A method for assisting in detecting the backfat thickness of a pig and a special primer pair thereof
By designing dedicated primer pairs to amplify the SSC10g.20549610 G>A polymorphic site, and using PCR and sequencing methods to detect backfat thickness in pigs, the detection problem in existing technologies has been solved, enabling efficient and accurate breeding selection and improving pig production performance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-12-02
- Publication Date
- 2026-07-07
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately detecting backfat thickness in pigs, which affects their growth rate and lean meat percentage, and the breeding process is time-consuming.
A dedicated primer pair was designed to amplify the DNA fragment at the SSC10g.20549610 G>A polymorphic site. The genotype of the pig was determined by PCR amplification and sequencing, thereby assisting in the detection of backfat thickness in pigs.
This technology enables efficient and accurate detection of backfat thickness in pigs, shortens breeding time, reduces breeding costs, and improves pig production performance, particularly by reducing the average backfat thickness by approximately 3.37 mm.
Smart Images
Figure CN121362840B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a method for assisting in the detection of backfat thickness in pigs and its dedicated primer pair. Background Technology
[0002] Backfat thickness in pigs affects growth rate and carcass lean meat percentage. Excessive backfat deposition not only affects growth rate and reduces carcass lean meat percentage, but also leads to feed waste. Backfat thickness is an important indicator for assessing carcass lean meat percentage, showing a strong negative correlation with it. Because of its high heritability and ease of measurement, it is often used as an indirect trait for improving lean meat percentage in the genetic improvement of lean pigs.
[0003] The backfat thickness trait in pigs is closely related to nutritional levels and feeding management, but genetic factors play an essential role. The influence of breed on traits is also essentially hereditary. Identifying and conducting in-depth research on causal mutations in the backfat thickness trait has important theoretical significance and application value for carrying out precision molecular breeding of this trait in actual production. Summary of the Invention
[0004] The purpose of this invention is to provide a method for assisting in the detection of backfat thickness in pigs and a dedicated primer pair thereof, so as to solve the problems mentioned in the background art.
[0005] To achieve the above objectives, the present invention provides the following technical solution: a dedicated primer pair for amplifying DNA fragments containing the SSC10g.20549610 G>A polymorphic site;
[0006] The SSC10g.20549610 G>A polymorphism site is the G>A mutation at the 20549610th nucleotide site from the 5' end on chromosome 10 of the international pig genome version 11.1 (Sscrofa11.1Primary Assembly) reference sequence.
[0007] Furthermore, the primer pair consists of the DNA molecule shown in SEQ ID No. 1 and the DNA molecule shown in SEQ ID No. 2.
[0008] A method for assisting in the detection of backfat thickness in pigs, using a specific primer pair, is as follows: the backfat thickness of homozygous GG genotype pigs or heterozygous GA genotype pigs is less than that of homozygous AA genotype pigs.
[0009] The homozygous GG genotype pigs are those whose bases at the SSC10g.20549610 G>A polymorphism site are all G;
[0010] The heterozygous GA genotype pigs are those with bases G and A at the SSC10g.20549610 G>A polymorphism site;
[0011] The homozygous AA genotype pigs are those whose bases at the SSC10g.20549610 G>A polymorphism site are all A;
[0012] The SSC10g.20549610 G>A polymorphism site is located at base 20549610 on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly).
[0013] Furthermore, the method for determining the homozygous GG genotype, heterozygous GA genotype, or homozygous AA genotype is as follows: Using pig genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or 2 as primers to obtain PCR amplification products. If all bases at position 20549610 of chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) contained in the PCR amplification products are G, then the genotype of the pig is homozygous GG; if the bases at that position are G and A, then the genotype of the pig is heterozygous GA; and if all bases at that position are A, then the genotype of the pig is homozygous AA.
[0014] Furthermore, when the primers are the primer pair described in claim 2, the 20549610th base of chromosome 10 of the pig genome (Sscrofa11.1Primary Assembly) is located at position 448 from the 5' end of the PCR amplification product.
