Genetic engineering recombinant bacillus subtilis as well as construction method and application thereof in resisting vibrio infection

By constructing a genetically engineered recombinant Bacillus subtilis expressing IL-8 from Scorpionfish, the problem of the lack of specific immune enhancers in Scorpionfish farming has been solved, achieving effective prevention and control of Vibrio harveyi and Vibrio parahaemolyticus, and promoting the green, healthy and sustainable development of Scorpionfish farming.

CN121379907APending Publication Date: 2026-01-23SHANDONG UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511541318.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-27
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

In existing technologies, the lack of specific immune enhancers in the farming of Scorpionfish leads to severe Vibrio infections, and the long-term use of antibiotics results in drug resistance and drug residues, making it difficult to achieve sustainable development of green aquaculture.

Method used

Recombinant Bacillus subtilis was constructed using genetic engineering. Cot B, a protein in the spore capsid, was used as an anchoring protein to express Scorpion IL-8 on the spore surface, thereby enhancing its immune function. The Cot B-IL-8 fusion gene was constructed using overlap extension PCR technology and expressed in Bacillus subtilis WB800N. Sodium alginate was added as an embedding agent to ensure spore stability.

Benefits of technology

It significantly enhances the immune function and resistance to Vibrio infection in Scorpionichthys schlegelii, improves growth performance and intestinal digestive enzyme activity, improves intestinal tissue structure, enhances antioxidant capacity and non-specific immune levels, and effectively prevents and treats Vibrio harveyi and Vibrio parahaemolyticus infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121379907A_ABST
    Figure CN121379907A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering and aquaculture, in particular to genetic engineering recombinant bacillus subtilis as well as a construction method and application thereof in vibrio infection resistance. Specifically, according to the recombinant bacillus subtilis, bacillus subtilis WB800N is taken as host bacteria, pDG364 is taken as a carrier, spore capsid protein Cot B is taken as anchoring protein, and the recombinant bacillus subtilis Bs-pDG364-Cot B-IL-8 capable of anchoring and expressing sebastes schlegeli interleukin-8 on the spore surface is constructed. The recombinant bacillus subtilis BB8 constructed by the invention not only can obviously improve the growth performance of sebastes schlegeli and improve the health state of intestinal tracts, but also can enhance the oxidation resistance, the non-specific immune level and the vibrio infection resistance of the sebastes schlegeli, provides a new effective strain for development and application of sebastes schlegeli immunopotentiator, and has a wide application prospect. The method has a wide application prospect in sebastes schlegeli breeding industry.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of genetic engineering and aquaculture, and particularly relates to a genetically engineered recombinant Bacillus subtilis, a construction method thereof and application thereof in resisting Vibrio infection. BACKGROUND

[0002] The information disclosed in the background of the present application is only intended to increase the understanding of the overall background of the present application and should not necessarily be regarded as acknowledging or implicitly suggesting that this information constitutes prior art known to those of ordinary skill in the art.

[0003] Sebastes schlegelii Sebastes schlegelii , also known as black head or black stone grouper, is an important marine aquaculture fish in northern China, mainly distributed in the Bohai Sea, the Yellow Sea and the East China Sea and other regions. It has the characteristics of strong environmental adaptability, strong reproductive capacity, delicious and nutritious meat, etc., and is favored in the domestic and foreign markets, and has become one of the important marine cage culture fish in the coastal areas of northern China.

[0004] With the continuous expansion of the intensive culture scale of Sebastes schlegelii, the disease problem has become increasingly prominent, which has become an important factor restricting the sustainable development of its aquaculture industry. Among them, bacterial diseases are the common disease types in the culture of Sebastes schlegelii, and the diseases caused by Vibrio bacteria (such as Vibrio harveyi and Vibrio parahaemolyticus) are the most serious. These diseases not only lead to a large number of deaths of Sebastes schlegelii and cause huge economic losses, but also seriously affect the healthy development of the Sebastes schlegelii culture industry. Vibrio

[0005] At present, in aquaculture, the main way to deal with fish diseases includes the use of antibiotics and other drugs, but long-term use of antibiotics is easy to lead to drug resistance of pathogenic bacteria, cause drug residues, pose potential threats to the environment and human health, and does not conform to the development concept of green aquaculture. As a functional feed additive, immune enhancer can regulate the immune system of fish and enhance the ability of the body to resist pathogenic infection, and has the advantages of no pollution and no drug residues, and has become an important means of disease prevention and control in aquaculture industry. However, at present, specific immune enhancers for Sebastes schlegelii are still relatively lacking and need to be developed. SUMMARY

[0006] In view of the deficiencies in the prior art, the purpose of the present application is to provide a genetically engineered recombinant Bacillus subtilis, which can anchor and express IL-8 of Sebastes schlegelii on the surface of spores, and can significantly enhance the immune function and anti-Vibrio infection ability of Sebastes schlegelii. Based on the above research results, the present application is completed.

[0007] In order to achieve the above technical purpose, the technical scheme provided by the present application is as follows: ​In a first aspect, the present application provides a genetically engineered recombinant Bacillus subtilis, which is anchored with spore coat protein Cot B as an anchor protein and can anchor interleukin-8 (IL-8) on the surface of the Bacillus subtilis.

[0008] The interleukin-8 (IL-8) is derived from fish, further from Sebastiscus alternatus, and the nucleotide sequence of the gene is shown in SEQ ID NO. 2. IL-8 The GenBank accession number of the gene is KP069025.1, wherein the coding region fragment size is 300 bp (SEQ ID NO. 1). When constructing the recombinant vector, the codon is optimized and linked to the IL-8 The 12 bp linker sequence (5'-GGCGGCGGAGGG-3') is added upstream of the gene, which can increase the spatial flexibility of the anchor protein and the IL-8 protein and avoid structural interference between the two; the 6×His tag sequence (5'-CACCACCACCACCACCAC-3') of 18 bp is added downstream, which facilitates the subsequent detection of the fusion protein by Western Blot and other technologies, IL-8 The full-length sequence of the gene is 330 bp (SEQ ID NO. 2).

