal bath for 30 minutes, 2ul of the activated product is separated by urea polyacrylamide gel, and the adaptor activation efficiency is detected by gel imaging instrument.

[0169] 3. The experimental results are shown in Figure 3The 5' end FAM group of the activated adaptor covalently binds to the topoisomerase, and is excited by blue light after denaturation and is located in the gel hole at the top of the picture; the unactivated adaptor is a 56bp DNA fragment with FAM and TET groups excited by blue and green light, respectively, and appears cyan in the central position of the picture; the 12bp short fragment cut off during activation has a TET group and is excited by green fluorescence at the bottom of the picture; the structure type of the adaptor before activation is labeled above each lane. It can be clearly seen that the activation efficiency of the adaptor increases first and then decreases with the length of the second single-stranded DNA, and the maximum activation efficiency appears in the "12bp nick" group, i.e., the activated adaptor formed by three single-stranded DNAs, which greatly improves the activation efficiency and obtains a blunt-end activated adaptor.

[0170] Example 2: PNK improves the efficiency of activated adaptor preparation

[0171] 1. Preparation of adaptor before activation. The adaptor DNA fragment before activation was annealed in a ratio of 1:1:1, and the composition of the 1x annealing buffer was: 0.1M Tris-HCl, 0.1M NaCl, 0.05M EDTA. The annealing conditions were: heating at 95℃ for 2 minutes, and then decreasing by 0.1℃ every 5 seconds until 25℃. The names and sequences of the three fragments are as follows:

[0172] Adaptor F': CGGCCAAGCAGAAGACGGCATACGAGATCCCTTGATAGCACGTAG (SEQ ID NO. 9)-FAM

[0173] Adaptor R': AAGGGATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO. 10)-Cy5

[0174] Adaptor 12bp: CTACGTGCTATC (SEQ ID NO. 11)

[0175] 2. Configure the activated adaptor preparation system, the main components are: 10X reaction buffer (Tris-acetic acid 500Mm pH7.5, sodium chloride 1M, magnesium chloride 25mM, EDTA 1mM) 2ul, activated adaptor 4pmol, vaccinia virus topoisomerase I (D6952, Biyun Tian) 1U, ATP 0.5mM, PNK (M0201, NEB) 0U, 1U, 2U, 5U, 10U, 20U, 40U, deionized water to 20ul. The negative control group does not contain topoisomerase and PNK, and the other components remain unchanged.

[0176] 3. React at 37℃ for 30 minutes, take 2ul of the reaction sample and perform urea denaturing polyacrylamide gel electrophoresis separation, and detect the position and fluorescence intensity of each band under a gel imaging system.

[0177] 4. Experimental results are as follows Figure 4 As shown in Figure A, the activation process is illustrated: the 3' end of the 56 bp fragment is modified with FAM, and the 5' end of the 43 bp fragment is labeled with Cy5. The gel image is unstained, therefore all bands shown are excited by the labeled fluorescent molecules. The top band represents the unactivated adapter, containing FAM fluorescent molecules. After adapter activation, the 3' end 12 bp is cleaved, the FAM molecules fall off, and therefore the activated product is not fluorescent and is not shown on the gel image. The middle band represents the 43 bp fragment containing Cy5, and its content remains unchanged throughout the process. The cleaved 12 bp fragment carries FAM fluorescence and is located at the bottom. Because a denaturing gel containing urea is used, the DNA double strand unwinds and exists in a single-stranded state in the gel. In subplots B and C, the concentrations of PNK in each sample were 0 U, 1 U, 2 U, 5 U, 10 U, 20 U, and 40 U, ​​respectively. The results showed that as the amount of PNK added to the reaction system increased, the content of unactivated adapters gradually decreased after the reaction, while the number of small fragments cleaved during the activation process gradually increased. This indicates that the addition of PNK further improved the adapter activation efficiency, and the adapter activation efficiency increased with the increase of PNK content.

[0178] Example 3: Preparation of a viscous end-activated connector with a 3' end T-protrusion and a blunt end-activated connector

[0179] The preparation process of viscous end and blunt end activated joint is as follows: Figure 5 As shown, the specific steps are as follows:

[0180] 1. Preparation of pre-activation adapters. Pre-activation adapters were annealed at a 1:1:1 ratio to prepare blunt-end and sticky-end pre-activation adapters. The 1x annealing buffer consisted of 0.1M Tris-HCl, 0.1M NaCl, and 0.05M EDTA. Annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C. The DNA fragments used in the experiment and their names are shown below:

[0181] 1) Activated connector before viscous end:

[0182] Adaptor F-sticky: FAM-ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTTATTCCGATAGTG (SEQ ID NO. 1) - TET Adaptor R-sticky: AGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 12) Adaptor 13bp: CACTATCGGAATA (SEQ ID NO. 13)

