Application of CAPS molecular marker in identifying bitter melon pulp thickness

By applying CAPS molecular markers to bitter melon pulp thickness and utilizing variations in the nucleotide sequence of SEQ ID NO.2 and PciI enzyme digestion, the problem of low efficiency in traditional identification methods was solved, achieving efficient and accurate identification of bitter melon pulp thickness and improving breeding efficiency.

CN121362853BActive Publication Date: 2026-03-10TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Traditional methods are inefficient and time-consuming in determining the thickness of bitter melon flesh, and existing molecular marker technologies are not widely used in determining the thickness of bitter melon flesh.

Method used

A CAPS molecular marker was developed. Primer pairs were designed using a variation at position 222 of the nucleotide sequence shown in SEQ ID NO.2. PCR amplification and digestion with the restriction endonuclease PciI were performed, and the pulp thickness was analyzed by electrophoresis.

Benefits of technology

It has enabled efficient and accurate early identification of bitter gourd flesh thickness, with genotype and phenotype consistency reaching 100%, thus improving the efficiency of genetic breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362853B_ABST
    Figure CN121362853B_ABST
Patent Text Reader

Abstract

This invention discloses the application of CAPS molecular markers in identifying the thickness of bitter melon flesh. Analysis revealed that, compared to thick-fleshed bitter melon varieties, the thin-fleshed bitter melon mutant M17 contains a 6-base insertion (AGTGAA) at position 12132249 on chromosome 6. Specific primers were designed targeting this mutation site. These primers were used to amplify the bitter melon genome, and the PCR amplification products were digested with the restriction enzyme PciI. The size of the digested products allows for the identification of bitter melon varieties exhibiting thick or thin flesh traits. This invention can accurately identify the flesh thickness of bitter melon in its early growth stages, improving the breeding efficiency of thick-fleshed varieties, and offers advantages such as high efficiency, accuracy, and ease of operation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to the application of a CAPS molecular marker in identifying the thickness of bitter gourd pulp. Background Technology

[0002] Momordica charantia( Momordica charantia Bitter melon (L.), also known as balsam pear or bitter gourd, is a vine belonging to the genus *Momordica* in the Cucurbitaceae family. It is mainly cultivated in tropical and subtropical regions. Bitter melon is rich in vitamins, amino acids, and various bioactive components, and has pharmacological effects such as antiviral, antitumor, and hypoglycemic properties. Due to its significant health and medicinal functions, it is known as a "medicinal vegetable."

[0003] Fruit thickness refers to the thickness of the bitter melon flesh, specifically the radial distance from the outer pericarp to the inner cavity (seed cavity) wall. It is a key indicator for evaluating the appearance and taste quality of bitter melon. This trait directly affects its edible value, commercial value, and consumer acceptance. Thick-fleshed bitter melons typically have a fuller, crisper, or juicier texture, while thin-fleshed varieties tend to be dry, fibrous, and have relatively lower edible quality. In most Asian consumer markets, including China, Japan, and Southeast Asia, bitter melons with thick flesh and a plump shape are more favored and command higher market prices, making them an important and intuitive basis for buyers and consumers to judge bitter melon quality. Furthermore, given similar length and diameter of individual fruits, increased flesh thickness often translates to higher single-fruit weight and flesh yield, positively impacting yield per unit area. Therefore, flesh thickness is considered one of the core breeding objectives for improving bitter melon quality and is of great significance for enhancing the economic benefits of the bitter melon industry.

[0004] Traditional methods for identifying bitter gourd flesh thickness mainly rely on phenotypic selection, requiring observation and screening after fruiting. This is not only time-consuming and labor-intensive but also inefficient. Molecular marker-assisted selection (MAP) technology offers a new approach for bitter gourd genetic breeding. CAPS (Cleaved Amplified Polymorphic Sequences) markers are PCR-based molecular markers. They involve designing specific primers to amplify genomic DNA using PCR, followed by restriction endonuclease digestion of the amplified products. The polymorphism in the length of the digested fragments is then used to detect differences in the DNA sequence. CAPS markers offer advantages such as simple operation, good stability, high reproducibility, and easy result analysis, and have been applied in the genetic breeding of various crops. However, their application in identifying bitter gourd flesh thickness is rarely reported. Therefore, developing a CAPS molecular marker closely linked to bitter gourd flesh thickness is of great significance for improving the efficiency of bitter gourd genetic breeding and accelerating the selection of superior varieties. Summary of the Invention

[0005] To address the aforementioned deficiencies in the prior art, this invention proposes the application of CAPS molecular markers in identifying the thickness of bitter melon pulp, thereby resolving the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] A CAPS molecular marker for identifying the thickness of bitter melon pulp, wherein the CAPS molecular marker is located at position 222 of the nucleotide sequence shown in SEQ ID NO.2, and there is a variation between C and CAGTGAA at this site.