[0009] Further, the spore coat protein coding gene Cot B is derived from Bacillus subtilis WB800N.

[0010] Further, the starting strain of the genetically engineered recombinant Bacillus subtilis can be Bacillus subtilis WB800N strain.

[0011] In a second aspect, the present application provides a construction method of the genetically engineered recombinant Bacillus subtilis described above, which comprises the following steps: constructing a recombinant expression vector containing Cot B-IL-8 the fusion gene, transforming the recombinant expression vector into Bacillus subtilis to obtain the genetically engineered recombinant Bacillus subtilis.

[0012] Among them, the Cot B-IL-8 fusion gene is obtained by overlap extension PCR technology, wherein the Cot B gene is derived from Bacillus subtilis WB800N; the IL-8 gene is derived from fish, further from Sebastiscus alternatus, and the IL-8 nucleotide sequence of the gene is shown in SEQ ID NO. 2.

[0013] The recombinant expression vector is obtained by linking the expression vector and the Cot B-IL-8 fusion gene, and the expression vector can be a plasmid, and in a specific embodiment of the present application, the plasmid can be pDG364 plasmid.

[0014] The starting strain Bacillus subtilis can be Bacillus subtilis WB800N, which can efficiently secrete exogenous proteins, is a recognized GRAS level microorganism, does not produce toxins, and WB800N has no risk of antibiotic resistance gene residue, so it is very suitable as a genetically engineered strain in the fields of feed, medicine, etc.

[0015] More specifically, the construction method of the genetically engineered recombinant Bacillus subtilis includes: (1) Cot B Gene, Cot G Gene and IL-8 Gene amplification: The purified Bacillus subtilis WB800N strain was inoculated into LB liquid medium and cultured at 37°C, 220 r / min on a shaking bed for 12 h, and the genomic DNA was extracted according to the bacterial genomic DNA extraction kit instructions. Using specific primers, the Cot B Gene and Cot G Gene were amplified using genomic DNA as a template. The primer sequences are as follows: Cot B Gene primer: F-Cot B (5'-TGAGCCGGATGTGATCTGCG-3'), R-Cot B (5'-TTAAAATTTACGTTTCCAGTGATAGTC-3') Cot G Gene primer: F-Cot G (5'-ACGCAAGTCTTTTGGATGAAC-3'), R-Cot G (5'-TTATTTGTATTTCTTTTTGACTACCC-3') PCR reaction system (50 μL): 2×Phanta Max Buffer (2 mM) 25 μL, dNTP Mix (10 mM) 1 μL, upstream primer (0.4 μM) 2 μL, downstream primer (0.4 μM) 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, ddH2O 17 μL, genomic DNA (100 ng / μL) 2 μL. Reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 5 min (for Cot B Gene) or 3 min (for Cot G Gene), a total of 35 cycles; 72°C final extension for 10 min. The amplification products were detected by agarose gel electrophoresis, and the gel was recovered for standby.

[0016] According to Sebastodes wakiyamaeIL-8 The gene, with GenBank accession number KP069025.1, was synthesized with an upstream 12 bp linker sequence and a downstream 18 bp 6×His tag sequence. IL-8 The gene (330 bp in length) was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0017] (2) Construction of fusion genes: Constructed separately by overlap extension PCR Cot B-IL-8 and Cot G-IL-8 Fusion gene, primers are as follows: Cot B-IL-8 Fusion gene primers: F-Cot B (5'-TGAGCCGGATGTGATCTGCG-3'), R-8 (5'-TTAGTGGTGGTGGTGGTGGTGACGAC-3') Cot G-IL-8 Fusion gene primers: F-Cot G (5'-ACGCAAGTCTTTTGGATGAAC-3'), R-8 (5'-TTAGTGGTGGTGGTGGTGGTGACGAC-3') PCR reaction system (50 μL): 25 μL 2×PhantaMax Buffer (2 mM), 1 μL dNTP Mix (10 mM), 2 μL upstream primer (0.4 μM), 2 μL downstream primer (0.4 μM), 1 μL PhantaMax Super-Fidelity DNA Polymerase, 15 μL ddH2O, anchoring protein gene fragment (… Cot B or Cot G 2 μL IL-8 2 μL of gene fragment. Reaction conditions are the same as in step (1). Cot B-IL-8 The fusion gene is expected to be approximately 1670 bp in size. Cot G-IL-8 The expected size of the fusion gene is approximately 1115 bp. The amplified product was recovered from the gel and kept for later use.

[0018] (3) Construction of recombinant plasmids: Using restriction endonucleases Hin d III and Eco RI was used to double-digest the pDG364 vector. The digestion system was 20 μL. Hin d III (15 U / μL) 1 μL EcoRI (15 U / μL) 1 μL, pDG364 plasmid DNA (85 ng / μL) 9 μL, 10×M Buffer 2 μL, ddH2O 7 μL. Incubate at 37℃ for 4 h, then add 10×Loading Buffer to terminate the reaction, and recover the linearized pDG364 vector by gel extraction.