[0183] 2) Blunt pre-activated adaptor:

[0184] Adaptor F-blunt: FAM-ATCTTCGCGTTCTAGGCACTTCACTTTCGTCTTCCACCCCCCTTATTCCGATAGTG (SEQ ID NO. 1) - TET Adaptor R-blunt: AAGGGGGGTGGAAGACGAAAGTGAAGTGCCTAGAACGCGAAGAT (SEQ ID NO. 2) Adaptor 12bp: CACTATCGGAAT (SEQ ID NO. 8)

[0185] 2. Prepare the activation adaptor system, the main components are: 10X reaction buffer (Tris-acetic acid 500Mm pH7.5, sodium chloride 1M, magnesium chloride 25mM, EDTA 1mM) 2ul, activated pre-adaptor 4pmol (the experimental group with blunt end adaptor is marked as "blunt", the experimental group with sticky end is marked as "3'-T"), vaccinia virus topoisomerase I (D6952, Biyun Tian) 1U, ATP 0.5mM, PNK 0U (marked as "-" in Figure 6 ) or 5U (marked as "+" in Figure 6 ), deionized water to 20ul. The NC group does not contain topoisomerase and PNK, and the other components remain the same Figure 6 Figure 6 3. React at 37℃ for 30 minutes, take 2ul of the reaction sample for urea denatured polyacrylamide gel electrophoresis separation, and detect the position and fluorescence intensity of each band under the gel imager.

[0186] 4. The experimental results are shown in , PNK improves the activation efficiency of the sticky end adaptor, and the activation efficiency of the sticky end and blunt end adaptor is relatively close.

[0187] Figure 6

[0188] ​​Example 4: Determination of ligation efficiency between activated adapters and test DNA

[0189] 1. Preparation of nucleic acid samples for testing. The blunt-end and sticky-end nucleic acid fragments to be tested were annealed separately at a 1:1 ratio. The annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C. The required nucleic acid names and sequences are as follows:

[0190] Target-sticky F: CTGCTCATTCGGTCCTGCTGACTTTAAGAGCTGTGCGCCGTA

[0191] (SEQ ID NO.14)

[0192] Target-sticky R: ACGGCGCACAGCTCTTAAAGTCAGCAGGACCGAATGAGCAGA

[0193] (SEQ ID NO.15)

[0194] Target-blunt F:TCTGCTCATTCGGTCCTGCTGACTTTAAGAGCTGTGCGCCGT

[0195] (SEQ ID NO.16)

[0196] Target-blunt R: ACGGCGCACAGCTCTTAAAGTCAGCAGGACCGAATGAGCAGA

[0197] (SEQ ID NO.15)

[0198] 2. Prepare the blunt-end ligation system, the main components of which are: 10X reaction buffer (Tris-acetic acid 500Mm pH7.5, sodium chloride 1M, magnesium chloride 25mM, EDTA 1mM) 1ul, blunt-end nucleic acid to be tested 0-0.5pmol, blunt-end activation adapter 0-2.0pmol, and deionized water to make up to 10ul.

[0199] 3. Prepare the sticky end ligation system, the main components of which are: 1ul of 10X reaction buffer, 0-0.5pmol of sticky end nucleic acid to be tested, 0-1pmol of sticky end activation adapter, and deionized water to make up to 10ul.

[0200] 4. Incubate the above reaction system in a metal bath at 37°C for 10 minutes. Take 2 μL of sample and perform 4-12% non-deformable polyacrylamide gel electrophoresis for separation. After SYBR-gold staining, analyze the band position and gray value.

[0201] 5. Connection diagram as shown Figure 7 As shown, the experimental results are as follows: Figure 8 and 9 As shown, the proportion of target biomolecules completing the ligation reaction gradually increases with the increase of the amount of activated adapter added. The ligation efficiency of the target biomolecules with viscous ends was 82.3% (activated adapter: target biomolecule = 2:1) calculated by grayscale value, and the ligation efficiency of the target biomolecules with blunt ends was 74.6% (activated adapter: target biomolecule = 4:1).

[0202] Example 5: Sequencing library construction and sequencing of amplicon samples

[0203] 1. Preparation of blunt-end amplicon samples. PCR amplification was performed using Pfu DNA polymerase with pUC57 DNA plasmid as a template. The reaction system was as follows: 1X Pfu reaction buffer (20mM Tris-HCl (pH 8.8 at 25℃), 10mM (NH4)2SO4, 2mM MgSO4, 10mM KCl, 0.1% (v / v) Triton X-100, 0.1mg / ml BSA), 0.4μM forward amplification primer, 0.4μM reverse amplification primer, 0.1ng / ul template DNA, 0.2mM dNTPs, and 0.025U / ul Pfu DNA polymerase (D7216, Beyotime). The amplification reaction program was as follows: pre-denaturation: 94℃ for 3 minutes; denaturation: 94℃ for 30 seconds; annealing: 55℃ for 30 seconds; extension: 72℃ for 2 minutes; cycle number: 30; final extension: 72℃ for 10 minutes. After the amplification reaction, band detection was performed using agarose gel electrophoresis, and the target product was recovered using a PCR product recovery kit (D0033, Beyotime). Figure 10 , Figure 11 (The black area on the right side of the image above).