[0008] A primer pair for amplifying the CAPS molecular marker, the nucleotide sequences of which are shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0009] A kit for identifying the thickness of bitter melon pulp, the kit containing the primer pair and restriction endonuclease PciI.

[0010] Furthermore, the present invention relates to the application of the CAPS molecular marker, the primer pair, or the kit in identifying the thickness of bitter melon pulp.

[0011] Furthermore, those skilled in the art can determine the thickness of bitter melon pulp through the following methods (i) or (ii):

[0012] (i) Sequencing the sequence of SEQ ID NO.2. If the nucleotide sequence at position 222 of SEQ ID NO.2 is C, then the bitter melon to be tested is a thick-fleshed bitter melon. If the nucleotide sequence at position 222 of SEQ ID NO.2 is modified to CAGTGAA, then the bitter melon to be tested is a thin-fleshed bitter melon.

[0013] (ii) Perform PCR amplification on the SEQ ID NO.2, then digest the amplified product with the restriction endonuclease PciI, and perform electrophoresis. Determine the thickness of the bitter melon flesh based on the electrophoresis results. If both 221bp and 125bp bands are produced simultaneously, or both 221bp, 125bp and 346bp bands are produced simultaneously, then the bitter melon to be tested is a thick-fleshed type. If only a 352bp band is produced, then the bitter melon to be tested is a thin-fleshed type.

[0014] The thick-fleshed bitter melon has a flesh thickness greater than or equal to 1.00 cm; the thin-fleshed bitter melon has a flesh thickness less than or equal to 0.75 cm.

[0015] Furthermore, this invention proposes a method for determining the thickness of bitter melon pulp, comprising the following steps:

[0016] (1) Extract genomic DNA from the bitter melon to be tested;

[0017] (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the primer pair to obtain the amplification product;

[0018] (3) The amplified product was digested with restriction endonuclease PciI and electrophoresed. The thickness of the bitter melon flesh was determined based on the electrophoresis results. If bands of 221bp and 125bp were produced at the same time, or bands of 221bp, 125bp and 346bp were produced at the same time, the bitter melon to be tested was a thick-fleshed bitter melon. If only a band of 352bp was produced, the bitter melon to be tested was a thin-fleshed bitter melon.

[0019] Furthermore, each 20 μL PCR reaction system contains: 10 μL 2×Hieff® PCR Master Mix, 0.5 μL each of the forward and reverse primers, 1 μL DNA, and 8 μL ddH2O. The concentrations of the forward and reverse primers are 10 μM, and the concentration of the DNA is 50 ng / μL.

[0020] Furthermore, the PCR amplification program was as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 20 s, 56 °C annealing for 30 s, 72 °C extension for 30 s, 35 cycles; 72 °C extension for 10 min, 4 °C hold for 5 min.

[0021] Furthermore, the bitter gourd genomic DNA is derived from bitter gourd seeds, bitter gourd plants, or bitter gourd fruits.

[0022] This invention also relates to a molecular-assisted breeding method for a thick-fleshed bitter gourd variety. This method uses the aforementioned CAPS molecular marker to screen bitter gourd breeding materials and selects thick-fleshed bitter gourd materials for subsequent breeding.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] (1) Through whole-genome resequencing analysis, this invention found that the thin-fleshed bitter gourd mutant M17 has a 6-base (AGTGAA) insertion at position 12132249 on chromosome 6. Further analysis of the expression level of the gene Chr0601420 (its nucleotide sequence is shown in SEQ ID NO.9) at this mutation site using qPCR revealed that the expression level of this gene in M17 is significantly lower than that in Y52;

[0025] (2) Based on this insertional variation, this study developed a CAPS (Cleaved Amplified Polymorphic Sequence) molecular marker based on the restriction endonuclease PciI. The results showed that the PCR amplification products of all bitter gourd plants with thicker flesh could be digested by PciI into two fragments of 221bp and 125bp, or three fragments of 221bp, 125bp, and 346bp, while those of plants with thinner flesh could not be digested. The genotype-phenotype concordance rate reached 100%.

