DNA enzyme triple-helix molecular switch detection system adaptive to personal glucometer as well as preparation method and application of DNA enzyme triple-helix molecular switch detection system

Abstract

The invention provides a DNA enzyme triple-helix molecular switch detection system adaptive to a personal glucometer as well as a preparation method and application of the DNA enzyme triple-helix molecular switch detection system, and belongs to the technical field of biosensors. The DNA enzyme triple-helix molecular switch disclosed by the invention comprises an aptamer containing two nucleotide arm segments and DNA enzyme covalently coupled with a magnetic bead, two nucleotide arm segments of the aptamer and DNA enzyme form a triple helix structure; the two nucleotide arm segments comprise a nucleotide sequence SEQ ID NO.1 at the 5'end of the aptamer and a nucleotide sequence SEQ ID NO.2 at the 3 'end of the aptamer. According to the invention, the flexibility of an original aptamer is limited by using a terminal fixation strategy, the spatial conformation of the original aptamer is stabilized, the affinity of the aptamer to a target is improved, and the sensitivity of the aptamer to the target is improved by using a triple-helix molecular switch containing DNA enzyme and nano-enzyme-gold nanoparticles. Accurate and sensitive detection of trace pollutants in food is realized by measuring the reduction amplitude of the glucose concentration in the detection liquid through a household glucometer.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biosensors, and particularly relates to a DNA enzyme triple helix molecular switch detection system suitable for a personal blood glucose meter, and a preparation method and application thereof. BACKGROUND

[0002] Food safety hazards such as ochratoxin A (OTA) are toxic metabolites mainly produced by aspergillus, which often contaminate corn, wheat, oat and other cereals and their products, as well as coffee beans, raisins and other agricultural products. OTA not only has strong nephrotoxicity, but also has potential risks such as carcinogenicity (especially kidney cancer), immunosuppression, and teratogenicity. Due to its colorless, odorless and stable nature, it is difficult to completely destroy through conventional processing, so it is crucial to effectively detect food and feed.

[0003] The commonly used detection methods mainly include the following: high performance liquid chromatography (HPLC), especially combined with fluorescence detector or mass spectrometer (HPLC-MS / MS), which is the most commonly used high-precision quantitative method in the laboratory. However, it is time-consuming and costly, and is not suitable for rapid screening of on-site or large quantities of samples. Enzyme-linked immunosorbent assay (ELISA) and colloidal gold immunochromatographic test strip are used as rapid on-site detection tools, but their sensitivity and accuracy are usually lower than HPLC, mainly providing qualitative or semi-quantitative rough results, which is difficult to meet the requirements of accurate quantification.

[0004] Compared with antibodies, aptamers have stronger specificity, higher affinity to target molecules, are easier to obtain, can be synthesized in large quantities and rapidly in vitro, and have simpler preparation methods, and can be screened for different types of target substances. At the same time, household portable blood glucose meters can accurately measure blood glucose and have the characteristics of small size, low cost and simple operation, and are essential medical supplies for many families, which can provide accurate quantitative results. Therefore, developing an aptamer biosensor to use a portable blood glucose meter for quantitative detection of non-glucose substances and other food safety hazards provides convenience for real-time detection of toxins, pesticide residues and other harmful substances in food at home, and has wide application prospects. SUMMARY

[0005] Therefore, one of the purposes of the present application is to provide a DNA enzyme triple helix molecular switch.

[0006] The second purpose of the present application is to provide a preparation method of the DNA enzyme triple helix molecular switch.

[0007] The third purpose of the present application is to provide an application of the DNA enzyme triple helix molecular switch or the preparation method in the preparation of a product for detecting target substances.

[0008] The fourth object of the present application is to provide a kit.

[0009] The fifth object of the present application is to provide a method for detecting a target.

[0010] In order to achieve the above-mentioned objects, the present application provides the following technical solutions. A DNA enzyme triple helix molecular switch, the triple helix molecular switch comprising an aptamer containing two nucleotide arm segments and a DNA enzyme covalently coupled with a magnetic bead; the two nucleotide arm segments of the aptamer form a triple helix structure with the DNA enzyme; the two nucleotide arm segments comprise a 5' end nucleotide sequence SEQ ID NO. 1 of the aptamer and a 3' end nucleotide sequence SEQ ID NO. 2 of the aptamer.

[0011] Preferably, the nucleotide sequence of the DNA enzyme is shown as SEQ ID NO. 3.

[0012] Preferably, the aptamer comprises an aptamer targeting a target, and the target comprises ochratoxin A.