[0204] 2. Preparation of sticky-end amplicon samples. PCR amplification was performed using Taq DNA polymerase with pUC57 DNA plasmid as a template. The reaction system consisted of: 1X Taq reaction buffer (20mM Tris-HCl (pH 8.8 at 25℃), 10mM (NH4)2SO4, 2mM MgSO4, 10mM KCl, 0.1% (v / v) Triton X-100, 0.1mg / ml BSA), 0.4μM forward primer, 0.4μM reverse primer, 0.1ng / ul template DNA, 0.2mM dNTPs, and 0.025U / ul Pfu DNA polymerase (D7205, Beyotime). The amplification program was as follows: pre-denaturation: 94℃ for 3 minutes; denaturation: 94℃ for 30 seconds; annealing: 55℃ for 30 seconds; extension: 72℃ for 2 minutes; cycle number: 30; final extension: 72℃ for 10 minutes. After the amplification reaction was completed, band detection was performed using agarose gel electrophoresis, and the target product was recovered using a PCR product recovery kit (D0033, Beyotime).

[0205] 3. Activated connector connection. Use either a flat-end activated connector modified with TZ or a sticky-end activated connector modified with TZ, respectively. Figure 10 The ligation reaction system for the two amplicon products (the gray area in the middle of the image above) was as follows: 1 μL of 10x reaction buffer (500 M Tris-acetic acid, pH 7.5, 1 M sodium chloride, 25 mM magnesium chloride, 1 mM EDTA), 2 pmol of activated adapter, 0.5 pmol of amplicon product, and deionized water to a final volume of 10 μL. The mixture was incubated at 37°C for 10 minutes. The ligation product was purified and recovered using 0.4X magnetic beads (N411, Novizan) to remove excess activated adapters.

[0206] 4. Sequencing adapter ligation (e.g.) Figure 10 As shown). Take the sequencing adapter modified with TCO (as shown). Figure 10 The black part on the left of the image above is ligated with the above ligation product at a ratio of 2:1 and incubated at room temperature for 1 minute.

[0207] 5. Sequencing was performed using the Qnome3841 nanopore sequencer from QiCarbon Technology Co., Ltd., along with its accompanying reagents, following the instructions for use. The same applies below.

[0208] 6. The sequencing results are shown in Tables 2 and 3.

[0209] Table 2 Sequencing results of sticky-terminated amplification products

[0210]

[0211] Table 3 Sequencing results of blunt-end amplification products

[0212]

[0213] The data in Tables 2 and 3 show that both sticky-end and blunt-end amplification products achieved the same total throughput, MAP throughput, and Q7 throughput as conventional library preparation and sequencing when used for nanopore sequencing. Furthermore, compared to blunt-end amplification products, sticky-end amplification products resulted in higher total throughput, Q7 throughput, MAP throughput, total read count, and effective well time for nanopore sequencing.

[0214] The definitions of the relevant terms are as follows:

[0215] The term "total throughput" refers to the amount of analytes, such as bases, that pass through a nanopore within a given time period.

[0216] The term "Q7 flux" refers to the number of bases with an accuracy of 80% or higher in the total flux.

[0217] The term "Map flux" refers to the number of bases in the total flux that align to the correct position in the reference sequence.

[0218] The term "total number of reads" refers to the number of read segments that pass through a nanopore within a certain period of time.

[0219] The term "Reads length N50" refers to the length of the shortest read among the 50% of the relatively long reads that pass through the nanopore within a certain time.

[0220] The term "effective well time" refers to the total sequencing time of the wells that are effectively sequenced.

[0221] Example 6: Construction and sequencing of E. coli genomic DNA sequencing library

[0222] 1. Pretreatment of *E. coli* genomic DNA samples. The extracted *E. coli* genomic DNA was dephosphorylated using the following reaction mixture: 50 mM potassium acetate, 20 mM Tris-acetic acid (pH 7.9), 10 mM magnesium acetate, 100 μg / ml recombinant albumin, 1 μg *E. coli* genomic DNA, 1 U shrimp alkaline phosphatase (rSAP), and deionized water to a final volume of 20 μL. The reaction mixture was incubated at 37°C for 10 minutes, followed by inactivation at 80°C for 2 minutes. Then, dNTPs (final concentration 1 mM), 1 U T4 DNA polymerase (M0203, NEB), 1 U Klenow DNA polymerase (M0210, NEB), and 1 U Taq DNA polymerase (M0320, NEB) were added. The reaction program was 37°C for 10 minutes, followed by 65°C for 10 minutes. After the reaction, the DNA product was purified using 0.4X magnetic beads (N411, Novizan).