[0019] The linearized pDG364 vector was respectively combined with Cot B-IL-8 , Cot G-IL-8 The fusion gene was ligated via seamless cloning. The seamless cloning reaction system (20 μL) consisted of: 10 μL of 2×Seamless cloning Master Mix, 2 μL of linearized pDG364 vector (40 ng / μL), and the fusion gene fragment (…). Cot B-IL-8 95 ng / μL or Cot G-IL-8 8 μL or 7 μL of 105 ng / μL, and 0 μL or 1 μL of sterile ddH2O. Incubate in a water bath at 50℃ for 20 min, then cool in an ice bath for 2 min to obtain recombinant plasmids pDG364-Cot B-IL-8 (pB8) and pDG364-Cot G-IL-8 (pG8), respectively.

[0020] The recombinant plasmid was transformed into E. coli DH5α competent cells. After antibiotic selection (ampicillin 100 μg / mL), positive single colonies were picked and expanded. The plasmid was extracted for PCR identification (vector primers F-364: 5'-GCGAAATACGGGCAGACATGG-3', R-364: 5'-GGATTTGAGCGTAGCGAAAAATCC-3') and sequencing verification. Plasmids with correct sequencing were stored at -80℃.

[0021] (4) Construction of recombinant Bacillus subtilis: Preparation of Bacillus subtilis WB800N competent cells: The WB800N strain was revived and purified on LB agar plates. Single colonies were picked and inoculated into GM I medium and incubated overnight at 30°C with shaking at 150 r / min. The inoculum was then transferred to fresh GM I medium at a 10% inoculum and incubated at 37°C with shaking at 220 r / min for 3.5 h. The inoculum was then transferred to GM II medium at a 10% inoculum and incubated at 37°C with shaking at 220 r / min for 1.5 h. The cells were centrifuged at 4000 r / min for 3 min, 900 μL of supernatant was discarded, and the remaining cells were resuspended to obtain competent cells.

[0022] Take 10 μL of each sample and administer with restriction endonuclease. KpnI After the pB8 and pG8 plasmids (1 μg) are cut, 100 μL of competent cells are added, and incubated at 37 DEG C for 1 h; 500 μL of GM II medium is added, and cultured at 37 DEG C with 200 r / min shaking for 3 h; after centrifugation, the bacterial cells are resuspended, and spread on LB solid plates containing 5 μg / mL chloramphenicol, and cultured at 37 DEG C for 16 h.

[0023] The suspected positive single colony is picked, and after expansion culture, genomic DNA is extracted, and PCR identification is performed using primers F-amy E (5'-CCAATGAGGTTAAGAGTATTCC-3') / R-amy E (5'-CGAGAAGCTATCACCGCCCAGC-3') and specific primers (F-3-B-8 / R-3-B-8 or F-3-G-8 / R-3-G-8); and amylase activity detection is simultaneously performed. The correct strains are named BB8 and BG8, respectively, and stored at -80 DEG C.

[0024] The application of the genetically engineered recombinant Bacillus subtilis Bs-pDG364-Cot B-IL-8 (BB8) in the preparation of an immune enhancer for Sebastodes fuscescens is disclosed above. It is verified through experiments that the effect of BB8 on surface anchoring expression of IL-8 is better than that of BG8, and BB8 can significantly improve the growth performance, intestinal digestive enzyme activity, intestinal tissue structure, antioxidant capacity, non-specific immune level, and resistance to Vibrio harveyi and Vibrio parahaemolyticus infection of Sebastodes fuscescens.

[0025] In a third aspect of the present application, a fish immune enhancer is provided, which comprises the genetically engineered recombinant Bacillus subtilis Bs-pDG364-Cot B-IL-8 (BB8) disclosed above, and the final spore concentration of BB8 in the immune enhancer is 1x10 8 CFU / mL. Furthermore, sodium alginate is added as an embedding agent to ensure the stability of the spores during storage and transportation, and effective release in the intestinal tract of Sebastodes fuscescens.

[0026] The fish can be Sebastodes fuscescens.

[0027] In a fourth aspect of the present application, the genetically engineered recombinant Bacillus subtilis or the fish immune enhancer disclosed above is applied in any one or more of the following: (a) enhancing the immunity of fish; (b) preventing and treating Vibrio infection.

[0028] The Vibrio includes but is not limited to Vibrio harveyi and Vibrio parahaemolyticus.

[0029] The above one or more technical solutions have the following beneficial technical effects: The technical scheme is to use Bacillus subtilis heterologous protein presentation system to construct recombinant Bacillus subtilis capable of expressing IL-8 of Sebastodes fuscescens as an immunomodulatory factor, and evaluate the immune enhancement effect on Sebastodes fuscescens, so as to provide a new effective strain for development of a specific immune enhancer of Sebastodes fuscescens, solve the disease problem in the cultivation of Sebastodes fuscescens, and promote the green, healthy and sustainable development of the Sebastodes fuscescens cultivation industry. BRIEF DESCRIPTION OF DRAWINGS

[0030] The drawings accompanying the specification of this application form a part thereof, serve to provide further understanding of the application, and together with the description of the exemplary embodiments of the application, explain the application, and do not constitute an improper limitation on the application.

[0031] Figure 1 PCR identification results of the recombinant plasmids pB8 and pG8 in the embodiments of the application; A: M is DL2000 Plus DNA Ladder; 1 is the identification result of pG8; 2 is the identification result of pB8; 3 is the negative control.

[0032] Figure 2 PCR identification results of the recombinant Bacillus subtilis BB8 and BG8 in the embodiments of the application; A: M is DL2000 Plus DNA Ladder; 1 is the negative control; 2 is the identification result of BB8 (F-amy E / R-amy E); B: M is DL2000 Plus DNA Ladder; 1 is the negative control; 2 is the identification result of BB8 (F-3-B-8 / R-3-B-8); C: M is DL2000 Plus DNA Ladder; 1 is the negative control; 2 is the identification result of BG8 (F-amy E / R-amy E); D: M is DL2000 Plus DNA Ladder; 1 is the identification result of BG8 (F-3-G-8 / R-3-G-8); 2 is the negative control.