[0013] The present application also provides a preparation method of the DNA enzyme triple helix molecular switch, comprising the following steps: The aptamer containing two nucleotide arm segments is activated to obtain an activated aptamer; the activated aptamer is added into the DNA enzyme covalently coupled with the magnetic bead, and then a mixed solution is added for incubation; the concentration of the aptamer is 50-250 nM; the mixed solution is 20 mM PBS containing 0-10 mM Mg 2+ , pH 7.2.

[0014] The present application also provides an application of the DNA enzyme triple helix molecular switch or the preparation method in the preparation of a product for detecting a target, wherein the target is a target targeted by an aptamer.

[0015] The present application also provides a kit, the kit comprising the DNA enzyme triple helix molecular switch, a Single DNA labeled with a magnetic bead and a gold nanoparticle at two ends respectively; the Single DNA contains a DNA enzyme specific recognition site.

[0016] The present application also provides a method for detecting a target, wherein the target is a target targeted by an aptamer, and the kit is used for detection, comprising the following steps: The DNA enzyme triple helix molecular switch is magnetically separated to remove supernatant, 300 μL of a to-be-detected solution is added, and after incubation at room temperature, the supernatant is removed by magnetic separation, 300 μL of PBS buffer is added after washing, and reaction liquid A is obtained; The supernatant of the SingleDNA magnetic separation removing of the two ends marked with magnetic beads and gold nanoparticles respectively is removed, mixed with the reaction liquid A, and Pb 2+ After 10-50 min of post-reaction, the supernatant is removed by magnetic separation; The glucose solution is added to the supernatant, and the detection is performed by using a blood glucose meter after 10-30 min of reaction at room temperature.

[0017] Preferably, the time of room temperature incubation is 30-60 min.

[0018] Preferably, the concentration of Pb 2+ is 2-10 mM.

[0019] Preferably, the concentration of the glucose solution is 30 mM, and the volume ratio of the supernatant to the glucose solution is 1:2.

[0020] Compared with the prior art, the present application has the following beneficial effects: The present application provides a DNA enzyme triple helix molecular switch, which uses a terminal fixation strategy to limit the flexibility of the original aptamer, stabilizes the spatial conformation, and further improves the affinity of the aptamer to the target. The triple helix molecular switch provided by the present application can be used for detecting target objects. After specific binding of the target objects and the aptamer, the triple helix molecular switch releases the DNA enzyme. The solution containing the DNA enzyme is added to the SingleDNA detection liquid with the two ends marked with magnetic beads and gold nanoparticles respectively, and the coenzyme ion Pb 2+ is added at the same time. The DNA enzyme dependent on Pb 2+ specifically cleaves the signal tag specific site (rA) after the target recognition is completed, and the AuNPs are cleaved and released. The free AuNPs are separated and mixed with the glucose solution, and the change of the glucose concentration is detected by using a blood glucose meter. The higher the concentration of the target objects in the detection system, the greater the decrease of the glucose concentration. The quantitative detection of the target objects is realized according to the change of the glucose concentration. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 FIG. 1 is a structural diagram of a DNA enzyme triple helix molecular switch; Figure 2 FIG. 2 is a TEM diagram of Au NPs; Figure 3 FIG. 3 is a particle size diagram of Au NPs; Figure 4 FIG. 4 is an ultraviolet-visible absorption spectrum diagram of Au NPs; Figure 5 FIG. 5 is an enzyme activity determination diagram of Au NPs; Figure 6 FIG. 6 is a working curve of a detection method; Figure 7 FIG. 7 is a feasibility analysis diagram; Figure 8 Figure 2 is a signal change detection chart; wherein the left chart is the detection result of the Blank group, and the right chart is the detection result of the A11-DNAzyme-OTA-SD-Au group; Figure 9 Figure 3 is an agarose gel electrophoresis chart of triple helix structure; wherein, A is an OTA aptamer with different arm lengths, D refers to DNAzyme, + refers to containing, and - refers to not containing; from left to right, the lanes are respectively Marker, OTA aptamer without arm segment, A7, A7+DNAzyme, A9, A9+DNAzyme, A11, A11+DNAzyme, A13, A13+DNAzyme, A15, and A15+DNAzyme gel electrophoresis results; Figure 10 Figure 4 is a result of condition optimization; wherein, A is the influence of the concentration of the aptamer on the detection result; B is the influence of the Mg 2+ concentration on the result; C is the influence of the Pb 2+ concentration on the result; and D is the influence of the DNAzyme shearing MB-SingleDNA-Au time on the result; Figure 11 Figure 5 is the accuracy of the detection method; Figure 12 Figure 6 is the stability of the detection method; Figure 13 Figure 7 is the specificity of the detection method; Figure 14 Figure 8 is the actual sample detection of the detection method. DETAILED DESCRIPTION

[0022] The present application provides a DNAzyme triple helix molecular switch, which comprises an aptamer containing two nucleotide arm segments and a DNAzyme covalently coupled with a magnetic bead; the two nucleotide arm segments of the aptamer form a triple helix structure with the DNAzyme; the two nucleotide arm segments comprise a 5' end nucleotide sequence SEQ ID NO. 1: GCTCGGAGAAG of the aptamer, and a 3' end nucleotide sequence SEQ ID NO. 2: GAAGAGGCTCG of the aptamer.