[0223] 2. Take the above DNA sample and ligate it with activated sticky-end adapters modified with TZ groups. The reaction system is as follows: 50 mM tris-acetic acid (pH 7.5), 100 mM NaCl, 2.5 mM MgCl2, 1 mM EDTA, 100 ng of treated genomic DNA, 2 pmol of activated sticky-end adapters modified with TZ, and deionized water to make up to 10 μL. Incubate at room temperature for 1 minute. Then purify with 0.4X magnetic beads to remove excess activated adapters.

[0224] 3. Ligate sequencing adapters. Add 2 pmol of sequencing adapters containing TCO groups to the above reaction system, incubate at room temperature for 1 minute, and then proceed with sequencing.

[0225] 4. The sequencing results are shown in Table 4.

[0226] Table 4. Escherichia coli genome sequencing results

[0227]

[0228] The data in Table 4 show that the total throughput, MAP throughput, Q7 throughput, and other parameters all reach the level of conventional library preparation and sequencing.

[0229] Example 7: Preparation and sequencing of activated sequencing adapters

[0230] This embodiment prepares a topoisomerase-activated sequencing adapter by reacting a topoisomerase with a pre-sequencing adapter. For example... Figure 11 As shown, activated sequencing adapters can be directly linked to target biomolecules to complete library construction. The main construction steps of activated sequencing structures are as follows:

[0231] 1. Synthesize the adapter DNA strand before activation and sequence it. The name and sequence are as follows:

[0232] 1) Sequencing adapter DNA strands before sticky end activation:

[0233] Adaptor I: 5'-(C3 spacer)30-ATCCTTTTTAGAATTTTAGAGATTTTTTTTTTT(SEQ ID NO.17)-(iSp18)4-AGAGATTCAGAGATCCCTTGATAGCACGTAG(SEQ ID NO.18)-3'

[0234] Adaptor II: 5'-ATCTCTAAAATTCTAAAAAG(SEQ ID NO.19)-3'

[0235] Adaptor III: 5'-AGGGATCTCTGAATCTCTGAATCTCTAGTCCAGCACCGACC(SEQ IDNO.20)-3'

[0236] Adaptor IV: 5'-CTACGTGCTATCA(SEQ ID NO.21)-3'

[0237] 2) Pre-activation sequencing of adapter DNA strands with blunt ends:

[0238] Adaptor I: 5'-(C3 spacer)30-ATCCTTTTTAGAATTTTAGAGATTTTTTTTTTT(SEQ ID NO.17)-(iSp18)4-AGAGATTCAGAGATCCCTTGATAGCACGTAG(SEQ ID NO.18)-3'

[0239] Adaptor II: 5'-ATCTCTAAAATTCTAAAAAG(SEQ ID NO.19)-3'

[0240] Adaptor III: 5'-AAGGGATCTCTGAATCTCTGAATCTCTAGTCCAGCACCGACC(SEQ IDNO.22)-3'

[0241] Adaptor IV: 5'-CTACGTGCTATC(SEQ ID NO.11)-3'

[0242] 2. Anneal the DNA strands used to prepare blunt-end and sticky-end activated sequencing adapters at a ratio of 1:1:1:1. The 1x annealing buffer consisted of 0.1M Tris-HCl, 0.1M NaCl, and 0.05M EDTA. The annealing conditions were: heating at 95°C for 2 minutes, decreasing the temperature by 0.1°C every 5 seconds until reaching 25°C.

[0243] 3. Prepare the activation adapter preparation system, the main components of which are: 2 μL of 10X topoisomerase reaction buffer (Tris-acetic acid 500 Mm pH 7.5, sodium chloride 1 M, magnesium chloride 25 MmM, EDTA 1 MmM), 4 pmol of pre-activation adapter, 1 U of vaccinia virus topoisomerase I (D6952, Beyotime), and make up the volume to 20 μL with deionized water. Heat the above reaction system in a 37°C metal bath for 30 minutes.

[0244] 4. Load helicase and purify to obtain blunt-end activated sequencing adapters and sticky-end activated sequencing adapters.

[0245] 5. The preparation of the sample to be tested is described in Example 5 of this invention.

[0246] 6. Ligate the blunt-end and sticky-end amplicon products using blunt-end and sticky-end activation sequencing adapters, respectively. The reaction system was as follows: 1 μL of 10x reaction buffer (500 M Tris-acetic acid, pH 7.5, 1 M sodium chloride, 25 mM magnesium chloride, 1 mM EDTA), 2 pmol of activation sequencing adapter, 0.5 pmol of amplicon product, and deionized water to a final volume of 10 μL. Incubate at room temperature for 1 minute. Purify and recover the ligation products using 0.4X magnetic beads (N411, Novizan) to remove excess activation adapters.