[0026] (3) This invention provides an efficient and accurate molecular marker that can be used for early identification and assisted selection breeding of bitter gourd flesh thickness, providing important technical support for improving the quality breeding efficiency of bitter gourd. Attached Figure Description

[0027] Figure 1 Cross-sections of fruits from thick-fleshed bitter gourd inbred line Y52 and thin-fleshed bitter gourd mutant M17;

[0028] Figure 2 To analyze the gene expression level of Chr0601420 using qPCR;

[0029] Figure 3 CAPS molecular marker analysis for F3 generation bitter gourd plants. Detailed Implementation

[0030] To enable those skilled in the art to better understand the technical content of this invention, the technical solution of this invention will be further described in detail below with reference to specific embodiments. The processes, conditions, experimental methods, and reagents used in implementing this invention are all common knowledge in the field and are conventional products on the market.

[0031] Example 1

[0032] 1.1 Experimental Methods

[0033] Ethyl methanesulfonate was used to induce mutagenesis in the seeds of bitter gourd inbred line Y52 (1.13 cm flesh thickness). In the M2 generation, a thin-fleshed bitter gourd mutant, M17, with a flesh thickness of 0.75 cm was screened (see details). Figure 1 M17 was crossed with the original parent Y52 to obtain the F1 generation. The F1 generation was then self-crossed to obtain the F2 generation, and a segregating population of the F2 generation was constructed. Fifty thick-fleshed bitter gourd plants and 50 thin-fleshed bitter gourd plants were selected from the F2 generation, and DNA was extracted from each plant. After adjusting the DNA concentration to be consistent, equal amounts were mixed to construct a DNA pool. Whole-genome resequencing analysis revealed that the M17 mutant contained a 6-base insertion (AGTGAA) at position 12132249 on chromosome 6. There was a site variation (C→CAGTGAA) in this region that was closely linked to the bitter gourd flesh thickness trait.

[0034] SEQ ID NO.1 (M17)

[0035] ATCCCACATTCATAACTTTTCAACCATTTCCTACACGTGAATAGTTAATAAATATTTTTTTCTTTTATATTAAAATATTATTTTTTACTATGTTAATAATGCGTAAGATGGGGTTTCACTTTTTAAAATTTTTTTTTTTTTGAAATTATTGGGATGACGGCACAATTTTGTTTTATAAATTTTCTTAGTACTTTGGATTTTGATTTTTTGATATGTCAA CA GTGAA ATGTGTGTGATATGGAAATTAACAAAAATATGTATTTCTTGATTACTGCATATTGTATTCATGTGAGTCACTAATTTTAACTTAATTTTAACATATTATTTTTTTTAGATTTGACTTCTTAGAT

[0036] SEQ ID NO.2 (Y52)

[0037] ATCCCACATTCATAACTTTTCAACCATTTCCTACACGTGAATAGTTAATAAATATTTTTTTCTTTTATATTAAAATATTATTTTTTACTATGTTAATAATGCGTAAGATGGGGTTTCACTTTTTAAAATTTTTTTTTTTTTGAAATTATTGGGATGACGGCACAATTTTGTTTTATAAATTTTCTTAGTACTTTGGATTTTGATTTTTTGATATGTCAA C ATGTGTGTGATATGGAAATTAACAAAAATATGTATTTCTTGATTACTGCATATTGTATTCATGTGAGTCACTAATTTTAACTTAATTTTAACATATTATTTTTTTTAGATTTGACTTCTTAGAT

[0038] To further verify the effectiveness of the CAPS marker, the F2 generation obtained from the cross between M17 and Y52 was self-crossed to produce the F3 generation. Forty-six individual plants with essentially the same flesh thickness from the F2 and F3 generations were selected. The flesh thickness of the F3 plants was statistically analyzed (Table 1) and CAPS molecular markers were examined (see details). Figure 3 ,Note: Figure 3 Sample No. 45 initially showed unclear bands during electrophoresis, but subsequent repeated experiments confirmed that it produced bands of 221bp, 125bp, and 346bp.

[0039] The CAPS molecular marker analysis method is as follows:

[0040] (1) Using the Kangwei Century DNA Extraction Kit (Catalog No.: CW0531M), bitter gourd DNA was extracted and the DNA concentration was adjusted to 50 ng / μL;

[0041] (2) The primers synthesized at Shanghai Sangon Biotech Co., Ltd. are shown below:

[0042] McChr06_12132249F: ATCCCACATTCATAACTTTTCAACC (SEQ ID NO.3); McChr06_12132249R: ATCTAAGAAGTCAAATCTAAAAAAA (SEQ ID NO.4);

[0043] The primers were diluted to 10 μM, and PCR amplification was performed using bitter melon DNA as a template with the primers mentioned above.

