Application of IFNAR1 gene in improving resistance of swine AFB1, DON and T2 toxins

Abstract

The invention discloses an application of an IFNAR1 gene in improving AFB1, DON and T2 toxin resistance of pigs, and belongs to the technical field of biology. It is found for the first time that IFNAR1 gene knockout can improve the endurance capacity of cells to intestinal cytotoxicity caused by AFB1, DON and T2 toxins, the intestinal epithelial cell activity is increased, and death is reduced. By further developing IFNAR1 related drug targets, a theoretical basis is provided for treating AFB1, DON and T2 mycotoxins.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and specifically relates to IFNAR1 gene editing against AFB1, DON and T2 toxin induced intestinal cell toxicity and potential applications thereof. BACKGROUND

[0002] Intestinal cell toxicity: aflatoxin (AFB1) and deoxynivalenol (DON) are common mycotoxin contaminants in grains and grain products (wheat, corn, barley, etc.). The intestine is not only the main place for animals to digest food and absorb nutrients, but also the first barrier against various toxins, including mechanical, chemical, biological and immune barriers. When animals ingest feed contaminated with AFB1 and DON, mycotoxins can change the height of small intestinal villi and the depth of crypts, destroy the intestinal structure, change the integrity of intestinal epithelial cells to alter the intestinal barrier function, change the permeability of intestinal epithelium by regulating tight junctions, cause up-regulation of pro-inflammatory factor expression, induce increased expression of apoptosis genes and increased apoptosis cells, etc.

[0003] T2 toxin is an organic compound with the chemical formula C24H34O9. This toxin is produced by Fusarium decemseptatum and Magnaporthe grisea, and can damage the digestive tract mucosa and vascular endothelial cells, leading to gastrointestinal ulcers and a tendency to systemic hemorrhage. The toxin causes vomiting by stimulating the skin and mucosa, and long-term ingestion leads to growth arrest.

[0004] IFNAR1 gene: The protein encoded by IFNAR1 (Interferon Alpha And Beta Receptor Subunit 1) is a type I membrane protein and a component of the interferon receptor complex. The interferon receptor complex is composed of two chains, IFNAR1 and IFNAR2, which are responsible for binding type I interferons and initiating downstream signaling. This gene belongs to the cytokine receptor family and is located on human chromosome 9p21.3, mouse chromosome 16, and pig chromosome 13, and is distributed on the surface of various cells including intestinal epithelial cells and immune cells. IFNAR1 binds to type I interferons (such as IFN-α and IFN-β), initiates downstream JAK-STAT signaling, regulates the expression of numerous antiviral genes and immune regulatory genes, and plays a core role in resisting viral infection and maintaining immune homeostasis. Current research has focused on the role of IFNAR1 in viral infection and autoimmune diseases.

[0005] CRISPR / Cas9 gene editing technology: Clustered Regularly Interspaced Short Palinmic Repeats (CRISPR / Cas9) gene editing system is widely used in the knockout of genes related to cells, mice, pigs and other animals, and provides technical support for the research of anti-toxin genes.

[0006] In summary, the IFNAR1 gene related to the intestinal cell toxicity caused by AFB1 and DON toxins has not been found, and the gene research field related to the intestinal cell toxicity caused by AFB1 and DON toxins has not been found. SUMMARY

[0007] The technical problem to be solved by the present application is to provide an editable target gene IFNAR1 that can affect the intestinal cell toxicity caused by AFB1, DON or T2 toxin in mammals, and can be applied to the potential drug target point treatment and application of related diseases.

[0008] The technical solution of the present application is the use of a reagent for knocking out the IFNAR1 gene in the preparation of a drug for resisting the intestinal cell toxicity caused by AFB1, DON or T2 toxin in mammals.

[0009] Further, the intestinal cell toxicity caused by AFB1, DON or T2 toxin refers to one or more of increased intestinal epithelial cell viability, reduced death, promoted intestinal cell survival or increased anti-toxicity.

[0010] Further, the mammal is a mouse, a pig or a human.

[0011] Further, the reagent for knocking out the IFNAR1 gene is a CRISPR / Cas9 gene knockout vector targeting the IFNAR1 gene.

[0012] Further, the sgRNA nucleotide sequence of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID No. 1.