[0247] 7. Sequencing.

[0248] 8. The sequencing results are shown in Table 5.

[0249] Table 5. Results of activated sequencing adapter amplicon sequencing.

[0250]

[0251] Table 5 shows that the total throughput, MAP throughput, and Q7 throughput all reach the levels of conventional library preparation and sequencing. Furthermore, the throughput, total reads, and effective well time for nanopore sequencing using products with sticky end ligation are significantly higher, indicating that it is more conducive to improving the throughput of nanopore sequencing.

[0252] Example 8: Preparation of Modified Activated Sequencing Adapters

[0253] In this embodiment, maleimide-PEG11-biotin was used to biotinylate topoisomerase. The modification site involves the covalent linkage of maleimide and the thiol group on the topoisomerase. Subsequently, a modified activated adapter was prepared by binding the biotinylated topoisomerase to the adapter to form an activated adapter. Finally, the motor protein was locked into the single-stranded region at the pore end of the adapter, and the modified activated sequencing adapter was obtained after HPLC purification. The overall reaction procedure is as follows: Figure 13 As shown. The specific implementation steps are as follows:

[0254] 1. Synthesize the pre-activated sequencing adapter DNA strand, as in step 1 of Example 7.

[0255] 2. Same as step 2 in Example 7.

[0256] 3. Biotin modification

[0257] The above reaction system was desalted using a desalting column (89883, Thermo) and then replaced with PBS buffer. Subsequently, 800 pmol maleimide-PEG-biotin reagent (21911, Thermo) was added to the reaction system, and the reaction was carried out at room temperature for 1 hour, after which the solution was desalted and replaced with PBS solution.

[0258] 4. Prepare the activation adapter preparation system, the main components of which are: 2 μL of 10X topoisomerase reaction buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 mM, EDTA 1 mM), 40 pmol of pre-activation adapter, 10 U of vaccinia virus topoisomerase I (D6952, Beyotime), 40 U of T4 polynucleotide kinase (M0201, NEB), and deionized water to bring the volume to 200 μL. Heat the above reaction system in a 37°C metal bath for 30 minutes.

[0259] 5. Motor protein incubation and enzyme locking

[0260] Prepare motor protein M2 (SEQ ID NO.23; 20 μM) desalted to PBS buffer. The M2 incubation system consisted of: 40 pmol of biotin-modified sticky or blunt-ended activated linker, 400 pmol of M2, 1% PEG 8000, and 100 μM TMAD, with the volume adjusted to 400 μL using PBS buffer. Heat the reaction system in a 30°C metal bath for 30 minutes.

[0261] 6. HPLC purification of the modified sticky-end or blunt-end activated linker products.

[0262] Mobile phase A was prepared with the following main components: CHES 20mM pH 8.6, PEG 8000 1%, EDTA 100mM pH 8.0, and Glycerol 50%, with the volume brought to 500mL with deionized water. Mobile phase B was prepared with the following main components: CHES 20mM pH 8.6, PEG 8000 1%, EDTA 100mM pH 8.0, NaCl 1M, and Glycerol 50%, with the volume brought to 500mL with deionized water. The above-mentioned locked enzyme and modified activated linker were purified using a strong anion exchange column (5F53416, Sepax) in conjunction with a liquid chromatograph (e2695, Water), and the target peak was collected. The purification program was as follows: 65% mobile phase A and 35% mobile phase B were incubated for 5 minutes, 30% mobile phase A and 70% mobile phase B were incubated for 25 minutes, and 100% mobile phase B was incubated for 5 minutes.

[0263] HPLC purification results of the viscous end activated linker are as follows Figure 14As shown in Figure A, a total of 6 elution peaks (E1-E6) were separated. Gel electrophoresis and activity testing confirmed that E3 was the target product peak. The HPLC purification results of the blunt-ended activated linker are shown below. Figure 14 As shown in Figure B, a total of 6 elution peaks (E1-E6) were separated. Gel electrophoresis and activity testing confirmed that E3 was the target product peak.

[0264] Example 9: Preparation and purification of sequencing libraries for amplified products

[0265] 1. Preparation of amplification products

[0266] Taq DNA polymerase and Q5 DNA polymerase were used to amplify λ phage DNA as a template, respectively, yielding 2098 bp DNA products with sticky ends and blunt ends. The primers and reaction procedure required for the PCR reaction are as follows:

[0267] Primer-2k-F:GGGAACTACAGGCTGACAGT(SEQ ID NO.24)

[0268] Primer-2k-R:ACTGCCATATTCACCCCACA(SEQ ID NO.25)

[0269] Table 6. PCR reaction procedure

[0270]

[0271] After the reaction, the amplification product was purified and recovered by magnetic beads. The product was dissolved in elution buffer (10 mM tris-HCl, 1 mM EDTA), and the nucleic acid concentration was determined by Qubit.