[0044] (3) The PCR reaction system is 20 μL: 10 μL of 2×Hieff® PCR Master Mix (Shanghai Yisheng Biotechnology Co., Ltd.), 0.5 μL of forward and reverse primers, 1 μL of DNA, and 8 μL of ddH2O.

[0045] (4) PCR amplification: 94℃ pre-denaturation, 5 min; 94℃ denaturation, 20 s, 56℃ annealing, 30 s, 72℃ extension, 30 s, 35 cycles; 72℃ extension, 10 min, 4℃ incubation for 5 min.

[0046] (5) Add 0.5 μL of restriction enzyme PciI to the PCR product, mix with a pipette, and digest overnight at 37°C.

[0047] (6) Prepare a 1% agarose gel and analyze the enzyme digestion products by agarose gel electrophoresis. The thickness of the pulp of the test sample can be distinguished according to the electrophoretic bands.

[0048] 1.2 Experimental Results

[0049] The results showed that the PCR amplification products of all F2 plants with thicker flesh (flesh thickness ≥ 1.00 cm) could be digested by PciI into two fragments of 221 bp and 125 bp, or three fragments of 221 bp, 125 bp, and 346 bp. However, the PCR amplification products of plants with thinner flesh (flesh thickness ≤ 0.75 cm) were 352 bp in size and could not be digested by PciI. The genotype and phenotype were 100% identical, indicating that the insertion of 6 bases at position 12132249 on chromosome 6 of the Y52 plant was closely linked to the thin-fleshed trait.

[0050] Table 1. Statistics on pulp thickness of individual F3 generation plants

[0051]

[0052] Further explanation: Based on the above findings, technicians can also use conventional sequencing methods to sequence the sequences of SEQ ID NO. 1 and SEQ ID NO. 2, directly identifying the thickness of the bitter melon pulp through the sequencing results. Although sequencing methods are relatively complex (compared to the aforementioned enzyme digestion methods), sequencing technology can provide more accurate and detailed sequence information, clearly identifying key sites related to bitter melon pulp thickness. Therefore, technicians can flexibly choose between sequencing or enzyme digestion methods to identify bitter melon pulp thickness based on different experimental objectives and conditions.

[0053] Example 2: Expression level of gene Chr0601420

[0054] Analysis revealed that the gene Chr0601420 is located upstream of the mutation site described in Example 1, and there may be a strong correlation between this gene and the mutation site. This example further utilizes qPCR to analyze the effect of this mutation site on the expression level of the gene Chr0601420.

[0055] 2.1 Experimental Methods

[0056] (1) RNA was extracted from bitter gourd 6 days and 10 days after pollination using TAKARA RNA extraction kit (catalog number: 9769);

[0057] (2) Take 1 μg of RNA from each sample and reverse transcribe the RNA into cDNA using the TOKOYO reverse transcription kit (catalog number: FSQ-201). Dilute the cDNA 5 times with ddH2O.

[0058] (3) The qPCR primers for the gene Chr0601420 and the internal reference gene were synthesized at Shanghai Sangon Biotech Co., Ltd., as shown below:

[0059] Chr0601420-RTF: TCATTATCCGTCGATGCCCA (SEQ ID NO.5);

[0060] Chr0601420-RTR: GCAAGCAGAGCAGGTCATAC (SEQ ID NO. 6);

[0061] McPP2A-RTF: TGTGAGGGACAAAGCTGTGG (SEQ ID NO.7);

[0062] McPP2A-RTR: ATGAAACAGCCCACATGCAG (SEQ ID NO. 8);

[0063] The primers were diluted to 10 μM, and qPCR was performed using bitter melon cDNA as a template with the primers described above.

[0064] (4) Prepare a 10 μL reaction system using TAKARA's real-time fluorescence kit (catalog number: RR420A): 1 μL cDNA, 0.2 μL each of forward and reverse primers (10 μM), 0.2 μL DyeII, 5 μL 2×Premix EX Taq, and 3.4 μL ddH2O. Place the mixture in a qPCR instrument.

[0065] (5) Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 3 s, 60℃ annealing and extension for 25 s, 40 cycles.

[0066] Each experiment was repeated in three replicates. Relative expression levels were analyzed using the ΔΔCt method, and significance was assessed using one-way ANOVA.

[0067] 2.2 Experimental Results

[0068] qPCR analysis showed that the expression level of this gene in M17 was significantly lower than that in Y52 (see details). Figure 2 ).

