Exosome RNA detection composition based on positive and negative targets and use method thereof

Abstract

The invention belongs to the field of biological detection, and discloses an exosome RNA detection composition based on positive and negative targets and a use method thereof, the composition comprises two positive targets and one negative target: the positive target A is miRNA stably expressed in exosome and is used for reflecting the expression level of small RNA; the positive target B is typical mRNA and is used for evaluating the quality of the long-fragment RNA; the negative target C is bacterial 16S rRNA and is used for identifying bacterial nucleic acid pollution in a sample. The method combines III-generation reverse transcriptase and HotStart Taq enzyme to construct a qPCR system, has high sensitivity and specificity, and is suitable for rapid detection of trace RNA. Whether the exosome RNA is suitable for downstream analysis or not can be judged by acquiring the Cq values of the three types of targets and setting a reference range. According to the invention, the integration of quality control, quantification and pollution identification of the exosome RNA is realized.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological detection, and particularly relates to an exosome RNA detection composition based on positive and negative targets and a use method thereof. BACKGROUND

[0002] Exosomes are nanoscale membrane vesicles secreted by various cells, which are rich in various bioactive substances, including proteins, lipids, miRNAs, mRNAs, and IncRNAs, and have important biological functions, especially in tumor diagnosis, immune regulation, and research and clinical transformation of neurodegenerative diseases. In recent years, exosome RNA has been widely regarded as a potential non-invasive biomarker, and its extraction and analysis have gradually become an important direction of scientific research and clinical detection.

[0003] However, the quality control of exosome RNA still faces many challenges. Traditional RNA quality control methods, such as agarose gel electrophoresis, Bioanalyzer or Nanodrop determination of RNA concentration and purity, often cannot accurately evaluate the RNA integrity and contamination in trace samples, especially the identification of exogenous bacterial nucleic acid contamination. Before exosome RNA is used for downstream library sequencing, qPCR, WB or electron microscopy, there is a lack of a standardized, quantifiable and multi-species RNA quality evaluation system, which often leads to experimental failure or inconsistent results.

[0004] Although there are single qPCR or RT-qPCR for detecting specific miRNA or mRNA in the prior art, there is no combined target system for miRNA and mRNA dual-channel expression and pollution investigation. Especially lacking a three-dimensional quality control strategy using miRNA and mRNA as positive targets and bacterial 16S rRNA as negative target. There is a lack of consistent judgment standard for multi-target expression (such as ΔCq), and there is no enzyme system optimization to improve sensitivity and repeatability. SUMMARY

[0005] To solve the problems mentioned in the background art, the purpose of the present application is to provide an exosome RNA detection composition based on positive and negative targets and a use method thereof. By introducing miRNA and mRNA as positive targets and bacterial 16S rRNA as negative target, a three-in-one exosome RNA quality control system is constructed, which has the advantages of simple operation, clear judgment standard and wide application range, can realize rapid, accurate and quantifiable evaluation of exosome RNA, and is suitable for various sample types of human, mouse and rat.

[0006] The purpose of the present application can be achieved by the following technical solutions: An exosome RNA detection composition based on positive and negative targets, comprising: a positive target A primer set for amplifying miRNA, a positive target B primer set for amplifying mRNA, a negative target C primer set for amplifying bacterial-derived 16S rRNA, reverse transcriptase, heat-start DNA polymerase.

[0007] Further preferably, the positive target A is a miRNA stably expressed in exosomes, selected from one or more of let-7b, let-7a, U6, miR-26b, miR-21, miR-29, miR-26a, miR-16; The positive target B is a mRNA or lncRNA stably expressed in exosomes, selected from one or more of ACTB, GAPDH, Neat1, 18S rRNA; The negative target C is a 16S rRNA conserved region sequence of bacterial origin, suitable for detecting various bacterial contamination.

[0008] Further preferably, the preferred sequence of the positive target A primer set for amplifying miRNA is as follows: RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAAT; qPCR-F: TCGGCAGGTAGCAGCACGTAAAT; qPCR-R: CTCAACTGGTGTCGTGGA; The preferred sequence of the positive target B primer set for amplifying mRNA is as follows: ACTB F: CGYGARAAGATGACCCAGATC; ACTB R: GGATCTTCATGAGGTAGTCWGTC; The sequence of the negative target C primer set for amplifying bacterial-derived 16S rRNA is as follows: 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT.