[0023] In the present application, the nucleotide sequence of the DNAzyme is as shown in SEQ ID NO. 3: CATCTcttctccgagccggtCGAAATAGTGAGT, wherein the lowercase letters represent the sequence complementary to the arm end of the aptamer.

[0024] In the present application, the aptamer includes an aptamer targeting a target, and the target includes ochratoxin A. The nucleotide sequence of the aptamer targeting ochratoxin A and containing two nucleotide arm segments is shown in SEQ ID NO. 4: GCTCGGAGAAGGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGAAGAGGCTCG. The present application can realize detection of various different hazards including toxins, agricultural and veterinary drugs and heavy metals by replacing aptamers of different hazards in the triple helix molecular switch.

[0025] The present application also provides a preparation method of the DNA enzyme triple helix molecular switch, including the following steps: activating an aptamer containing two nucleotide arm segments to obtain an activated aptamer; adding the activated aptamer into DNA enzyme covalently coupled with magnetic beads, and then adding a mixed solution for incubation; the concentration of the aptamer is 50-250 nM; the mixed solution is 20 mM PBS containing 0-10 mM Mg 2+ , pH 7.2. As an implementable mode, the source of Mg 2+ in the specific embodiment of the present application is magnesium chloride hexahydrate.

[0026] In the method for preparing the DNA enzyme triple helix molecular switch, the activation of the aptamer is preferably 95 ℃ for 10 min; the concentration of the aptamer is preferably 50-250 nM, further preferably 100-250 nM, and more preferably 200 nM. It has been found in the present application that the concentration of the aptamer directly affects the number and stability of the triple helix structure, and the concentration of the aptamer provided in the present application is helpful to the formation of the triple helix structure. In the present application, the concentration of Mg 2+ in the mixed solution is preferably 0-10 mM, further preferably 2.5-10 mM, and more preferably 5 mM; and the Mg 2+ in the solution when the aptamer is mixed with the DNA enzyme provides a positive electric environment for triple helix formation, and a suitable concentration of Mg 2+ promotes the formation of the triple helix structure.

[0027] The present application also provides application of the DNA enzyme triple helix molecular switch or the preparation method in preparation of a product for detecting a target, and the target is a target targeted by the aptamer.

[0028] The present application also provides a kit, and the kit includes the DNA enzyme triple helix molecular switch and Single DNA labeled with magnetic beads and gold nanoparticles at two ends, respectively; and the Single DNA contains a specific recognition site of the DNA enzyme.

[0029] The nucleotide sequence of the SingleDNA in the application is NH2-ACTCACTAT / rA / GGAAGAGATG-SH, that is, the 5' section of the nucleotide shown in the nucleotide sequence 5'-ACTCACTATGGAAGAGATG-3' shown in SEQ ID NO. 5 is modified by NH2, the 3' end is modified by SH, and the modification of the DNA enzyme specific recognition site rA is made between the 9th and 10th bases of the nucleotide sequence shown in SEQ ID NO. 5.

[0030] The application further provides a method for detecting a target, which is a target targeted by an aptamer, using the kit, comprising the following steps: removing the supernatant of the magnetic separation of the DNA enzyme triple helix molecular switch, adding 300 μL of a to-be-detected solution, removing the supernatant after incubation at room temperature, adding 300 μL of PBS buffer after washing, and obtaining a reaction solution A; mixing the SingleDNA labeled with magnetic beads and gold nanoparticles at two ends with the reaction solution A, adding Pb 2+ after the reaction for 10-50 min, removing the supernatant by magnetic separation; adding a glucose solution to the supernatant, reacting at room temperature for 10-30 min, and then detecting by using a blood glucose meter.

[0031] In the method for detecting a target in the application, the incubation time at room temperature is preferably 30-60 min, and more preferably 40-50 min; the target competes with the aptamer to release the DNA enzyme by incubation at room temperature in the application. The concentration of Pb 2+ after the addition is preferably 20-45 min, and more preferably 40 min. The concentration of Pb 2+ is preferably 2-10 mM, more preferably 4-8 mM, and more preferably 6 mM; it is found in the application that Pb 2+ has an auxiliary effect on the cleavage of singleDNA by DNA enzyme, and the concentration of Pb 2+ in the application can promote the cleavage of singleDNA by DNA enzyme. The concentration of the glucose solution is preferably 30 mM, and the volume ratio of the supernatant to the glucose solution is preferably 1:2. As an implementable way, the source of Pb 2+ in the specific embodiments of the application is lead nitrate.