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a CAPS molecular marker detection reagent in identifying the thickness of the fruit flesh of Momordica charantia, characterized by, The CAPS molecular marker is located at position 222 of the nucleotide sequence shown in SEQ ID NO.

2. There is a variation between C and CAGTGAA at this position. If the base at position 222 of the nucleotide sequence shown in SEQ ID NO.2 is C, then the bitter melon to be tested is a thick-fleshed type. If the base at position 222 of the nucleotide sequence shown in SEQ ID NO.2 is CAGTGAA, then the bitter melon to be tested is a thin-fleshed type. The variety of bitter melon is the bitter melon inbred line Y52, the bitter melon mutant M17, or the F2 and F3 generations of the cross between the two.

2. Use according to claim 1, characterized in that, The thickness of bitter melon flesh is determined by the following method (i) or (ii): (i) Sequencing the sequence of SEQ ID NO.

2. If the nucleotide sequence at position 222 of SEQ ID NO.2 is C, then the bitter melon to be tested is a thick-fleshed bitter melon. If the nucleotide sequence at position 222 of SEQ ID NO.2 is modified to CAGTGAA, then the bitter melon to be tested is a thin-fleshed bitter melon. (ii) Perform PCR amplification on the SEQ ID NO.2, then digest the amplified product with the restriction endonuclease PciI, and perform electrophoresis. Determine the thickness of the bitter melon flesh based on the electrophoresis results. If both 221bp and 125bp bands are produced simultaneously, or both 221bp, 125bp and 346bp bands are produced simultaneously, then the bitter melon to be tested is a thick-fleshed type. If only a 352bp band is produced, then the bitter melon to be tested is a thin-fleshed type. The thick-fleshed bitter melon has a flesh thickness greater than or equal to 1.00 cm; the thin-fleshed bitter melon has a flesh thickness less than or equal to 0.75 cm.

3. A primer pair for amplifying the CAPS molecular marker of claim 1, wherein, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. A kit for identifying the thickness of the fruit pulp of Momordica charantia, characterized by, The kit contains the primer pair as described in claim 3 and the restriction endonuclease PciI.

5. A method for identifying the thickness of the fruit flesh of Momordica charantia L., characterized by, Includes the following steps: (1) Extract the genomic DNA of bitter gourd to be tested; the bitter gourd variety is bitter gourd inbred line Y52, bitter gourd mutant M17 or the F2 and F3 generations of the hybrid of the two; (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the primer pair described in claim 3 to obtain the amplification product; (3) The amplified product was digested with restriction endonuclease PciI and electrophoresed. The thickness of the bitter melon flesh was determined based on the electrophoresis results. If bands of 221bp and 125bp were generated at the same time, or bands of 221bp, 125bp and 346bp were generated at the same time, the bitter melon to be tested was a thick-fleshed bitter melon. If only a band of 352bp was generated, the bitter melon to be tested was a thin-fleshed bitter melon. The flesh thickness of the thick-fleshed bitter melon was greater than or equal to 1.00cm. The flesh thickness of the thin-fleshed bitter melon was less than or equal to 0.75cm.

6. The method of claim 5, wherein, Each 20 μL PCR reaction system contains: 10 μL 2×HieffPCR Master Mix, 0.5 μL each of forward and reverse primers, 1 μL DNA, and 8 μL ddH2O; the concentrations of the forward and reverse primers are 10 μM, and the concentration of the DNA is 50 ng / μL.

7. The method of claim 5, wherein, PCR amplification procedure: 94℃ pre-denaturation, 5 min; 94℃ denaturation 20 S, 56℃ annealing 30 S, 72℃ extension 30 S, 35 cycles; 72℃ extension 10 min, 4℃ keeping 5 min.

8. The method of claim 5, wherein, The genomic DNA of the Momordica charantia is derived from Momordica charantia seeds, Momordica charantia plants or Momordica charantia fruits.

9. A method of molecular assisted breeding of thick-fleshed Momordica charantia varieties, characterized by, The method according to any one of claims 5-8 is used to screen Momordica charantia breeding materials, and a thick-fleshed Momordica charantia material is selected for subsequent breeding; and the Momordica charantia is a selfing line Y52, a mutant M17 or an F2 or F3 generation of a cross between the two.

Citation Information

Patent Citations

  • Momordica charantia root knot nematode disease resistance SNP marker and application thereof

    CN116445644A

  • Molecular marker linked with yellow peel of bitter gourd and application of molecular marker

    CN120210424A