[0013] A method for constructing an AFB1, DON or T2 toxin intestinal cell model, by knocking out the IFNAR1 gene of the intestinal cell, thereby obtaining an AFB1, DON or T2 toxin cell model.

[0014] Further, the method for knocking out the IFNAR1 gene of the intestinal cell is to use a CRISPR / Cas9 gene knockout vector to knock out the IFNAR1 gene.

[0015] Further, the sgRNA sequence of the CRISPR / Cas9 gene knockout vector is shown as SEQ ID No. 1.

[0016] Further, the intestinal cell is a pig intestinal epithelial cell.

[0017] Firstly, the IFNAR1 gene is knocked out in the pig intestinal epithelial cell by using the CRISPR / Cas9 gene knockout technology, the V2 empty load and IFNAR1 knockout IPEC-J2 cells are treated by AFB1, DON and T2, and after 48h, the optical microscope observation and cell counting kit (CCK-8) activity detection are carried out, so as to prove that the activity of the intestinal epithelial cell is increased, the death is reduced, the intestinal cell survival is promoted, and the anti-toxicity is increased after the IFNAR1 is knocked out.

[0018] Compared with the prior art, the present application has the following beneficial effects:

[0019] 1. The present application firstly finds and proves that the IFNAR1 gene editing can be used as a key gene for resisting the intestinal cell toxicity caused by AFB1, DON and T2 toxins of mammals, after the IFNAR1 gene is knocked out, the activity of the intestinal epithelial cell is increased, the death is reduced, the intestinal cell survival is promoted, and the anti-toxicity is increased.

[0020] 2. By further developing the IFNAR1 related drug target, a theoretical basis for treating AFB1, DON and T2 mycotoxins can be provided. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Microscope pictures of V2 empty load and IFNAR1 knockout pig intestinal epithelial cells (IPEC-J2) after 48h treatment of AFB1 and DON; wherein, A is a normal V2 empty load IPEC-J2 cell; B is an IFNAR1 knockout IPEC-J2 cell; C is a V2 empty load IPEC-J2 cell treated by AFB1 (40uM) for 48h; D is an IFNAR1 knockout IPEC-J2 cell treated by AFB1 (40uM) for 48h; E is a V2 empty load IPEC-J2 cell treated by DON (20uM) for 48h; F is an IFNAR1 knockout IPEC-J2 cell treated by DON (20uM) for 48h; AFB1 is aflatoxin B1; DON is vomitoxin;

[0022] Figure 2Figure of CCK-8 activity detection results of V2 empty and IFNAR1 gene knockout pig intestinal epithelial cells (IPEC-J2) after AFB1 and DON treatment for 48 h; A is the CCK8 activity detection results of different concentrations of AFB1 treatment, B is the CCK8 activity detection results of different concentrations of DON treatment; * p < 0.05, ** p < 0.01, *** p < 0.001;

[0023] Figure 3 Figure of CCK-8 activity detection results of V2 empty and IFNAR1 gene knockout pig intestinal epithelial cells (IPEC-J2) after T2 treatment for 48 h. DETAILED DESCRIPTION

[0024] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0025] Example 1: Construction of IFNAR1 gene knockout model of pig intestinal epithelial cells

[0026] 1. The sgRNA targeting the pig IFNAR1 gene (CDS sequence as shown in SEQ ID No. 4) was designed using the website CHOPCHOP (https: / / chopchop.cbu.uib.no / ), and the DNA sequence corresponding to the sgRNA was connected to the LentiCRISPR-V2 vector. Then, the LentiCRISPR-V2 vector and the IFNAR1 connected LentiCRISPR-V2 vector were packaged into lentivirus using 293FT cells. The sgRNA nucleotide sequence is shown in SEQ ID No. 1

[0027] F: 5'-GCTTCACTGCGTGTCGGTAT-3' (SEQ ID No. 1)

[0028] 2. Then, the IPEC-J2 cell line was infected with LentiCRISPR-V2 empty vector (V2 empty, V2-CON) and IFNAR1 knockout (IFNAR1-KO) lentivirus and screened for puromycin resistance. After screening was completed, cell samples were collected for subsequent knockout identification. DNA was extracted using a cell DNA extraction kit, and DNA of normal V2 empty and IFNAR1 knockout IPEC-J2 cells was extracted, PCR amplification was performed using knockout identification primers, and then sequencing comparison analysis was performed. The knockout identification primer nucleotide sequence is shown in SEQ ID No. 2 and SEQ ID No. 3