[0032] In the detection method provided by the application, the target specifically binds to the aptamer, the DNA enzyme triple helix molecular switch releases the DNA enzyme, the solution containing the DNA enzyme is added to the SingleDNA detection solution labeled with magnetic beads and gold nanoparticles at two ends, and the coenzyme ion Pb 2+ is added at the same time. 2+The DNA enzyme instead of natural enzyme is used to cut the specific site (rA) of the signal tag after the target recognition is completed, the AuNPs are cut and released, the free AuNPs are separated and mixed with the glucose solution, after the mixing, the AuNPs have the glucose oxidase activity and can catalyze the degradation of part of the glucose, and the accurate concentration of the remaining glucose is detected by using the blood glucose meter. The higher the concentration of the target in the detection system is, the more the aptamers combined with the target are, the more the triple helix molecular switch consumed is, the more the DNA enzyme released is, the more the AuNPs produced after the Au-SingleDNA is cut is, and the greater the decrease of the glucose concentration is, so that the quantitative detection of the target can be realized according to the change of the glucose concentration.

[0033] The present application rationally utilizes the triple helix molecular switch containing the DNA enzyme and the nano-enzyme-gold nanoparticles, realizes the accurate and sensitive detection of the trace pollutants in the complex food matrix by accurately determining the decrease of the glucose concentration in the detection liquid by using the household blood glucose meter, avoids the complex work and the technology such as the coupling of the glucose oxidase or the drawing of the working curve of the detection system for the instrument correction in the previous technology using the blood glucose meter, simplifies the operation, greatly improves the repeatability and stability of the detection, ensures the accuracy of the detection results, and has a good practical application prospect.

[0034] The technical solutions provided by the present application will be described in detail in combination with the embodiments below, but they cannot be understood as the limitation on the protection scope of the present application.

[0035] Example 1 A DNA enzyme triple helix molecular switch.

[0036] In the embodiment, the aptamer is the aptamer targeting ochratoxin A.

[0037] The nucleotide sequence of the aptamer (denoted as A11) targeting ochratoxin A containing two nucleotide arm segments is shown in SEQ ID NO. 4: GCTCGGAGAAGGATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGAAGAGGCTCG.

[0038] The nucleotide sequence of the DNA enzyme is shown in SEQ ID NO. 3: CATCTcttctccgagccggtCGAAATAGTGAGT.

[0039] The preparation method is as follows: 1. Carboxyl activation on the surface of the magnetic beads: Take 100 μL Mag-COOH (300 nm, 10 mg / mL, surface carboxyl content ≥ 70 μM / g) magnetic beads into a 1 mL centrifuge tube, remove the supernatant by magnetic separation, wash twice with 200 μL MEST solution (100 mM MES, pH 5.0, containing 0.05% Tween 20) by magnetic separation, and then remove the supernatant; quickly add 100 μL of freshly prepared EDC solution (10 mg / mL, dispersed with the above MEST solution) and 100 μL of NHS (10 mg / mL, dispersed with the above MEST solution) solution to the centrifuge tube containing the magnetic beads, vortex to fully suspend the magnetic beads, and activate at 25 ℃ for 30 min. During this period, keep the magnetic beads in a suspended state (you can use a vertical mixer to mix by inversion).

[0040] 2. Covalent coupling of magnetic beads (MB) and DNAase: Remove the supernatant by magnetic separation, add 300 μL of 200 nM DNAase, and couple at 25 ℃ for 2 h. After coupling, remove the supernatant by magnetic separation, resuspend the magnetic beads with 200 μL of PBS solution (0.1M, pH 7.2, containing 1% BSA), and react at 25 ℃ for 1 h to block the unreacted activated carboxyl groups on the surface of the magnetic beads. After blocking, wash and resuspend the MB-DNAase in PBS (20 mM PBS, pH 7.2) solution.

[0041] 3. Construction of DNAase triple helix molecular switch (THMS): Remove the supernatant of MB-DNAase by magnetic separation, add 300 μL of 200 nM A11 (95 ℃ activation for 10 min, 4 ℃ cooling for 20 min), mix A11 and MB-DNAase in PBS (20 mM PBS containing 5 mM Mg 2+ , pH 7.2) thoroughly, and incubate at 37 ℃ for 1.5 h to form THMS (MB-DNAase-A11). Remove the supernatant by magnetic separation, wash and resuspend in PBS (20 mM PBS, pH 7.2) solution to obtain the DNAase triple helix molecular switch. The structure of the obtained DNAase triple helix molecular switch is shown in Figure 1 .