[0009] Further preferably, the reverse transcriptase is a third-generation high-heat-stable reverse transcriptase; and the heat-start DNA polymerase is an anti-contamination HotStart Taq enzyme.

[0010] A method for using an exosome RNA detection composition based on positive and negative targets, comprising the following steps: S1. Extracting exosome RNA; S2. Reverse transcription and fluorescent quantitative PCR amplification are performed on the positive target A, the positive target B and the negative target C respectively by using the nucleic acid primer composition of claim 1. S3. The Cq values of the positive targets A and B and the negative target C are extracted to form three groups of quantitative data for subsequent quality evaluation to determine the quality and contamination state of the exosome RNA.

[0011] Further preferably, when the sample is detected by RTqPCR amplification, the Cq value of the positive target A is less than or equal to 25 and the melting peak temperature is 81.5°C single peak; the Cq value of the positive target B is less than or equal to 30 and the melting peak temperature is 79°C single peak; and when the negative target C has no amplification peak within 40 amplification cycles, it is determined that the quality of the exosome RNA sample meets the detection requirements.

[0012] Further preferably, when the sample is used for RNAseq library detection, the Cq value of the positive target A is less than or equal to 19 and the melting peak temperature is 81.5°C single peak; the Cq value of the positive target B is less than or equal to 24 and the melting peak temperature is 79°C single peak; and when the negative target C has no amplification signal in the amplification cycle, it is determined that the quality of the exosome RNA sample meets the library requirements.

[0013] Further preferably, the method is suitable for exosome RNA quality control detection of human, mouse or rat origin.

[0014] Further preferably, the amplification result of the negative target C can be used to monitor the contamination of the experimental system; when the negative target C has an amplification signal, it is automatically determined that the experiment is unqualified and it is prompted to extract the exosome RNA or replace the reagent system.

[0015] Further preferably, the method can be applied to exosome RNA extraction quality control, sample pre-screening, NGS library judgment or RNA sample quality control in liquid biopsy.

[0016] The beneficial effects of the present application are: This invention, by simultaneously setting two positive target RNAs, miRNA and mRNA (or lncRNA), comprehensively assesses the integrity and expression activity of exosomal RNA in samples from the perspective of different types of RNA molecules, avoiding misjudgments caused by a single indicator. Furthermore, by introducing the conserved region of bacterial 16S rRNA as a negative target, this invention constructs an internal control mechanism that can simultaneously identify nucleic acid contamination, clearly determining the presence of exogenous bacterial nucleic acids, thereby improving the reliability and safety of the entire exosomal RNA quality control process. This method relies on a real-time quantitative PCR platform for Cq value detection and melting peak analysis, achieving efficient quality control without the need for electrophoresis, microarrays, or high-throughput sequencing equipment. It is simple to operate, low in cost, and suitable for research laboratories and medical testing scenarios. The composition uses a third-generation reverse transcriptase and HotStart Taq enzyme working synergistically, effectively improving the reverse transcription efficiency and amplification specificity of low-starting-volume RNA templates, giving this invention extremely high sensitivity, capable of identifying trace RNA samples with starting volumes below 1 ng. Experimental verification shows that this method has good applicability and high reproducibility in human, mouse, and rat samples, with a CV value of less than 5%, and can be used as a standard pretreatment step for subsequent experiments such as qPCR, library construction, sequencing, electron microscopy, or NTA. Attached Figure Description

[0017] The invention will now be further described with reference to the accompanying drawings.

[0018] Figure 1 The amplification and melting curves of human serum exosome RNA samples in this invention are shown. Figure 2 These are the amplification and melting curves of mouse serum exosome RNA samples used in this invention. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Example 1 1. Exosome extraction and RNA preparation Take 1 mL of human serum sample, extract exosome particles by ultracentrifugation, resuspend in PBS and extract total RNA using the TRIzol method, remove genomic DNA residue by ethanol precipitation and DNase I treatment, and finally dissolve in 20 μL of RNase-free water for later use.

