Modified Brucella, preparation method and application thereof, and vaccine

By replacing the Omp25 gene of Brucella with the IFN-γ gene, a modified Brucella was prepared, which solved the problems of insufficient immunoprotection and high infectivity in humans of existing vaccines, and achieved better prevention and control effects and safety.

CN121379909APending Publication Date: 2026-01-23TECON BIOPHARMACEUTICAL CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511602104.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing brucellosis vaccines have problems such as insufficient immune protection, high infectivity in humans, and other side effects, making it difficult to effectively control the spread and harm of brucellosis.

Method used

By replacing the Omp25 gene of Brucella with the IFN-γ gene, a modified Brucella was prepared. The gene replacement was carried out using homologous recombination, and the IFN-γ gene sequence was optimized to facilitate expression and secretion in Brucella, thereby improving the immune effect.

Benefits of technology

The modified Brucella bacteria have a shorter survival time in animals, reducing the risk of bacterial contamination, improving vaccine safety and immunogenicity, and enhancing cellular immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121379909A_ABST
    Figure CN121379909A_ABST
Patent Text Reader

Abstract

The invention provides modified brucella as well as a preparation method and application thereof and a vaccine, and relates to the technical field of biology. The Omp25 gene of the modified brucella is replaced by an IFN (interferon)-gamma gene. The vaccine containing the modified Brucella is short in bacterium discharging time when being used for immunizing animals, the cellular immune effect can be improved, and prevention and control of Brucella are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a modified Brucella bacteria, its preparation method and application, and vaccines. Background Technology

[0002] The following statements are provided only as background information in relation to the present invention and do not necessarily constitute prior art.

[0003] Brucella is a group of Gram-negative facultative intracellular parasitic bacteria that primarily infect livestock and wild animals, and is also an important zoonotic pathogen. Brucellosis is an infectious disease caused by Brucella, which causes serious economic losses to the livestock industry and poses a public health threat.

[0004] In animal husbandry, Brucella primarily infects cattle, sheep, and pigs, causing reproductive disorders such as abortion, stillbirth, and infertility, severely impacting farm productivity and economic benefits. Infected animals can also become long-term carriers, continuously shed bacteria through milk, urine, placental secretions, and other bodily fluids, further spreading the disease. Furthermore, brucellosis can lead to weight loss and reduced milk production, further exacerbating economic losses in the livestock industry.

[0005] Brucellosis not only poses a threat to animal health but can also be transmitted to humans through direct contact with infected animals or their products (such as unpasteurized dairy products), causing symptoms such as fever, joint pain, and fatigue, and in severe cases, even leading to chronic disease. In short, Brucella is a serious pathogen in the livestock industry, affecting not only animal health and production performance but also posing a potential threat to human health, necessitating comprehensive control measures. Therefore, Brucella control is crucial in the livestock industry, requiring measures such as vaccination, regular testing, and isolation of infected animals to reduce its spread and harm. Providing Brucella strains that can be used as vaccines is also helpful in Brucella control.

[0006] Currently, vaccines used for brucellosis prevention mainly include live attenuated vaccines, inactivated vaccines, DNA vaccines, and subunit vaccines. Live attenuated vaccines are recognized as the best vaccines for preventing brucellosis in animals, but they have drawbacks such as residual virulence and interference with diagnosis. Commonly used classic live attenuated vaccines in clinical practice include S119, Rev.1, M5, S2, and RB51. The S19 vaccine provides strong immune protection for cattle, but reports indicate that it has some pathogenicity in humans, and human infection may occur during its production or administration. The bovine brucellosis RB51 vaccine is resistant to rifampin and has some infectivity in humans; therefore, it is not widely used in my country. Rev.1 and M5 are brucellosis vaccines for sheep, both of which have high virulence, while the brucellosis vaccine strain S2 for pigs has a low level of protection and a short duration of immunity. Commonly used DNA vaccines induce strong humoral and cellular immune responses by encoding cytosolic binding protein p39, liposomal proteins L7 / L12, copper-zinc superoxide dismutase, Brucella dioxetine synthase, Omp16, Omp25, and outer membrane protein Omp31. However, due to their low immunogenicity, multiple booster immunizations or higher doses are necessary to enhance vaccine efficacy. Similarly, subunit vaccines and other novel vaccines also suffer from less than ideal immunoprotective efficacy. Therefore, improving vaccine protection while reducing infectivity and other side effects remains a challenge.

[0007] In view of this, the present invention is hereby proposed. Summary of the Invention

[0008] The purpose of this invention is to provide a modified Brucella strain for use in vaccine preparation, thereby improving the effectiveness of Brucella prevention and control.

[0009] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: In one aspect, a modified Brucella strain is provided, wherein the Omp25 gene of the Brucella strain is replaced with the IFN-γ gene.

[0010] In an optional embodiment, the modified Brucella is obtained by modifying Brucella bovis, Brucella ovis, or Brucella swine. In an optional embodiment, the bovine Brucella includes strain A19, strain S19, strain 2308, strain RB51, strain ATCC 544, strain ATCC 86 / 8 / 59, or strain ATCC 292. In an optional embodiment, the Brucella ovis includes strain M5, strain Tulya, or strain B3196. In an optional embodiment, the swine brucellosis includes strain S2; In an optional embodiment, the modified Brucella is obtained by modifying Brucella bovis strain A19.

[0011] In an optional embodiment, the 5' end of the IFN-γ gene contains a nucleotide sequence encoding the unstable domain of the BtpB protein; In an optional embodiment, the unstable domain of the BtpB protein is positions 1 to 90 of the BtpB protein amino acid sequence; In an optional embodiment, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9; In an optional embodiment, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO. 2.