[0042] Example 2 A kit.

[0043] The kit of this example includes the DNAase triple helix molecular switch of Example 1, and also includes Single DNA labeled with magnetic beads and gold nanoparticles at both ends.

[0044] The nucleotide sequence of SingleDNA is NH2-ACTCACTAT / rA / GGAAGAGATG-SH.

[0045] The preparation method of SingleDNA labeled with magnetic beads and gold nanoparticles at both ends is as follows: 1. Preparation of AuNPs: Before preparing AuNPs, all glassware was cleaned with freshly prepared aqua regia solution (1:3 HNO3 / HCl) and rinsed with water. 1 mL of 1% (w / w) HAuCl4 solution was added to 95 mL of distilled water, and heated to boiling with stirring. Then, 1% (w / w) Na3C6H5O7·2H2O was quickly added, and under vigorous stirring, the solution changed from light yellow to wine red. The wine red solution was boiled for another 15 min, cooled to room temperature and stored in the refrigerator (4°C) for standby.

[0046] 2. Characterization of AuNPs: The morphology ( Figure 2 ) and particle size distribution ( Figure 3 ) of AuNPs were observed by transmission electron microscopy (TEM). AuNPs were uniformly dispersed in uniform spherical shape. The average size of AuNPs was measured to be 26 nm. AuNPs solution showed a local surface plasmon resonance peak maximum (λ max ) at 520 nm. Figure 4

[0047] 3. Glucose oxidase-like activity assay of AuNPs: To determine the glucose oxidase activity of AuNPs nanoscale enzyme, the glucose acid and H2O2 produced by glucose oxidation reaction were verified by Fe 3+ / hydroxylamine method and HRP / TMB colorimetric method, respectively. As shown in Figure 4 , glucose acid can react with hydroxylamine and Fe 3 + to form a red complex, thereby significantly enhancing the absorbance. Similarly, when TMB and HRP coexist, the characteristic peak of oxTMB appears at 652 nm, indicating the presence of H2O2 in the glucose catalytic reaction using AuNPs. Figure 5

[0048] 4. Activation of carboxyl groups on the surface of magnetic beads: ​​Take 100 μL Mag COOH (300 nm, 10 mg / mL, surface carboxyl content ≥70 μM / g) magnetic beads into a 1 mL centrifuge tube, remove the supernatant by magnetic separation, and wash twice with 200 μL MEST solution (100 mM MES, pH 5.0, containing 0.05% Tween 20) by magnetic separation, then remove the supernatant; quickly add freshly prepared 100 μL EDC solution (10 mg / mL, dispersed with the above MEST solution) and 100 μL NHS (10 mg / mL, dispersed with the above MEST solution) solution to the centrifuge tube containing the magnetic beads, vortex to fully suspend the magnetic beads, and activate at 25 °C for 30 min. During this period, keep the magnetic beads in a suspended state (use a vertical mixer to mix and invert).

[0049] 5. Covalent coupling of magnetic beads (MB) and SingleDNA: Remove the supernatant by magnetic separation, add 300 μL of 200 nM SingleDNA, and couple at 25 °C for 2 h. After coupling, remove the supernatant by magnetic separation, resuspend the magnetic beads with 200 μL of PBS solution (pH 7.2, containing 1% BSA), and react at 25 °C for 1 h to block the unreacted activated carboxyl groups on the surface of the magnetic beads. After blocking, wash and add TCEP (10 mM) for reduction at room temperature for 30 min. After reduction, wash and resuspend the MB-SingleDNA in 300 μL of PBS solution (20 mM PBS, pH 7.2) for standby use.

[0050] 6. Coupling of MB-SingleDNA and AuNPs: Take the AuNPs solution, adjust the pH of the AuNPs solution to 8.5. Centrifuge 2 mL of AuNPs solution at pH 8.5 (10000 rpm, 15 min). After centrifugation, discard the supernatant. Then add 400 μL of ultrapure water to each tube and mix well to obtain a concentrated AuNPs solution. Take 1 mL of the concentrated AuNPs solution and add it to the TCEP-activated MB-SingleDNA, then add a NaCl (2 M) solution for aging. Repeat the salt aging process until the concentration of sodium chloride in the system reaches 50 mM (use a syringe to add 2M NaCl dropwise to the system until the concentration reaches 50 mM). Then mix and place for 8 h to allow the MB-SingleDNA and AuNPs to fully couple (volume ratio of MB-SingleDNA: AuNPs = 1:2). After coupling, remove the supernatant by magnetic separation, wash and add PBS (20 mM PBS, pH 7.2) for storage.

[0051] Example 3 A method for detecting a target.