[0021] 7. Composition Preparation The exosome RNA detection composition provided by the application is selected, and includes: a positive target A primer group (the miRNA target is hsa-miR-16-5p): RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAAT; qPCR F: TCGGCAGGTAGCAGCACGTAAAT; qPCR R: CTCAACTGGTGTCGTGGA; A positive target B primer group (the mRNA target is ACTB): ACTB F: CGYGARAAGATGACCCAGATC; ACTB R: GGATCTTCATGAGGTAGTCWGTC; A negative target C primer group (bacterial 16S rRNA): 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT.

[0022] The reverse transcriptase is a third-generation high-thermal-stability enzyme (compatible with 50 DEG C reaction), and the hot-start enzyme is a HotStart Taq enzyme.

[0023] 3. qPCR detection The extracted exosome RNA is taken as a template, reverse transcription reaction is carried out according to the reverse transcription reagent instruction, and the obtained cDNA is used for fluorescence quantitative PCR amplification analysis. The total volume of the qPCR reaction system is 20 μL, and the composition is shown in Table 1 as follows:

[0024] Table 1 RNA amplification system

[0025] The fluorescence quantitative PCR is carried out on a real-time fluorescence quantitative PCR instrument, and the amplification program is set as shown in Table 2: Table 2 RNA amplification program

[0026] 4. Result analysis After amplification and detection by the exosome RNA detection composition, the results are shown in Table 3 as follows: Table 3 Exosome RNA amplification results of human serum

[0027] The above results show that the human serum exosome RNA sample detected by the composition of the present application is qualified in quality and can be used for subsequent downstream analysis such as RNA-seq library construction, WB protein verification, NTA nanoparticle size analysis or transmission electron microscope observation.

[0028] Example 2: Exosome RNA quality detection using different miRNA / mRNA target combinations 1. Exosome extraction and RNA preparation Take 1 mL of human serum sample, extract exosome particles by ultracentrifugation, resuspend in PBS, extract total RNA by TRIzol method, and remove genomic DNA residues by ethanol precipitation and DNase I treatment, finally dissolve in 20 μL of RNase-free water for standby.

[0029] 2. Composition configuration Select the exosome RNA detection composition provided by the present application, which includes: positive target A primer set (miRNA target is hsa-let-7a-5p): RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATAC; qPCR F: TCGGCAGGTGAGGTAGTAGGT; qPCR R: CTCAACTGGTGTCGTGGA; Positive target B primer set (mRNA target is GAPDH): GAPDH F: CAAYGACCCCTTCATTGACC; GAPDH R: GACMAGCTTCCCRTTCTCRG; Negative target C primer set (bacterial 16S rRNA): 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT.

[0030] The reverse transcriptase is a third-generation high-temperature stable enzyme (compatible with 50°C reaction), and the hot-start enzyme is HotStart Taq enzyme.

[0031] 3. qPCR detection Take μL of the extracted exosome RNA as a template, perform reverse transcription reaction according to the reverse transcription reagent instructions, and obtain cDNA for fluorescence quantitative PCR amplification analysis. The total volume of the qPCR reaction system is 20 μL, and the reaction system, reaction program and example 1 are the same.

[0032] 4. Result analysis After the amplification detection by the exosome RNA detection composition of the present application, the results are shown in Table 4 below: Table 4 Exosome RNA amplification results of human serum

[0033] As can be seen from Table 4, the Cq value of the positive target A (let-7a-5p) is 24.8, and the Cq value of the positive target B (GAPDH) is 29.7, both of which are within the determination threshold range set by the present application, and the melting peaks appear at 81.5℃ and 79℃, respectively, showing clear single peaks, indicating good amplification specificity. No amplification signal is detected for the negative target C (16S rRNA), indicating that the sample is not contaminated with bacteria.

[0034] Example 3: Application to quality detection of mouse exosome RNA samples 1. Exosome extraction and RNA preparation Take 1 mL of C57BL / 6 mouse plasma sample, extract exosome particles by differential centrifugation combined with ultracentrifugation, the specific steps are as follows: 300xg centrifugation for 10 min, remove cells; 2000xg centrifugation for 20 min, remove cell debris; 10,000xg centrifugation for 30 min, remove large particles; 100,000xg centrifugation for 90 min, collect exosomes; resuspend the precipitate with PBS and wash it again at 100,000xg. Finally, the exosome particles are extracted by TRIzol method to extract total RNA, which is precipitated by ethanol and treated with DNase I enzyme, and then dissolved in 20 μL of RNase-free water for standby.