[0015] Furthermore, it is applied to the breeding of pigs.
[0016] Furthermore, the pig in question is a Qinglian Black Pig.
[0017] This invention provides a method for assisting in the detection of backfat thickness in pigs and its dedicated primer pair, which has the following beneficial effects:
[0018] This invention uses sequencing to detect the bases at the SSC10g.20549610 G>A polymorphism site to determine the genotype of individual pigs, thereby selecting for the backfat thickness trait. This can reduce the average backfat thickness of pigs by approximately 3.37 mm, resulting in pigs with better production performance. The method provided by this invention allows for early screening of pigs, effectively solving the problem of long selection time for superior breeding pigs in actual production, reducing breeding costs, and effectively reducing or increasing backfat thickness in pigs in actual production. This method has high accuracy, low detection cost, and can achieve automated detection, making it highly valuable for practical applications in pig breeding. Attached Figure Description
[0019] Figure 1 This is a sequencing result diagram of the sequence near the G>A site in SSC10g.20549610 of this invention. Detailed Implementation
[0020] The embodiments of the present invention will be described in further detail below with reference to the accompanying drawings and examples. The following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.
[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0022] This invention uses Qinglian Black Pig ( Sus scrofa The breed of pig was purchased from Zhejiang Qinglian Food Co., Ltd.
[0023] The PCR amplification sequences in the following examples all refer to the pig genome (Sscrofa11.1 Primary Assembly) sequence.
[0024] Example 1: Determining the thickness of pig backfat
[0025] I. Determination of the G>A polymorphic site in SSC10g.20549610
[0026] (a) Using two Qinglian black pigs as experimental materials, genomic DNA was extracted from their ear margin tissues.
[0027] (II) Primer Design and Synthesis
[0028] Based on the international pig genome version 11.1 reference sequence (http: / / asia.ensembl.org / Sus_scrofa / Info / Index), the following primers were designed and synthesized:
[0029] U (upstream primer): 5'– GAAGCAGGAGTTGAGGCA -3' (SEQ ID No. 1);
[0030] D (downstream primer): 5'–ACTTCTGTCAAATGTTCCCTGC–3' (SEQ ID No. 2).
[0031] (III) PCR amplification
[0032] Using the genomic DNA of Qinglian black pig obtained in step (1) as a template, PCR amplification was performed with U and D as primers to obtain PCR amplification products, which were named product 1 and product 2, respectively.
[0033] PCR amplification system: 200 ng genomic DNA, 5 µL 10× PCR amplification buffer, dNTPs final concentration of 10 mM, 50 ng each of forward and reverse primers, 0.75 U Taq DNA polymerase, Mg 2＋ 2.5 mmol / L, add ddH2O to bring the system to 50 µL.
[0034] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 60.5℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; final extension at 72℃ for 10 min.
[0035] (iv) Sequencing and sequence analysis
[0036] Products 1 and 2 were sequenced, yielding the sequences of product 1 (as shown in SEQ ID No. 3) and product 2 (as shown in SEQ ID No. 4). SEQ ID No. 3 and SEQ ID No. 4 differ by only one base, specifically at position 448 from the 5' end in both sequences, where the base is either G or A. Figure 1 As indicated by the middle arrow, this site is located at position 20549610 on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly), and is therefore named SSC10g.20549610G>A.
[0037] An individual whose genotype consists entirely of G bases at position 20549610 on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) (or at position 448 from the 5' end of the PCR amplification product obtained in step (III)) is homozygous and its genotype is named homozygous GG. An individual whose genotype consists entirely of A bases at position 20549610 on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) (or at position 448 from the 5' end of the PCR amplification product obtained in step (III)) is homozygous and its genotype is named homozygous AA. An individual whose base at position 20549610 of chromosome 10 (or the base at position 448 from the 5' end of the PCR amplification product obtained in step (iii)) is G or A is a heterozygous individual, and the genotype of this individual is named heterozygous GA genotype.