[0272] 2. Connector connection

[0273] Prepare the adapter ligation system according to the following components: 1 μL 10X ligation buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 MmM, EDTA 1 MmM), 10 ng of the sticky-end or blunt-end modified activated sequencing adapter from Example 8, 30-100 fmol of sticky-end or blunt-end amplification product, and deionized water to bring the volume to 10 μL. After mixing thoroughly, react at room temperature for 4 minutes, and use Qsep to detect adapter ligation efficiency.

[0274] 3. Purification and sequencing

[0275] Take 20 μL of streptavidin magnetic beads (65601, Thermo) and place them on a magnetic rack. Remove the supernatant and wash three times with PBS, removing the supernatant again. Add the above ligation system to the magnetic beads, mix well, and let stand at room temperature for 1 minute. Then place it on a magnetic rack and wait for the magnetic beads to be completely adsorbed (1-2 minutes). Aspirate the supernatant solution and determine the sample purity using QSEP. The detection results of the viscous end ligation product are as follows: Figure 15 As shown in Figure A, the blue peaks represent the components in the system before purification, and the red peaks represent the content of each component in the system after purification. Peaks 1-4 represent: 1. Activated sequencing adapter; 2. 2kb DNA fragment; 3. Single-end adapter ligation product; 4. Double-end adapter ligation product. The detection results of blunt-end ligation products are shown below. Figure 15 As shown in Figure B, the blue curves represent the components in the system before purification, and the red curves represent the content of each component in the system after purification. Peaks 1-4 represent: 1. Activated sequencing adapter; 2. 2kb DNA fragment; 3. Single-end adapter ligation product; 4. Double-end adapter ligation product.

[0276] 4. Nanopore sequencing

[0277] The above-mentioned libraries were sequenced for 16 hours using the nanopore sequencer 3841 from Qitan Technology Co., Ltd., and the sequencing results were compared and analyzed. The sequencing results of sticky-end and blunt-end modified activated sequencing adapters are shown in Table 7. The total throughput, map throughput, Q7 throughput and other parameters all reached the level of conventional library preparation and sequencing. Moreover, the sequencing effect of the sticky-end ligation product was significantly better than that of the blunt-end ligation product in terms of throughput and effective well time.

[0278] Table 7. Amplicon sequencing results of modified activated sequencing adapters.

[0279]

[0280] Example 10: Preparation of solid-phase activated sequencing adapters

[0281] This embodiment prepares a solid-phase activated sequencing adapter by fixing the activated sequencing adapter onto a magnetic bead. The main steps are as follows: Follow steps 1-6 of Example 8, and then perform the following steps:

[0282] 7. Place streptavidin magnetic beads (65601, Thermo) on a magnetic rack. After complete adsorption, remove the supernatant and wash the beads three times with PBS buffer. Mix the two in PBS solution at a ratio of 50 μg of magnetic beads per ng of modified sticky-end or blunt-end activated sequencing adapters, and incubate at room temperature for 1 minute. Place the above system on a magnetic rack. After complete adsorption, discard the supernatant and wash the beads three times with PBS solution.

[0283] Example 11: Preparation and purification of sequencing libraries using solid-phase adapters

[0284] This embodiment uses the solid-phase activated sequencing adapter prepared in Example 10 to prepare a sequencing library and performs sequencing. The library preparation process is as follows: Figure 16 As shown, the main steps are as follows:

[0285] Preparation of amplification products

[0286] Taq DNA polymerase and Q5 DNA polymerase were used to amplify λ phage DNA as a template, respectively, to obtain 500 bp DNA products with sticky ends and blunt ends. The primers and reaction procedure required for the PCR reaction are as follows:

[0287] Primer-2k-F:GGGAACTACAGGCTGACAGT(SEQ ID NO.24)

[0288] Primer-500bp-R:CTACAGCGTGAGCTATGAGA(SEQ ID NO.26)

[0289]

[0290]

[0291] After the reaction, the amplification product was purified and recovered by magnetic beads. The product was dissolved in elution buffer (10 mM tris-HCl, 1 mM EDTA), and the nucleic acid concentration was determined by Qubit.

[0292] 1. Connector connection

[0293] Prepare the adapter ligation system according to the following components: 1 μL 10X ligation buffer (Tris-HCl 500 Mm pH 7.5, NaCl 1 M, MgCl2 25 MmM, EDTA 1 MmM), 500 μg sticky or blunt-end amplification products for immobilization, 30-100 fmol sticky or blunt-end amplification products, and deionized water to bring the volume to 10 μL. Mix thoroughly and react at room temperature for 4 minutes.