[0052] The target substance in this embodiment is ochratoxin A, and the kit in Example 2 is used for detection, and the detection method is as follows: The DNA enzyme triple helix molecular switch magnetic separation supernatant was removed, 300 μL of the test solution was added, and the reaction was carried out at room temperature for 40 min. The magnetic separation supernatant was removed, washed and added with PBS (20 mM PBS, pH 7.2) for preservation, and reaction solution A was obtained.

[0053] The SingleDNA magnetic separation supernatant labeled with magnetic beads and gold nanoparticles at both ends was mixed with reaction solution A, 6 mM Pb 2+ was added, and the reaction was carried out for 40 min. The auxiliary DNA enzyme cut the MB-SingleDNA-Au. The supernatant was removed by magnetic separation, and glucose solution (the concentration of the glucose solution was 30 mM, and the volume ratio of the supernatant to the glucose solution was 1:2) was added to the supernatant. The mixture was uniformly reacted at room temperature for 30 min, and then detected by a blood glucose meter.

[0054] The method constructed in this embodiment was used to detect different concentrations of OTA (0, 0.01, 0.02, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50 ng / mL) in the concentration range of 0~50 ng / mL, and a working curve was established based on a four-parameter logistic regression model (4-PL) (Formula 1). Figure 6 )。

[0055] Y=A+(D-A) / (1+(X / C)^B) (Formula 1); In the formula, A and D represent the lower and upper asymptotes respectively, C and B represent the inflection point concentration and Hill slope respectively, X represents the OTA concentration in the sample, and Y represents the blood glucose meter response value.

[0056] The fitting results show that the goodness of fit of the 4-PL model is high, and the determination coefficient R 2 is 0.98. In the range of 0.01~0.1 ng / mL, the OTA concentration and the blood glucose meter detection signal show a linear relationship, y=-8.306x+7.416, and the determination coefficient R 2 is more than 0.99 (the insert in Figure 6 ), and the detection limit of OTA is 0.09 ng / mL.

[0057] Example 4 Verification and optimization of the detection method.

[0058] 1. Verify the feasibility of detection.

[0059] Blank: 30 mM glucose solution, directly detected by a blood glucose meter; SD-Au: The supernatant of Single DNA magnetic separation with magnetic beads and gold nanoparticles labeled on both ends in Example 3 was mixed with DNA enzyme alone, 6 mM Pb was added, and the reaction was allowed to proceed for 40 min. The supernatant was separated by magnetic separation, and a glucose solution (30 mM glucose solution, the volume ratio of supernatant to glucose solution was 1:2) was added to the supernatant. After mixing, the glucose meter was used for detection. 2+ , the reaction was allowed to proceed for 40 min. The supernatant was separated by magnetic separation, and a glucose solution (30 mM glucose solution, the volume ratio of supernatant to glucose solution was 1:2) was added to the supernatant. After mixing, the glucose meter was used for detection. A11-DNAzyme-SD-Au: The test solution was detected using the method of Example 3, and the test solution was 300 μL PBS (20 mM PBS, pH 7.2); A11-DNAzyme-OTA-SD-Au: The test solution was detected using the method of Example 3, and the test solution was 300 μL OTA solution (10 ng / mL); Results are shown in Figure 7 and Figure 8 The results show that the SD-Au group has the strongest cutting ability and the most Au cut off and the least remaining Au, so the detection result is the lowest because the DNA enzyme does not form a triple helix structure. The A11-DNAzyme-SD-Au group has the least Au cut off or even no Au cut off and the most remaining Au because the triple helix structure is formed, the cutting ability of the DNA enzyme is inhibited, the test solution does not contain OTA that specifically binds to the aptamer, and the DNA enzyme is not released. The A11-DNAzyme-OTA-SD-Au group has the most Au cut off and the least remaining Au because the OTA specifically binds to the aptamer, the triple helix structure is opened, and the DNA enzyme is released. Therefore, the detection result is equivalent to that of Single-Au. It is shown that the catalytic ability of single DNA-Au alone is the strongest, and the detected glucose concentration in the system is the lowest. When the triple helix structure is formed, the cutting ability of the DNA enzyme on single DNA-Au is inhibited, and the detected glucose concentration in the system is the highest. When the triple helix molecular switch is opened by adding OTA, the exposed DNA enzyme cuts single DNA-Au, and the released Au catalyzes glucose to cause a signal change.

[0060] 2. Effect of aptamer arm length on triple helix structure.

[0061] The difference between this example and Example 1 is that the ochratoxin A aptamer sequence is shown in Table 1.

[0062] Table 1 Nucleotide sequence Note: Lowercase letters represent the nucleotide sequence of the aptamer arm segment at both ends.