[0035] 2. Composition configuration Select the exosome RNA detection composition provided by the present application, which includes: positive target A primer group (miRNA target is hsa-miR-16-5p): RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAAT; qPCR F: TCGGCAGGTAGCAGCACGTAAAT; qPCR R: CTCAACTGGTGTCGTGGA; Positive target B primer group (mRNA target is ACTB): ACTB F: CGYGARAAGATGACCCAGATC; ACTB R: GGATCTTCATGAGGTAGTCWGTC; Negative target C primer group (bacterial 16S rRNA): 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT.

[0036] The reverse transcriptase is a third-generation high-thermal-stability enzyme (compatible with 50℃ reaction), and the hot-start enzyme is a HotStart Taq enzyme.

[0037] 3. qPCR detection Take μL of RNA template for reverse transcription reaction, and the synthesized cDNA is used for qPCR amplification. The total volume of the qPCR reaction system is 20 μL, and the reaction system, reaction program and example 1 are the same.

[0038] 4. Result analysis After amplification and detection by the exosome RNA detection composition of the application, the results are shown in Table 5 below: Table 5 Exosome RNA amplification results of mouse serum

[0039] Table 5 shows that the Cq value of positive target A (miR-16-5p) is 23.2, and the Cq value of positive target B (ACTB) is 27.2, both of which are within the specified determination range, the melting curve shows a clear single peak, which is located at 81.5℃ and 79℃, respectively, and the amplification specificity is good. Negative target C (16S rRNA) has no amplification signal within 40 cycles, indicating that the system is not contaminated by bacteria. The results prove that the composition of the application can be stably applied to mouse samples, has good cross-species applicability and technical stability, and is suitable for exosome RNA quality control in animal experiments and preclinical research.

[0040] Comparative Example 1: RNA quality detection without negative target C primer set in the composition 1. Exosome extraction and RNA preparation Take 1 mL of human serum sample, extract exosome particles by the same ultracentrifugation method as in Example 1, and extract RNA by TRIzol method after resuspension in PBS. After ethanol precipitation and DNase I treatment, the RNA is dissolved in 20 μL of RNase-free water for use. To simulate bacterial contamination, 10 5 copies / μL of E. coli total RNA solution was added to the exosome resuspension before RNA extraction to construct an artificially contaminated sample.

[0041] 2. Detection composition configuration The composition used for detection of the present comparative example does not contain the negative target C (16S rRNA) primer set, and the remaining components remain consistent with Example 1, including: positive target A primer set (hsa-miR-16-5p), positive target B primer set (ACTB), reverse transcriptase (third-generation high-heat-stable reverse transcriptase), and hot-start DNA polymerase (HotStart Taq enzyme).

[0042] 3. qPCR detection RNA reverse transcription and qPCR amplification were performed according to the method of Example 1. The qPCR system and procedure remained consistent, and only positive targets A and B were detected.

[0043] 4. Result analysis After amplification and detection by the exosome RNA detection composition of the present application, the results are shown in Table 6 below: Table 6 Exosome RNA amplification results in human serum

[0044] From the above detection results, although 10 5 copies / μL of E. coli RNA were introduced in the present comparative example to simulate contamination, the composition did not contain the negative target C (16S rRNA) primer set, and the contamination signal could not be recognized in the qPCR detection. The positive targets A and B still showed normal amplification, and the Cq values and Tm values were within the "qualified" range, leading to false judgment of the sample as qualified. In contrast, Example 1 introduced the negative control 16S rRNA primer under the same contamination conditions, which could accurately identify the contamination, thereby avoiding false analysis.

[0045] Comparative Example 2: RNA detection using a traditional second-generation enzyme system 1. Exosome extraction and RNA preparation Take 1 mL of human serum sample, extract exosome particles by ultracentrifugation, resuspend in PBS, extract total RNA by TRIzol method, and remove genomic DNA residues by ethanol precipitation and DNase I treatment, and finally dissolve in 20 μL of RNase-free water for standby.