[0033] Figure 3 Amylase activity detection results in the embodiments of the application; wherein, A: before adding iodine solution; 1-2 are B. subtilis B: after adding iodine solution; 1-2 are B. subtilis

[0034] Figure 4 Spore staining microscopy and spore counting results (magnification: 1000x) in the embodiments of the application; wherein, A: B. subtilis ​WB800N; B: Recombinant Bacillus subtilis BG8; C: Recombinant Bacillus subtilis BB8; D: Spore count analysis, different letters above the bars indicate significant differences between treatment groups ( p <0.05).

[0035] Figure 5 This is a Western blot detection of IL-8 protein in an embodiment of the present invention; wherein, A:M is a protein marker; 1 is recombinant Bacillus subtilis BB8; 2 is... B. subtilis WB800N; B: M is protein marker; 1 is recombinant Bacillus subtilis BG8; 2 is... B. subtilis WB800N.

[0036] Figure 6 The following are examples of indirect immunofluorescence verification of recombinant Bacillus subtilis BB8 and BG8 spores in this invention: A: Bacillus subtilis WB800N spores observed under a bright field of view; B: Recombinant Bacillus subtilis BG8 spores observed under a bright field of view; C: Recombinant Bacillus subtilis BB8 spores observed under a bright field of view; D: Bacillus subtilis WB800N spores observed under a fluorescence microscope; E: Recombinant Bacillus subtilis BG8 spores observed under a fluorescence microscope; F: Recombinant Bacillus subtilis BB8 spores observed under a fluorescence microscope.

[0037] Figure 7 The images show the detection results of intestinal digestive enzyme activities in *Scorpionichthys schlegelii* in this embodiment of the invention; from left to right, they represent the detection results of the foregut, midgut, and hindgut, respectively; from top to bottom, they represent the detection results of lipase, α-amylase, and trypsin activities, respectively.

[0038] Figure 8 The images show the intestinal tissue sections and morphological parameter analysis results of *Scorpionichthys schlegelii* in this embodiment of the invention; from left to right, they represent the intestinal tissue sections and morphological parameter analysis results of each group; from top to bottom, they represent the detection results of the foregut, midgut, and hindgut. IVH: intestinal villus height; IVW: intestinal villus width; MT: muscle layer thickness. Different letters above the bars indicate significant differences between treatment groups. p <0.05).

[0039] Figure 9 The results of serum antioxidant and non-specific immune-related index detection of Scorpionfish in this embodiment of the invention are as follows: A: Total antioxidant capacity; B: Total superoxide dismutase; C: Catalase; D: Immunoglobulin M; E: Complement protein 3; F: Complement protein 4; G: Acid phosphatase; H: Alkaline phosphatase; I: Lysozyme.

[0040] Figure 10Total RNA detection results of each tissue of Sebastes hubbsi in the embodiment of the present application; M: DL2000 Marker; 1: gill RNA; 2: spleen RNA; 3: kidney RNA; 4: liver RNA; 5: foregut RNA; 6: midgut RNA; 7: hindgut RNA.

[0041] Figure 11 Total RNA detection results of each tissue of Sebastes hubbsi in the embodiment of the present application; M: DL2000 Marker; 1: gill RNA; 2: spleen RNA; 3: kidney RNA; 4: liver RNA; 5: foregut RNA; 6: midgut RNA; 7: hindgut RNA. CXCR1 and CXCR2 Relative expression amount analysis of genes; from left to right, the detection results of foregut, midgut and hindgut are respectively shown, and from top to bottom, the relative expression amounts of CXCR1 and CXCR2 genes are respectively shown.

[0042] Figure 12 Relative expression amount analysis of immune-related genes in different tissues of Sebastes hubbsi in the embodiment of the present application; from left to right, the detection results of liver, spleen, kidney, gill, foregut, midgut and hindgut are respectively shown; from top to bottom, the relative expression amounts of NF- κB , AP-1 , HIF-1 and STAT3 genes are respectively shown.

[0043] Figure 13 Analysis of the effect of recombinant Bacillus subtilis on the resistance of Sebastes hubbsi to Vibrio infection in the embodiment of the present application; A: V. harveyi Relative protection rate after WHSS0915 attack; B: V. parahaemolyticus Relative protection rate after ATCC33847 attack; C: V. harveyi Relative protection rate after mixed attack of WHSS0915 and V. parahaemolyticus ATCC33847. DETAILED DESCRIPTION

[0044] It should be noted that the following detailed description is illustrative only and is intended to provide further description of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0045] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof.

[0046] The application will be further described with specific examples, the following examples are only for explaining the application, and do not limit the content thereof. If the specific conditions of the experiments are not specified in the examples, the general conditions are usually used, or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples can be obtained from commercial channels if not specified.

[0047] The application will be further described with specific examples, the following examples are only for explaining the application, and do not limit the content thereof. If the specific conditions of the experiments are not specified in the examples, the general conditions are usually used, or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples can be obtained from commercial channels if not specified.

[0048] Example 1 Construction of recombinant Bacillus subtilis BB8 and BG8 1.1 Test materials Strains: Bacillus subtilis WB800N (Professor Du Aifang of Zhejiang University), Escherichia coli DH5α (Shanghai SunGene Biotech Co., Ltd.).

[0049] Plasmid: pDG364 vector (Professor Du Aifang of Zhejiang University), which is an Escherichia coli-Bacillus subtilis shuttle vector, integrated into Bacillus subtilis amy E locus, containing a chloramphenicol resistance gene Cmr ).