[0063] The formation of THMS was verified by agarose gel electrophoresis analysis. The results are shown in Figure 9 When the arm length exceeds 11 base pairs, a stable triplex is formed, and the electrophoretic mobility of the triplex complex is significantly delayed compared with A11 or DNAse components, so A11 is selected for subsequent experiments.

[0064] 3. The effect of aptamer concentration on the results when preparing a triple helix structure.

[0065] The preparation method in Example 1 is adopted, except that the aptamer concentration is set to 0, 50, 100, 200, and 250 nM, respectively, to prepare different triple helix structures. The SingleDNA with magnetic beads and gold nanoparticles labeled at both ends in Example 2 is prepared into different kits, and the method in Example 3 is adopted to detect PBS (20 mM PBS, pH 7.2).

[0066] The results are shown in A of Figure 10 The higher the A11 concentration, the more triple helix structures are formed, the fewer DNA enzymes are exposed, the fewer AuNPs are cut off, the less glucose is catalyzed, the more glucose is left, and the higher the result value detected by the blood glucose meter. When A11 is 200 nM, the most triple helix structures are formed, and the result value detected is the highest.

[0067] 4. The effect of Mg 2+ concentration on the results when preparing a triple helix structure.

[0068] The preparation method in Example 1 is adopted, except that the Mg 2+ concentration is set to 0, 2.5, 5, 7.5, and 10 mM, respectively, to prepare different triple helix structures. The SingleDNA with magnetic beads and gold nanoparticles labeled at both ends in Example 2 is prepared into different kits, and the method in Example 3 is adopted to detect PBS (20 mM PBS, pH 7.2).

[0069] The results are shown in B of Figure 10 Mg 2+ provides a positive environment for the formation of a triple helix. An appropriate concentration of Mg 2+ will promote the formation of a triple helix structure. When preparing a triple helix molecular switch, Mg 2+ (magnesium chloride hexahydrate) is added to the system. The triple helix molecular switch prepared by separation contains different concentrations of Mg 2+ . When the OTA is not contained in the test solution, the higher the concentration of magnesium ions, the more triple helix structures are formed, the fewer DNA enzymes are exposed, the fewer AuNPs are cut off, the less glucose is catalyzed, the more glucose is left, and the higher the result value detected by the blood glucose meter. Mg 2+At a concentration of 5 mM, the triple helix structure is most abundant, and the detection result value is the highest.

[0070] 5. During Pb detection 2+ The effect of concentration on the results.

[0071] The method described in Example 3 was used to detect 10 ng / mL OTA standard, the difference being that Pb was added at concentrations of 2, 4, 6, 8, and 10 mM respectively during the detection. 2+ .

[0072] The results are as follows Figure 10 As shown in C, after OTA binds to the aptamer, the DNase is separated and exposed, and the Pb in the detection system is then analyzed. 2+ The higher the concentration of Pb, the better the effect of DNase cleavage, the more AuNPs are cleaved, the more glucose is catalyzed, the less uncatalyzed glucose remains in the solution, and the lower the detected value of the blood glucose meter. 2+ When the concentration was 6 mM, the detection result was the lowest, and the result remained basically unchanged as time increased.

[0073] 6. The effect of the time for DNase to cleave MB-SingleDNA-Au on the results.

[0074] The method described in Example 3 was used to detect 10 ng / mL OTA standard, the difference being that Pb was added. 2+ After reacting for 10, 20, 30, 40 and 50 min respectively, the supernatant was magnetically separated for subsequent reactions.

[0075] The results are as follows Figure 10 As shown in D, after OTA binds to the aptamer, the exposed DNase is separated and placed in Pb. 2+ Under assisted shearing conditions, the longer the shearing time, the more AuNPs are sheared off, the more glucose is catalyzed, the less uncatalyzed glucose remains in the solution, and the lower the blood glucose meter reading. The lowest reading is obtained after 40 minutes of shearing, and the result remains essentially unchanged over time.

[0076] Example 5 Detection accuracy and stability.

[0077] The kit from Example 2 and the method from Example 3 were used for detection.

[0078] 1. Repeatability: Repeat the test of 10 ng / mL OTA standard solution 5 times and calculate the RSD value of the 5 results: RSD = (standard deviation SD / arithmetic mean X) × 100%.

[0079] The results of the 5 tests are as follows Figure 11As shown, the RSD value of 5 detection results was 1.41%, indicating that the constructed detection method had good accuracy.

[0080] 2. Stability: The kit in Example 2 was stored in a 4°C refrigerator for 5 days, and a 10 ng / mL OTA standard solution was detected once a day. The detection results of 5 consecutive days were compared (Fig. 2B), Figure 12 indicating that the detection intensity remained basically stable as the storage time was prolonged, indicating that the constructed sensor had high stability.