[0046] 2. Detection composition configuration The exosome RNA detection composition provided by the present application is selected, including: positive target A primer set (miRNA target hsa-miR-16-5p): RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAAT; qPCR F: TCGGCAGGTAGCAGCACGTAAAT; qPCR R: CTCAACTGGTGTCGTGGA; Positive target B primer set (mRNA target is ACTB): ACTB F: CGYGARAAGATGACCCAGATC; ACTB R: GGATCTTCATGAGGTAGTCWGTC; Negative target C primer set (bacterial 16S rRNA): 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT.

[0047] The comparative example uses a traditional second-generation reverse transcriptase and a common Taq DNA polymerase.

[0048] 8. qPCR detection μL of the RNA sample was taken for a reverse transcription reaction (42°C, 60 minutes), and the obtained cDNA was used for fluorescence quantitative PCR amplification. The reaction system and fluorescence detection program were the same as in Example 1.

[0049] 4. Analysis of detection results After amplification and detection by the exosome RNA detection composition of the application, the results are shown in Table 7 below: Table 7 Exosome RNA amplification results in human serum

[0050] As can be seen from the above table, under the same sample and primer system conditions, after using a traditional second-generation reverse transcriptase and a non-heat-start Taq enzyme, the detection sensitivity and specificity decreased significantly. The Cq value of the positive target A increased to 29.8, and the Cq value of the positive target B increased to 34.6. The amplification curve showed obvious signal delay and decreased amplification efficiency, and the melting peak was weakened or even appeared tailing, indicating poor amplification specificity. By comparing the results in Example 1, which had significantly lower Cq values and clear melting peaks, it can be seen that the “third-generation high-thermal-stability reverse transcriptase + HotStart Taq enzyme” system used in the application has better amplification efficiency and result stability in the detection of low-abundance RNA.

[0051] Performance test 1. Detection repeatability test The same sample is tested under the same reaction conditions at least 5 times independently. Taking Comparative Example 1 as an example, the specific steps are as follows: an equal amount of RNA is taken from the exosome RNA sample of Example 1, and the positive target A (miRNA), the positive target B (mRNA) and the negative target C (16S rRNA) are subjected to reverse transcription and qPCR amplification according to the detection system of the application, respectively. The RT system and the PCR reaction system are independently constructed each time, and the Cq value obtained by each amplification is recorded. Then the average value and the standard deviation of 5 independent repeated tests are calculated to obtain the coefficient of variation (CV% = standard deviation / average value x 100%), if CV ≤ 5%, the system is determined to have good repeatability. The results are shown in Table 8 below.

[0052] Table 8 Comparison results of detection repeatability (CV%)

[0053] As can be seen from Table 8, the Cq value coefficient of variation (CV%) of Examples 1-3 is less than 3% after 5 independent repeated tests on the same sample, which shows that the system has excellent amplification stability and good batch repeatability. Comparative Examples 1 and 2 respectively lack a negative target or use a traditional enzyme system, resulting in significant fluctuations in the Cq value of the positive target, with CV values of more than 6.7% and 9.4% respectively, indicating that the amplification system is disturbed by background or the amplification efficiency fluctuates greatly, and the reliability of the detection results is low.

[0054] 2. Library construction efficiency verification The exosome RNA samples detected by Examples 1-3 and Comparative Examples 1-2 are selected, qPCR pre-judgment is performed according to the corresponding Cq value, and library construction is performed. The small RNA library kit is used for library construction reaction, and the library concentration and fragment distribution are measured to determine whether the library construction is successful. The library construction success criteria are: library concentration ≥ 1.5 ng / μL, and fragments concentrated in 140-160 bp (miRNA library region). The results are shown in Table 9 below.

[0055] Table 9 Cq value and library construction success rate

[0056] As can be seen from Table 9, the Cq values of the samples of Examples 1-3 are within the determination range, the library construction success rate is 100%, the library concentration and fragment distribution meet the small RNA library standard, and it is proved that the detection system of the application has good discrimination ability in the pre-screening stage. In contrast, the Cq value of Comparative Example 2 is out of the determination threshold range, and the library construction fails, verifying that the RNA quality of the high Cq value sample is low and not suitable for library construction; although the Cq value of Comparative Example 1 is qualified, it fails to identify sample contamination due to the lack of a negative target, and the library construction is successful but there is a risk of downstream contamination misdirection, indicating that there is a loophole in its screening and determination.