[0050] Reagents: Bacterial genomic DNA extraction kit (Hunan Aikrui Biology), Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme Biological Technology), restriction endonuclease (Beijing Baorisheng Medical Biology), seamless cloning kit (Shanghai SunGene Biological), chloramphenicol (Beijing Solabio Technology), etc. Hin d III、 Eco R I、 Kpn I, Beijing Baorisheng Medical Biology), seamless cloning kit (Shanghai SunGene Biological), chloramphenicol (Beijing Solabio Technology), etc.

[0051] Culture medium: LB liquid / solid culture medium, GM I / II transformation culture medium, 10×Spizien salts prepared according to the conventional formula.

[0052] 1.2 Gene amplification and fusion The genomic DNA of Bacillus subtilis WB800N was extracted, and the Cot B gene and Cot G gene were amplified with it as a template, and the PCR products were detected by 1% agarose gel electrophoresis, Cot B The size of the gene fragment was about 1343 bp, and the size of the Cot G gene fragment was about 788 bp, which was consistent with the expectation, and the gel was recovered for standby.

[0053] Synthesis of Quillback with linker and 6xHis tag IL-8 Gene (330 bp) was amplified by overlap extension PCR and fused with Cot B , Cot G Gene respectively to obtain Cot B-IL-8 (about 1670 bp) and Cot G-IL-8 (about 1115 bp) fusion genes, which were recovered after electrophoresis verification.

[0054] 1.3 Recombinant plasmid construction and identification The pDG364 vector was double-digested to obtain a linearized vector fragment. The linearized vector was ligated with two fusion genes respectively to construct recombinant plasmids pB8 and pG8. The recombinant plasmids were transformed into E. coli DH5a, and the plasmids were extracted after resistance screening. PCR identification showed that pB8 amplified about 1900 bp fragments and pG8 amplified about 1300 bp fragments, and the sequencing results were consistent with the expected, indicating that the recombinant plasmid was successfully constructed.

[0055] 1.4 Recombinant B. subtilis construction and screening The B. subtilis WB800N competent cells were prepared, and the digested pB8 and pG8 plasmids were transformed into the competent cells respectively. After chloramphenicol resistance screening, positive single colonies were picked for PCR identification and amylase activity detection.

[0056] PCR identification results: The BB8 genome amplified about 3300 bp fragments with F-amy E / R-amy E primers and about 1700 bp fragments with F-3-B-8 / R-3-B-8 primers; the BG8 genome amplified about 2700 bp fragments with F-amy E / R-amy E primers and about 1100 bp fragments with F-3-G-8 / R-3-G-8 primers, which were consistent with the expected.

[0057] Amylase activity detection results: There was no transparent hydrolysis circle around the BB8 and BG8 colonies, while there was obvious transparent circle around the WB800N colony, indicating that the fusion genes were successfully integrated into the B. subtilis genome, and the recombinant strain was successfully constructed.

[0058] Example 2 Comparison and verification of expression effects of recombinant B. subtilis BB8 and BG8 2.1 Spore preparation and counting Single colonies of BB8 and BG8 were picked and inoculated into LB broth containing chloramphenicol, and cultured at 37°C with shaking for 12 h. Then, 1% inoculum was transferred to 150 mL of DSM medium and cultured at 37°C with shaking (BB8 for 72 h, BG8 for 216 h). After incubation, spores were collected by centrifugation, washed three times with sterile water, sonicated, centrifuged again, stained with a spore staining kit, and analyzed by serial dilution plating for counting.

[0059] The results showed that after 72 h of culture, spores accounted for over 95% of the BB8 field of view, with a spore count of 1.7 × 10⁻⁶. 9 CFU / mL; BG8 spore count was 5.9 × 10⁻⁶. 8 CFU / mL, significantly lower than BB8 ( p <0.05); the number of spores in WB800N was 8.7 × 10⁻⁵. 8 CFU / mL. This indicates that BB8 has a better sporulation capacity than BG8.

[0060] 2.2 Western Blot Detection Spore capsid proteins of BB8 and BG8 were extracted and analyzed by SDS-PAGE electrophoresis and Western blotting (primary antibody: mouse 6×His-tagged antibody; secondary antibody: HRP-labeled goat anti-mouse IgG antibody). Results showed that BB8 exhibited a specific band at approximately 63 kDa (Cot B-IL-8 fusion protein), while BG8 showed a specific band at approximately 43 kDa (Cot G-IL-8 fusion protein); the analysis indicated that BB8 showed higher IL-8 protein expression.

[0061] 2.3 Indirect immunofluorescence assay (IFA) BB8, BG8, and WB800N spores were collected, washed with PBS, spread onto glass slides, fixed, blocked, and then treated with primary antibody and FITC-labeled secondary antibody. The results showed that WB800N spores showed no green fluorescence; BG8 spores exhibited weak green fluorescence; and the green fluorescence signal on the surface of BB8 spores was significantly stronger than that of BG8, further confirming that BB8 spores were more effective at anchoring IL-8 expression.

[0062] In summary, based on the combined results of spore count, Western blotting, and IFA, BB8 showed better surface anchoring of IL-8 in *Scorpionichthys schlegelii* than BG8. BB8 will be selected for further evaluation of its immune-enhancing effect on *Scorpionichthys schlegelii*.

[0063] Example 3 Evaluation of the immune-enhancing effect of recombinant Bacillus subtilis BB8 on Sebastiscus inermis 3.1 Test materials Test animals: 300 healthy Sebastiscus inermis juvenile fish (body length 6.5±0.5 cm, body weight 9±2 g) were purchased from Shandong Weihai Rongcheng Shengang Aquatic Technology Co., Ltd.

[0064] Strains: Vibrio harveyi WHSS0915 (laboratory isolated), Vibrio parahaemolyticus ATCC33847 (laboratory preserved), BB8 (constructed in Example 1).