[0081] 3. Specificity: In order to verify the specificity of the detection method, ACE, IMD, Pb 2+ , CPF and CRB were selected as interference substances for specificity analysis. ACE, IMD, Pb 2+ , CPF and CRB were mixed with OTA to prepare a test solution, so that the concentrations of ACE, IMD, Pb 2 + , CPF and CRB in the test solution were 50 ng / mL, and the concentration of OTA was 10 ng / mL.

[0082] The results are shown in Figure 13 As shown, when other interfering toxins coexisted with OTA (10 ng / mL) even at a concentration of 50 ng / mL, there was no significant difference in the signal response compared with the detection signal of OTA alone. Therefore, this strategy has excellent specificity for target analytes, which is helpful for the determination of OTA in complex actual samples.

[0083] 4. Accuracy: To evaluate the effectiveness and practicability of the method, an OTA actual sample spiking recovery test was performed: 5 g of the pulverized sample was mixed with 10 mL of a methanol aqueous solution (Vmethanol:Vwater = 7:3), vortexed for 15 min, then allowed to stand for 5 min, and centrifuged 3 times (6000 rpm, 10 min) to obtain a sample stock solution stored in a 4°C refrigerator. The sample stock solution was verified by HPLC to be free of OTA. After 5-fold dilution, different concentrations (0, 0.01, 0.02, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50 ng / mL) of OTA standard were added to the sample to obtain an actual sample, which was detected, and the results are shown in Figure 14 Corn, which is easily contaminated by OTA, was selected as the actual sample, and the spiking recovery rate was between 90.40% and 103.00%, indicating that the constructed method was less affected by the matrix effect, and could be applied to the detection of OTA in food in daily life, and had broad application prospects.

[0084] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A DNAse triple helix molecular switch characterized in that, The triple helix molecular switch comprises an aptamer containing two nucleotide arm segments and a DNA enzyme covalently coupled with a magnetic bead; the two nucleotide arm segments of the aptamer form a triple helix structure with the DNA enzyme; the two nucleotide arm segments comprise a 5' end nucleotide sequence SEQ ID NO. 1 of the aptamer and a 3' end nucleotide sequence SEQ ID NO. 2 of the aptamer.

2. The DNAse triple helix molecular switch of claim 1, wherein, The nucleotide sequence of the DNA enzyme is shown as SEQ ID NO.

3.

3. The DNAse triple helix molecular switch of claim 1, wherein, The aptamer comprises an aptamer targeting a target, and the target comprises ochratoxin A.

4. The method for preparing the DNA enzyme triplex molecular switch according to any one of claims 1 to 3, characterized in that, The method comprises the following steps: The aptamer containing two nucleotide arm segments is activated to obtain an activated aptamer; the activated aptamer is added to DNAzyme covalently coupled with magnetic beads, and a mixed solution is further added for incubation; the concentration of the aptamer is 50-250 nM; the mixed solution is 20 mM PBS containing 0-10 mM Mg 2+ , pH 7.

2.

5. Use of the DNAzyme triplex molecular switch according to any one of claims 1 to 3 or the preparation method according to claim 4 for the manufacture of a product for detecting a target, characterized in that, The target is a target targeted by the aptamer.

6. A kit characterized in that, The kit comprises the DNA enzyme triple helix molecular switch according to any one of claims 1-3, a Single DNA labeled with a magnetic bead and a gold nanoparticle at two ends, respectively; the Single DNA contains a specific recognition site of the DNA enzyme.

7. A method of detecting a target, comprising: The target is a target targeted by the aptamer, and the kit is used for detection according to claim 6, comprising the following steps: The DNA enzyme triple helix molecular switch is removed by magnetic separation, 300 μL of a to-be-detected solution is added, and after incubation at room temperature, the supernatant is removed by magnetic separation, 300 μL of PBS buffer is added after washing, and a reaction solution A is obtained; The supernatant of SingleDNA magnetic separation marked with magnetic beads and gold nanoparticles at both ends was removed, mixed with reaction solution A, and Pb 2+ After 10-50 min of post-reaction, the supernatant was removed by magnetic separation; Glucose solution is added to the supernatant, and after reaction at room temperature for 10-30 min, a blood glucose meter is used for detection.

8. The method of claim 7, wherein, The incubation time at room temperature is 30-60 min.

9. The method of claim 7, wherein the target is detected by a method comprising: Pb 2+ at a concentration of 2-10 mM.

10. The method of claim 7, wherein the target is detected by a method comprising: The concentration of the glucose solution is 30 mM, and the volume ratio of the supernatant to the glucose solution is 1:

2. The concentration of the glucose solution is 30 mM, and the volume ratio of the supernatant to the glucose solution is 1:2.

Images