[0029] F: 5'- TTTGGTCCGAAGAGAAGAGATT -3' (SEQ ID No. 2)

[0030] R: 5'- TAGTGGGTAAAGCTGGTTCACA -3' (SEQ ID No. 3)

[0031] Example 2 AFB1 and DON treatment of normal V2 empty and IFNAR1 knock-out intestinal epithelial cells

[0032] 1. By optical microscope observation, it was shown that after AFB1 and DON treatment for 48h, the cell death of IFNAR1-KO cells was reduced compared with normal V2 empty IPEC-J2 cells.

[0033] 2. Next, cell counting kit-8 (CCK-8) viability detection was performed. Cells were seeded in 96-well plates and incubated at 37℃ 5% CO2 for 24h, until the cell confluence reached more than 60%. Different concentrations of AFB1 and DON were added to V2 empty (V2-CON) and IFNAR1 knock-out (IFNAR1-KO) IPEC-J2 cells and incubated for 48h. The concentration of AFB1 was 20μM, 40μM and 60μM; the concentration of DON was 5μM, 10μM, 20μM and 40μM. CCK8 stock solution was diluted 1:10 to prepare working solution, 100μL CCK-8 working solution was added to each well, and the plate was incubated at 37℃ for 1h. The absorbance at 450nm was measured using a microplate reader.

[0034] The optical microscope pictures of V2 empty control group (V2-CON) and IFNAR1 knock-out gene (IFNAR1-KO) of IPEC-J2 are shown in Figure 1 , and the CCK8 viability detection results are shown in Figure 2 . From the optical microscope and CCK8 detection results, it can be seen that after AFB1 and DON treatment of IFNAR1 knock-out intestinal epithelial cells, the cell viability was significantly increased (P<0.01), the cell death was significantly reduced, and the anti-toxicity was increased.

[0035] Example 3 T2 toxin treatment of normal V2 empty and IFNAR1 knock-out intestinal epithelial cells

[0036] Cells were seeded in 96-well plates and incubated at 37°C 5% CO2 for 24h, until the cell confluence reached more than 60%. Different concentrations of T2 were added to IPEC cells of V2-CON and IFNAR1-KO and incubated for 48h. The concentration of T2 was 0.25 mM and 0.5 mM. CCK8 stock solution was diluted 1:10 to prepare working solution, 100 mL CCK-8 working solution was added to each well, and the plate was incubated at 37°C for 1h. The absorbance at 450 nm was measured using a microplate reader.

[0037] The results are shown in Figure 3 IFNAR1 knockout can improve the tolerance of cells to T2, and the cell death is significantly reduced, and the anti-toxicity is increased.

Claims

1. Application of reagents for knocking out the IFNAR1 gene in the preparation of drugs for mammalian intestinal cell toxicity caused by AFB1, DON or T2 toxins.

2. The application according to claim 1, characterized in that, The intestinal cytotoxicity caused by anti-AFB1, DON, or T2 toxins refers to one or more of the following: increased intestinal epithelial cell viability, reduced cell death, promotion of intestinal cell survival, or increased resistance to toxicity.

3. The application according to claim 1, characterized in that, The mammal is a mouse, a pig, or a human.

4. The application according to any one of claims 1 to 3, characterized in that, The reagent used to knock out the IFNAR1 gene is a CRISPR / Cas9 gene knockout vector that targets the IFNAR1 gene.

5. The application according to claim 4, characterized in that, The sgRNA nucleotide sequence of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID No.

1.

6. A method for constructing an intestinal cell model resistant to AFB1, DON, or T2 toxins, characterized in that, By knocking out the IFNAR1 gene in intestinal cells, cell models resistant to AFB1, DON, or T2 toxins can be obtained.

7. The method according to claim 6, characterized in that, The method for knocking out the IFNAR1 gene in intestinal cells is to knock out the IFNAR1 gene using a CRISPR / Cas9 gene knockout vector.

8. The method according to claim 7, characterized in that, The sgRNA sequence of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID No.

1.

9. The method according to any one of claims 6-9, characterized in that, The intestinal cells are porcine intestinal epithelial cells.

Images