[0065] Reagents: Pangasius hypophthalmus puffed compound feed (Changshu Quanxing), sodium alginate (Shanghai Shenguo Biological), enzyme activity kit (Nanjing Jiancheng Biological), qRT-PCR kit (Beijing Quanshi Gold Biological), etc.

[0066] 3.2 Test design and feeding management After 14 days of temporary rearing, the Sebastiscus inermis were randomly divided into 3 groups (n=100 tails / group): PBS group: fed with basic feed added with PBS; WB800N group: fed with feed added with WB800N spores; BB8 group: fed with feed added with BB8 spores.

[0067] Prepare WB800N and BB8 spores, adjust the final concentration to 1×10 8 CFU / mL, add 1% (w / v) sodium alginate as an embedding agent to each group of feed, and dry at 40°C for standby. Feed twice a day (09:00, 18:00) during the test, with a feeding amount of 2% of the total fish body weight, for 28 days. The water temperature was 16°C, the dissolved oxygen was 12-13 mg / L, the pH was 7.9-8.2, and 2 / 3 of the seawater was replaced daily.

[0068] 3.3 Growth performance determination On days 0, 7, 14, 21, and 28 of feeding, 10 tails were randomly selected from each group to measure body weight and body length, and weight gain rate (WGR), specific growth rate (SGR), body length growth rate (LGR), and feed efficiency (FER) were calculated, as shown in Table 1. The results showed that the addition of recombinant Bacillus subtilis BB8 in the feed had a positive effect on the growth performance of Sebastiscus inermis.

[0069] Table 1 Effect of recombinant Bacillus subtilis BB8 on the growth performance of Sebastiscus inermis

[0070] Note: All experimental data are expressed as mean ± standard deviation. Different letters in a row indicate significant differences. p <0.05).

[0071] 3.4 Detection of intestinal digestive enzyme levels in Scorpionfish (Scorpionfish schlegelii) To evaluate the effect of adding recombinant Bacillus subtilis on the activity of intestinal digestive enzymes in Sebastes schlegelii, the activities of lipase, α-amylase, and trypsin in the foregut, midgut, and hindgut were analyzed.

[0072] After 28 days of feeding, the lipase activity in the foregut and midgut of the BB8 group was significantly higher than that of the WB800N group and the PBS group. p <0.05%, the lipase activity in the hindgut of the BB8 group reached the highest level, significantly higher than that of the PBS group ( p <0.05).

[0073] In the BB8 group, α-amylase activity in the foregut and midgut peaked on day 7, while α-amylase activity in the hindgut peaked on day 21. Throughout the 28-day feeding period, α-amylase activity in the foregut, midgut, and hindgut of the BB8 group remained at a high level.

[0074] In the BB8 group, enterotrypsin activity remained at a high level, significantly higher than that in the PBS group at all time points. p <0.05).

[0075] The above results indicate that the addition of recombinant Bacillus subtilis BB8 effectively improved the intestinal digestive function of Sebastes schlegelii.

[0076] 3.5 Morphological and structural analysis of the intestinal tissue of Scorpionfish Xu's To evaluate the effect of adding recombinant Bacillus subtilis on the intestinal tissue structure of Sebastes schlegelii, the tissue structures of the foregut, midgut, and hindgut were analyzed.

[0077] Compared with the PBS group without Bacillus subtilis, the intestinal villus height in the foregut, midgut, and hindgut of the groups with Bacillus subtilis was increased. Specifically, the intestinal villus height in the foregut, midgut, and hindgut of the BB8 and WB800N groups was significantly higher than that of the PBS group. p <0.05).

[0078] There were no significant differences in the width of intestinal villi in the foregut and midgut among the groups. p >0.05), while the intestinal villus width of the hindgut in the BB8 group and WB800N group was significantly higher than that in the PBS group ( p <0.05).

[0079] Regarding muscle layer thickness, the muscle layer thickness of the foregut in the BB8 group was not significantly different from that in the PBS and WB800N groups. p>0.05). The muscular layer thickness of the midgut in the BB8 group was significantly higher than that in the PBS group ( p <0.05. There was no significant difference in the muscular layer thickness of the hindgut among the groups. p >0.05).

[0080] The above results indicate that the addition of recombinant Bacillus subtilis BB8 increases the intestinal villus height and muscle layer thickness of Sebastes schlegelii, further improving its intestinal digestion and absorption of nutrients.

[0081] 3.6 Detection of antioxidant and non-specific immune-related indicators in the serum of Scorpionfish schlegelii To evaluate the effects of adding recombinant Bacillus subtilis on the antioxidant capacity and nonspecific immune levels of Sebastes schlegelii, serum antioxidant-related indicators and nonspecific immune indicators were detected.

[0082] (1) Results of detection of antioxidant-related indicators The T-AOC activity assay results showed that the BB8 group reached its highest T-AOC activity on day 28, and was significantly higher than that of the PBS group at all time points. p <0.05).

[0083] The results of T-SOD activity assay showed that the T-SOD activity in the BB8 group remained at a high level throughout, and was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05).

[0084] CAT activity assay results showed that CAT activity in the BB8 group increased, reaching its highest level on day 28, significantly higher than that in the PBS group and the WB800N group. p <0.05).

[0085] The above results indicate that the addition of recombinant Bacillus subtilis enhances the antioxidant capacity of Sebastes schlegelii.

[0086] (2) Results of non-specific immune-related indicators The IgM content detection results showed that the IgM content in the BB8 group generally increased with the extension of feeding time, reaching a peak on day 28. The IgM content in the BB8 group was significantly higher than that in the PBS group at all time points. p <0.05), on days 7 and 21, the IgM content in the BB8 group was significantly higher than that in the WB800N group ( p <0.05).