[0294] 2. Library purification

[0295] The above reaction system was placed on a magnetic rack. After the magnetic beads were completely adsorbed (1-2 min), the supernatant was aspirated and proceeded directly to the subsequent sequencing process. The ligation products were analyzed using Qseq to detect adapter ligation. Results for sticky-end ligation products are shown below. Figure 17As shown in Figure B, peaks 1-4 represent: 1. activated sequencing adapter; 2. 500bp DNA fragment; 3. single-end adapter ligation product; 4. double-end adapter ligation product. The results for blunt-end ligation products are shown below. Figure 17 As shown in Figure A, peaks 1-4 represent: 1. Activated sequencing adapter; 2. 500bp DNA fragment; 3. Single-end adapter ligation product; 4. Double-end adapter ligation product.

[0296] 3. Sequencing

[0297] The above-mentioned library was sequenced for 16 hours using the nanopore sequencer 3841 from Qitan Technology Co., Ltd., and the sequencing results were compared and analyzed. The sequencing results are shown in Table 8. The total throughput, MAP throughput, Q7 throughput and other parameters all reached the level of conventional library preparation and sequencing. Moreover, the sequencing effect of the sticky end ligation product was significantly better than that of the blunt end ligation product in terms of throughput and effective well time.

[0298] Table 8. Results of solid-phase activated sequencing adapter amplicon sequencing.

[0299]

Claims

1. A method for characterizing a target biomolecule, comprising: Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product. By immobilizing the topoisomerase, the free topoisomerase, and / or the linker bound to the topoisomerase, and / or the target biomolecule bound to the topoisomerase, in the first liquid product, a second liquid product is obtained. The second liquid product or its purified third product containing the target biomolecule is brought into contact with a pore, allowing the target biomolecule to pass through and move relative to the pore, thereby obtaining one or more measurements representing one or more characteristics of the target biomolecule.

2. The method as described in claim 1, wherein, The throughput and / or duration of characterizing the target biomolecules are increased; and / or, The pores are nanopores, and / or biological pores, solid pores, or pores that are a hybrid of biological and solid components.

3. The method as described in claim 1 or 2, wherein, Methods for immobilizing topoisomerases include: The topoisomerase, free topoisomerase, and / or topoisomerase-bound linkers, and / or topoisomerase-bound target biomolecules in the first liquid phase product are bound to the surface of the solid material. Preferably, the method further includes: removing the resulting solid material after binding, and / or binding the topoisomerase to the surface of the solid material, including an incubation step. Preferably, the topoisomerase is bound to the surface of the solid material by at least one of the following methods: (1) Through the binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid material; preferably, the first molecule and the second molecule are biotin and streptavidin; (2) By means of an anti-toposome antibody disposed on the surface of the solid material.

4. The method as described in any one of claims 1-3, wherein, Provides conditions for using topoisomerases to link target biomolecules and adapters, wherein: Prior to ligation, i) at least one end of the target biomolecule or adapter contains a recognition sequence and / or recognition structure for a topoisomerase, and / or ii) the topoisomerase binds to at least one end of the target biomolecule or adapter and forms an activated molecule or activated adapter, which is capable of ligating to the adapter or the activated adapter is capable of ligating to the target biomolecule. Optionally, in i) and / or ii), the topoisomerase is modified for binding to the surface of a solid material while maintaining its activity in forming the linkage. After ligation, a covalent link between the end of the target biomolecule and the end of the adapter is formed, either a single-stranded nucleic acid link or a double-stranded nucleic acid link. Preferably, the ligation does not involve the addition of DNA ligase.

5. The method as described in any one of claims 1-4, wherein, The topoisomerase includes type I topoisomerase and / or type II topoisomerase. Preferably, the type I topoisomerase includes type IB topoisomerase. More preferably, the type IB topoisomerase includes vaccinia virus topoisomerase I. Preferably, the modification in the topoisomerase is such that the target site for binding to the surface of the solid material is a thiol group.

6. The method as described in claim 4 or 5, wherein, The activated linker or activated molecule described in ii) comprises a first segment and a second segment, wherein the 3' end of the first segment contains the topoisomerase recognition sequence, which is covalently coupled to the topoisomerase, and the 5' end of the second segment contains at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence and optional additional sequences, wherein the topoisomerase recognition sequence and at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence are annealed to form a first double-stranded structure. The topoisomerase described herein has the activity of linking a target biomolecule or linker to the 3' end of the first segment, wherein the target biomolecule or linker contains a hydroxyl group at the 5' end. Preferably, in the activated linker or activated molecule, the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment.

7. The method of claim 6, wherein, The 5' end of the first segment in the activated linker contains a loading region for a motor protein, which is used to control the permeation rate of the target biomolecule.