[0057] In the description of the application, the description of the terms "one embodiment", "an example", "a specific example" and the like is intended to mean that the particular feature, structure, material or characteristic being described is included in at least one embodiment or example of the present application. The illustrative appearances of the above-mentioned terms in this specification are not necessarily referring to the same embodiment or example. Moreover, the particular features, structures, materials or characteristics can be combined in any suitable manner in one or more embodiments or examples.

[0058] The above presents and describes the basic principles, main features and advantages of the present application. It should be understood by those skilled in the art that the present application is not limited by the above-mentioned embodiments, and the above-mentioned embodiments and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the present application.

Claims

1. An exosome RNA detection composition based on positive and negative targets, characterized in that, The exosome RNA detection composition comprises: a positive target A primer set for amplifying miRNA, a positive target B primer set for amplifying mRNA, a negative target C primer set for amplifying bacterial-derived 16S rRNA, a reverse transcriptase, and a hot-start DNA polymerase.

2. The exosome RNA detection composition according to claim 1, wherein the positive target A is a miRNA stably expressed in exosomes and is selected from one or more of let-7b, let-7a, U6, miR-26b, miR-21, miR-29, miR-26a, and miR-16. The positive target B is a mRNA or lncRNA stably expressed in exosomes and is selected from one or more of ACTB, GAPDH, Neat1, and 18S rRNA. The negative target C is a 16S rRNA conserved region sequence derived from bacteria and is suitable for detecting various bacterial contamination. The preferred sequence of the positive target A primer set for amplifying miRNA is as follows:

3. The exosome RNA detection composition of claim 1, wherein, RT primer: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAAT; qPCR-F: TCGGCAGGTAGCAGCACGTAAAT; qPCR-R: CTCAACTGGTGTCGTGGA; The preferred sequence of the positive target B primer set for amplifying mRNA is as follows: ACTB F: CGYGARAAGATGACCCAGATC; ACTB R: GGATCTTCATGAGGTAGTCWGTC; The sequence of the negative target C primer set for amplifying bacterial-derived 16S rRNA is as follows: 16S rRNA F: GTGCCAGCMGCCGCGGTAA; 16S rRNA R: GGACTACHVGGGTWTCTAAT. The reverse transcriptase is a third-generation high-heat-stable reverse transcriptase, and the hot-start DNA polymerase is an anti-contamination HotStart Taq enzyme.

4. The exosome RNA detection composition of claim 1, wherein, The method comprises the following steps:

5. A method of use of an exosome RNA detection composition based on positive and negative targets, the exosome RNA detection composition being as claimed in any one of claims 1 to 4, characterized in that, S1. Extracting exosome RNA; S2. Using the nucleic acid primer combination of claim 1 to perform reverse transcription and fluorescent quantitative PCR amplification on the positive target A, the positive target B, and the negative target C, respectively; S3. Extracting the Cq values of the positive target A and B and the negative target C to form three sets of quantitative data for subsequent quality assessment to determine the quality and contamination state of the exosome RNA. When the sample is detected by RT-qPCR amplification, the Cq value of the positive target A is less than or equal to 25 and the melting peak temperature is 81.5°C single peak; the Cq value of the positive target B is less than or equal to 30 and the melting peak temperature is 79°C single peak; and when the negative target C has no amplification peak within 40 amplification cycles, it is determined that the quality of the exosome RNA sample meets the detection requirements.

6. The method of use of claim 5, wherein, ​ 7. The method of use of claim 5, wherein, When the sample is used for RNAseq library detection, the Cq value of the positive target A is less than or equal to 19 and the melting peak temperature is 81.5℃ single peak; the Cq value of the positive target B is less than or equal to 24 and the melting peak temperature is 79℃ single peak; and when the negative target C has no amplification signal in the amplification cycle, it is determined that the exosome RNA sample quality meets the library building requirements.

8. The method of use of claim 5, wherein, The method is suitable for exosome RNA quality control detection of human, mouse or rat origin.

9. The method of use of claim 5, wherein, The amplification result of the negative target C can be used to monitor the pollution of the experimental system; when the negative target C has amplification signal, it is automatically determined that the experiment is unqualified and it is prompted to extract exosome RNA or replace the reagent system.

10. The method of use of claim 5, wherein, The method can be applied to the quality control of exosome RNA, sample pre-screening, NGS library building judgment or RNA sample quality control in liquid biopsy.

Images