[0087] The C3 content test results showed that the C3 content in the BB8 group gradually increased with the extension of feeding time, reaching the highest level on day 28. The C3 content in the BB8 group was significantly higher than that in the PBS group and the WB800N group at all time points. p<0.05).

[0088] C4 content detection results showed that the C4 content in the BB8 group gradually increased with the extension of feeding time, reaching a peak on day 28. On days 7, 21, and 28, the C4 content in the BB8 group was significantly higher than that in the WB800N group and the PBS group. p <0.05).

[0089] The ACP activity assay results showed that the ACP activity in the BB8 group first increased, then decreased, and then increased again, reaching its highest level on day 28. Furthermore, the ACP activity at each time point was significantly higher than that in the PBS group and the WB800N group. p <0.05).

[0090] AKP activity assay results showed that the AKP activity in the BB8 group was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05).

[0091] The LZM activity test results showed that the LZM activity in the BB8 group generally increased with the extension of feeding time, and was significantly higher than that in the PBS group and the WB800N group at all time points. p <0.05). The above results indicate that the addition of recombinant Bacillus subtilis BB8 improves the non-specific immunity level of Scorpionfish.

[0092] 3.7 Total RNA extraction from various tissues of Scorpionfish schlegelii The results of total RNA extraction and detection from different tissues of Sebastes schlegelii showed that the total RNA electrophoretic bands from the liver, spleen, kidney, gills, foregut, midgut, and hindgut were complete and clear, exhibiting three bands: 28S, 18S, and 5.8S. The concentration and purity of these bands met the expected requirements.

[0093] 3.8 Intestinal tissue of Scorpionfish schlegelii CXCR1 and CXCR2 Gene relative expression analysis To evaluate the effect of adding recombinant Bacillus subtilis on the expression level of the IL-8 receptor protein-coding gene in the intestinal tissue of Sebastes schlegelii, the following study was conducted on the intestinal tissue. CXCR1 Genes and CXCR2 The relative expression levels of genes were analyzed.

[0094] After feeding recombinant Bacillus subtilis BB8, the intestinal tissue of Scorpionichthys schlegelii CXCR1 The relative expression levels of genes generally showed an upward trend. (BB8 group foregut) CXCR1 The relative expression levels of the gene showed a trend of first increasing and then decreasing, reaching their highest level on day 21. (BB8 group midgut) CXCR1 The relative expression levels of the gene were significantly higher than those in the PBS group and the WB800N group at all time points. p<0.05). BB8 group hindgut CXCR1 The relative expression of the gene increased first, then decreased, and then increased again, reaching a peak on day 28, and was significantly higher than that in the PBS group and the WB800N group p <0.05).

[0095] After feeding recombinant Bacillus subtilis BB8, the relative expression of the gene in the intestinal tissue of Sebastodes fuscescens CXCR2 The relative expression of the gene showed an increasing trend. On days 21 and 28, the relative expression of the gene in the BB8 group CXCR2 was significantly higher than that in the PBS group and the WB800N group p <0.05). On days 21 and 28, the relative expression of the gene in the BB8 group CXCR2 was significantly higher than that in the PBS group p <0.05). The relative expression of the gene in the BB8 group hindgut CXCR2 showed an increasing trend first and then a decreasing trend, reaching a maximum on day 14, and was significantly higher than that in the PBS group at each time point p <0.05). On days 7, 14, and 21, the relative expression of the gene in the BB8 group hindgut CXCR2 was significantly higher than that in the WB800N group p <0.05).

[0096] The above results show that the addition of recombinant Bacillus subtilis can increase the relative expression of the IL-8 protein receptor protein coding gene CXCR1 and CXCR2 in the intestinal tissue of Sebastodes fuscescens.

[0097] 3.9 Analysis of the relative expression of immune-related genes in different tissues of Sebastodes fuscescens To evaluate the effect of adding recombinant Bacillus subtilis on the immune level of Sebastodes fuscescens, the relative expression of immune-related genes in different tissues of Sebastodes fuscescens was analyzed.

[0098] After feeding recombinant Bacillus subtilis NF-κB The relative expression of the gene showed an increasing trend in different tissues, with the highest relative expression in the liver and spleen. The relative expression of the gene in the tissues of the BB8 group NF-κB was significantly higher than that in the PBS group and the WB800N group p <0.05).

[0099] The relative expression of the gene in the liver, spleen, kidney, and gill tissues of the BB8 group AP-1 showed an increasing trend first, then a decreasing trend, and then an increasing trend again, and was significantly higher than that in the PBS group and the WB800N group at each time point p <0.05). The relative expression of the spore coat protein The relative expression amount of the gene in the liver, spleen, kidney, gill, midgut and hindgut of the BB8 group HIF-1 The relative expression amount of the gene showed a trend of first increasing, then decreasing and then increasing again, wherein the relative expression amount of the gene in the spleen HIF-1 was the highest, the relative expression amount of the gene in the liver, kidney and gill was the second, and the relative expression amount of the gene in the midgut was the lowest. The relative expression amount of the gene in each tissue of the BB8 group HIF-1 was significantly higher than that in the PBS group and the WB800N group at each time point p (P < 0.05).

[0100] The relative expression amount of the gene in each tissue of the BB8 group reached the highest level on the 28th day STAT3 , which was significantly higher than that in the PBS group and the WB800N group p (P < 0.05).

[0101] The above results show that the addition of the recombinant Bacillus subtilis significantly improves the relative expression amount of the genes of NF-κB , AP-1 , HIF-1 and STAT3 in each tissue of the Sebastiscus inermis.