8. A ligation method or a method for preparing a sequencing library, comprising: Provide the conditions for using topoisomerases to ligate target biomolecules and linkers to obtain the first liquid-phase product. By immobilizing the topoisomerase, the free topoisomerase and / or the linker of the topoisomerase or the target biomolecule bound to the topoisomerase in the first liquid product are removed to obtain the second liquid product.

9. The method of claim 8, further comprising the method of any one of claims 3-7.

10. An activating linker comprising a first segment and a second segment, wherein the 3' end of the first segment contains the topoisomerase recognition sequence, the topoisomerase recognition sequence being covalently coupled to the topoisomerase, and the 5' end of the second segment contains at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence and optional additional sequences, wherein the topoisomerase recognition sequence and at least a portion of the anticomplementary sequence of the topoisomerase recognition sequence are annealed to form a first double-stranded structure. The topoisomerase described therein has the activity of linking a target biomolecule to the 3' end of the first segment, wherein the target biomolecule contains a hydroxyl group at the 5' end.

11. The activated linker of claim 10, wherein the topoisomerase is bound to the surface of the solid material.

12. The activated linker of claim 11, wherein the topoisomerase is bound to the surface of the solid material by at least one of the following means: (1) Through the binding of a first molecule linked to the topoisomerase and a second molecule linked to the solid material; (2) By means of an anti-toposome antibody disposed on the surface of the solid material.

13. The activated connector as described in any one of claims 10-12, wherein, The topoisomerases include type I topoisomerases and / or type II topoisomerases. Preferably, the type I topoisomerase includes type IB topoisomerase; more preferably, the type IB topoisomerase includes vaccinia virus topoisomerase I; and even more preferably, the target site for linking the first molecule in the topoisomerase is a thiol group. And / or, the 5' end of the first segment contains a loading region for a motor protein; And / or, in the activated linker, the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment.

14. A method for preparing the activated connector according to any one of claims 10-13, the method comprising: A topoisomerase is reacted with a first double strand, wherein the first double strand comprises a topoisomerase recognition sequence and an inverse complementary sequence thereof, and the topoisomerase recognition sequence and the inverse complementary sequence thereof are annealed to form a second double strand structure.

15. The method of claim 14, wherein the method comprises: (1) Annealing a first single-stranded DNA, a second single-stranded DNA, and a third single-stranded DNA to form a complex, wherein the 5' end of the second single-stranded DNA is anticomplementary to the first single-stranded DNA, and the 3' end of the third single-stranded DNA is anticomplementary to the first single-stranded DNA. In the first single-stranded DNA, the sequence anticomplementing the 5' end of the second single-stranded DNA and the sequence anticomplementing the 3' end of the third single-stranded DNA are either consecutive or separated by one or more nucleotides. The first single-stranded DNA contains a topoisomerase recognition sequence, and the 5' end of the second single-stranded DNA and the 3' end of the third single-stranded DNA together contain the inverse complementary sequence of the topoisomerase recognition sequence; and (2) React the topoisomerase with the complex to obtain the activated linker. The activated connector comprises a first segment and a second segment, which form a double chain. The 3' end of the first segment and the 5' end of the second segment are oppositely complementary. The 3' end of the first segment is flush with the 5' end of the second segment, or the 3' end of the first segment protrudes or is missing one or more nucleotides compared to the 5' end of the second segment. The 3' end of the first segment contains a topoisomerase recognition sequence, wherein the topoisomerase recognition sequence is covalently coupled to the topoisomerase.

16. The method of claim 15, wherein the sequence in the first single-stranded DNA that is reverse complementary to the 3' end of the third single-stranded DNA and the topoisomerase recognition sequence are continuous or at least partially overlapping, preferably with one nucleotide overlap.

17. The method of any one of claims 14-16, wherein the topoisomerase comprises a type I topoisomerase and / or a type II topoisomerase, preferably, the type I topoisomerase comprises a type IB topoisomerase, more preferably, the type IB topoisomerase comprises vaccinia virus topoisomerase I, and even more preferably, the modification of the topoisomerase to target a thiol group for binding to the surface of a solid material.

18. The method of any one of claims 15-17, wherein the length of the third single-stranded DNA is ≥5 nt.

19. The method of any one of claims 15-17, wherein the length of the second single-stranded DNA is 10-140 nt.

20. The method of any one of claims 14-19, wherein the method further comprises: Add a reagent that can phosphorylate the 5'-terminal hydroxyl group to a 5'-terminal phosphate group.

21. A kit for nanopore sequencing, comprising an activated adapter as described in any one of claims 10-13 or an activated adapter prepared by the method described in any one of claims 14-20.

22. Use of the activated adapter according to any one of claims 10-13 or the activated adapter prepared by the method according to any one of claims 14-20 in nanopore sequencing.

Images