[0038] II. Association Analysis of SSC10g.20549610G>A Polymorphism Site with Backfat Thickness in Pigs
[0039] To determine whether the SSC10g.20549610G>A polymorphism is related to the backfat thickness trait in pigs, 304 healthy Qinglian black pigs were used as experimental materials for the following experiment:
[0040] (i) Extract genomic DNA from the ear margin tissue of each pig and perform PCR amplification according to the method in step (iii) of step one to obtain each PCR amplification product. Determine whether the genotype of each pig is homozygous GG, heterozygous GA or homozygous AA according to the method in step (iv) of step one.
[0041] (ii) Measure and record the backfat thickness of pigs weighing up to 90 kg.
[0042] The results are shown in Table 1.
[0043] Table 1 shows that the backfat thickness of homozygous GG genotype individuals and heterozygous GA genotype individuals is smaller than that of homozygous AA genotype individuals.
[0044] (III) The association between the pig SSC10g.20549610G>A locus and the backfat thickness trait was analyzed using the least squares method.
[0045] The model used is as follows:
[0046] Y = W + G + e
[0047] Where Y represents the measured trait; W represents the initial body weight covariate; G represents the genotype effect; and e represents the random error.
[0048] The results are shown in Table 1.
[0049] Table 1. Association analysis between the pig mutation site SSC10g.20549610G>A genotype and the pig backfat thickness trait.
[0050]
[0051] Table 1 shows that, among the backfat thickness traits in pigs, the backfat thickness of pigs with homozygous GG or heterozygous GA genotypes was significantly less than that of pigs with homozygous AA genotypes. The backfat thickness of pigs with homozygous AA genotypes was approximately 3.37 mm thicker than that of pigs with homozygous GG genotypes (P<0.05).
[0052] Therefore, in actual pig breeding, in order to obtain pigs with thinner backfat, it is best to select pigs with homozygous GG genotype for breeding.
[0053] The embodiments of the present invention are given for illustrative and descriptive purposes only, and are not intended to be exhaustive or to limit the invention to the forms disclosed. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of the invention, and to enable those skilled in the art to understand the invention and to design various embodiments with various modifications suitable for a particular purpose.
Claims
1. A method for assisting in the detection of backfat thickness in pigs, characterized in that, A specific primer pair was used, which is a primer pair for amplifying DNA fragments containing the SSC10g.20549610 G>A polymorphic site; The SSC10g.20549610 G>A polymorphism site is the G>A mutation at the 20549610th nucleotide site from the 5' end on chromosome 10 of the international pig genome version 11.1 reference sequence; the primer pair consists of the DNA molecules shown in SEQ ID No. 1 and SEQ ID No. 2, and the operation method is as follows: the backfat thickness of homozygous GG genotype pigs or the backfat thickness of heterozygous GA genotype pigs is less than that of homozygous AA genotype pigs; The homozygous GG genotype pigs are those whose bases at the SSC10g.20549610 G>A polymorphism site are all G; The heterozygous GA genotype pigs are those with bases G and A at the SSC10g.20549610 G>A polymorphism site; The homozygous AA genotype pigs are those whose bases at the SSC10g.20549610 G>A polymorphism site are all A; The SSC10g.20549610 G>A polymorphism site is the 20549610th base on chromosome 10 of the porcine genome; The method for determining the homozygous GG genotype, heterozygous GA genotype, or homozygous AA genotype is as follows: Using pig genomic DNA as a template, PCR amplification is performed using the above primer pairs as primers to obtain PCR amplification products. If all bases at position 20549610 of chromosome 10 of the pig genome contained in the PCR amplification products are G, then the pig's genotype is homozygous GG; if the bases at that position are both G and A, then the pig's genotype is heterozygous GA; and if all bases at that position are A, then the pig's genotype is homozygous AA. The 20549610th base of the pig chromosome 10 is located at position 449 from the 5' end of the PCR amplification product.
2. The method for assisting in detecting backfat thickness in pigs according to claim 1, characterized in that, It is applied to the breeding of pigs.
3. The method for assisting in detecting backfat thickness in pigs according to claim 1, characterized in that, The pig in question is a Qinglian Black Pig.