[0102] 3.10 Sebastiscus inermis challenge test results To evaluate the effect of the addition of the recombinant Bacillus subtilis on the resistance of the Sebastiscus inermis to the infection of V. harveyi WHSS0915 and V. parahaemolyticus ATCC33847 and mixed infection, a challenge test was performed. The results show that: V. harveyi After the infection of WHSS0915, the relative protection rate of the BB8 group was 60%. V. parahaemolyticus After the infection of ATCC33847, the relative protection rate of the BB8 group was 64.29%. V. harveyi After the mixed infection of WHSS0915 and V. parahaemolyticus ATCC33847, the relative protection rate of the BB8 group was 71.43%. The above results show that the addition of the recombinant Bacillus subtilis improves the resistance of the Sebastiscus inermis to the infection of V. harveyi WHSS0915 and V. parahaemolyticus ATCC33847 and mixed infection.

[0103] In summary, the recombinant Bacillus subtilis BB8 screened by the application has high safety and significant effect, and can be used as a core component of the Sebastiscus inermis immune enhancer, provides an effective technical solution for disease prevention and control of the Sebastiscus inermis aquaculture industry, and promotes the green, healthy and sustainable development of the industry.

[0104] IL-8 Gene coding region sequence: ATGATGAGCAGCGGATTCATTGTCTCCTCTATTGTGGTGCTCCTGGCTTTCCTGGCCGTCAGTGAAGGGATGAGTAAGAGAAGCCTGGGAGTGGAGCTGCACTGTCGCTGCATCCAGACGGAGAGCAAACCCATCAGCCGCCACATCGAGAAGGTGGAGCTGATTCCTGCCAACTCCCATTGCGGCGAGACCGAGATCATTGCTACTCTGAAAAAGACAGGCCAAGAGGTTTGCCTGGACCCCGAAGCTCTCTGGGTGAAGAAAGTAATTAAGAGGATCATGTCCAACAGAAGACGTTGA (SEQ ID NO. 1) optimized IL-8 gene sequence: GGCGGCGGAGGGATGATGTCATCTGGTTTCATCGTTTCTTCTATCGTTGTTCTTTTAGCTTTCTTAGCTGTTTCTGAAGGTATGTCTAAACGTTCTTTAGGTGTTGAACTTCACTGTCGTTGTATCCAAACTGAATCTAAACCAATCTCTCGTCACATCGAAAAAGTAGAACTTATCCCAGCTAACTCTCACTGTGGTGAAACTGAAATCATCGCTACTCTTAAGAAAACTGGTCAAGAAGTTTGTTTAGATCCTGAAGCTCTTTGGGTTAAAAAAGTAATCAAACGTATCATGTCTAACCGTCGTCGTCACCACCACCACCACCACTAA (SEQ ID NO. 2) The details of the present application are known.

[0105] The above description is merely the preferred embodiment of the present application but not to confine the present application. Any modification, equivalent replacement and improvement made in the spirit and principle of the present application shall be included within the scope of the present application.

Claims

1. A genetically engineered recombinant Bacillus subtilis, characterized in that, The genetically engineered recombinant Bacillus subtilis uses the spore capsid protein Cot B as an anchoring protein and can anchor and express IL-8 on the surface of the Bacillus.

2. The genetically engineered recombinant Bacillus subtilis as described in claim 1, characterized in that, The interleukin-8 (IL-8) is derived from fish, specifically from the rockfish (Scorpionus schlegelii).

3. The genetically engineered recombinant Bacillus subtilis as described in claim 2, characterized in that, The IL-8 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

4. The genetically engineered recombinant Bacillus subtilis as described in claim 1, characterized in that, The spore cap protein Cot B The gene originates from Bacillus subtilis WB800N.

5. The method for constructing recombinant Bacillus subtilis according to any one of claims 1-4, characterized in that, Includes the following steps: Build includes Cot B-IL-8 The recombinant expression vector of the fusion gene is obtained by transforming the recombinant expression vector into Bacillus subtilis.

6. The construction method as described in claim 5, characterized in that, The Cot B-IL-8 The fusion gene was obtained using overlap extension PCR technology, wherein... Cot B The gene originates from Bacillus subtilis WB800N; IL-8 The gene originates from fish, specifically from *Scorpionichthys schlegelii*. IL-8 The nucleotide sequence of the gene is shown in SEQ ID NO.2; The recombinant expression vector is an expression vector and the... Cot B-IL-8 The expression vector is a plasmid obtained by fusion gene ligation; further, the plasmid is the pDG364 plasmid.

7. The construction method as described in claim 5, characterized in that, The originating strain, Bacillus subtilis, is specifically Bacillus subtilis WB800N.

8. The use of the genetically engineered recombinant Bacillus subtilis according to any one of claims 1-4 in the preparation of fish immune enhancers.

9. The application as described in claim 8, characterized in that, The fish in question is *Scorpionichthys schlegelii*. Furthermore, the immune enhancer improves the growth performance and intestinal digestive enzyme activity of *Scorpionichthys schlegelii*, improves intestinal tissue structure, and enhances its antioxidant capacity, non-specific immune level, and resistance to Vibrio infection. The Vibrio includes *Vibrio harveyi* and *Vibrio parahaemolyticus*.

10. A fish immune enhancer, characterized in that, The fish immune enhancer comprises the genetically engineered recombinant Bacillus subtilis as described in any one of claims 1-4; further, the fish immune enhancer also comprises sodium alginate.

Citation Information

Patent Citations

  • Recombinant bacillus subtilis as well as construction method and application thereof

    CN118599747A

  • Marine source probiotic bacillus for antagonizing vibrio and application of marine source probiotic bacillus

    CN119060887A

  • Perch interlenkin 8 gene sequence

    CN1869229A

  • Probiotics composition for fishes containing a mixture of Bacillus subtilis and phage

    KR1020150024115A