[0012] In an optional embodiment, the IFN-γ gene contains the bovine IFN-γ gene; In an optional embodiment, the nucleotide sequence of the IFN-γ gene is obtained through sequence optimization; In an optional embodiment, the nucleotide sequence of the bovine IFN-γ gene after sequence optimization is shown in SEQ ID NO. 1.

[0013] In an optional embodiment, the nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.3.

[0014] In a second aspect, an IFN-γ gene for secretory expression in Brucella is provided, wherein the IFN-γ gene contains, from the 5' to the 3' segment, a nucleotide sequence encoding an unstable domain of the BtpB protein and a nucleotide sequence encoding IFN-γ. In an optional embodiment, the unstable domain of the BtpB protein is positions 1 to 90 of the BtpB protein amino acid sequence; In an optional embodiment, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9; In an optional embodiment, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO. 2; In an optional implementation, the IFN-γ includes bovine IFN-γ; In an optional implementation, the nucleotide sequence encoding IFN-γ is obtained through sequence optimization; In an optional implementation, the sequence-optimized nucleotide sequence encoding bovine IFN-γ is shown in SEQ ID NO.1; In an optional embodiment, the nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.3.

[0015] Thirdly, a method for preparing the modified Brucella described in the first aspect is provided, the method comprising replacing the Omp25 gene of Brucella with the IFN-γ gene.

[0016] In an optional embodiment, the preparation method shown includes replacing the Omp25 gene of Brucella with the IFN-γ gene using a homologous recombination method.

[0017] In an optional implementation, the homologous arm for homologous recombination includes an upstream homologous arm and a downstream homologous arm, wherein the upstream homologous arm is 501 bp upstream of the Omp25 gene and the downstream homologous arm is 501 bp downstream of the Omp25 gene.

[0018] In an optional embodiment, in the vector used for homologous recombination, the 5' end of the IFN-γ gene contains an upstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.4, and the 3' end contains a downstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.5.

[0019] In an optional embodiment, the IFN-γ gene is the IFN-γ gene for secretion and expression in Brucella as described in the second aspect.

[0020] Fourthly, the modified Brucella bacteria described in the first aspect, or the IFN-γ gene for secretion and expression in Brucella bacteria described in the second aspect, or the preparation method described in the third aspect, are provided for use in the preparation of vaccines.

[0021] Fifthly, a vaccine is provided that contains the modified Brucella bacteria described in the first aspect.

[0022] Compared with the prior art, the present invention has the following beneficial effects: The modified Brucella provided by this invention replaces the Omp25 gene with the IFN-γ gene. This modified Brucella has a shorter survival time in animals, reducing the time of bacterial shedding due to immunization, thus decreasing environmental pollution and harm to livestock workers caused by animal shedding. Furthermore, the modified Brucella provided by this invention exhibits better cellular immune response. Vaccines prepared based on this modified Brucella have better safety while maintaining good immunogenicity. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 The results of ST-IFN-γ gene identification in strain A19-△Omp25-ST-IFN-γ of Example 1 are shown below. The lane numbers correspond to the following samples: M: nucleic acid standard; 1: negative control; 2: positive control; 3: strain 1; 4: strain 2; 5: strain 3; 6: strain 4; 7: strain 5; 8: strain 6; 9: strain 7. Figure 2 The results of omp25 gene identification in strain A19-△Omp25-ST-IFN-γ in Example 1 are shown below. Lane numbers correspond to the following samples: M: nucleic acid standard; 1: negative control; 2: positive control; 3: strain 1; 4: strain 2; 5: strain 3; 6: strain 4; 7: strain 5; 8: strain 6; 9: strain 7. Figure 3 The SDS-PAGE results of IFN-γ in the culture supernatants of each bacterial strain in Example 2 are shown below. Lane numbers correspond to the following samples: M: protein standard; 1: culture supernatant of A19-△Omp25-IFN-γ strain; 2: culture supernatant of A19-△Omp25-ST-IFN-γ strain; 3: culture supernatant of A19-△Omp25-ST-IFN-γwd strain. Figure 4 This refers to the gating strategy for flow cytometry data in Example 3; Figure 5 In Example 3, flow cytometry was used to detect CD4+IFN-γ+ T cells and CD8+ after immunization with A19 and A19-ΔOmp25-ST-IFN-γ, respectively. + IFN-γ + T cell results; Figure 6 The curves showing the change in Brucella seropositivity rate over time after immunization with A19 and A19-△Omp25-ST-IFN-γ, respectively, in Example 3. Detailed Implementation

[0025] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] It should be noted that: Unless otherwise specified, all embodiments and preferred embodiments mentioned herein can be combined to form new technical solutions. All technical features and preferred features mentioned herein can be combined to form new technical solutions. The components involved, or their preferred components, can be combined to form new technical solutions.

[0027] In this article, the "range" disclosed is in the form of a lower limit and an upper limit, which may be one or more lower limits and one or more upper limits, respectively.

[0028] In this document, unless otherwise stated, the various reactions or operational steps may be performed sequentially or not in sequence. Preferably, the reaction methods described herein are performed sequentially.

[0029] In this document, unless otherwise stated, any numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order or importance between these entities or behaviors, such as numbering first, second... fifth.

[0030] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0031] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0032] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those familiar to a person skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be used herein.

[0033] In one aspect, a modified Brucella strain is provided, wherein the Omp25 gene of the Brucella strain is replaced with the IFN-γ gene.

[0034] Brucella Omp25 protein is a protein released in an acidic medium during the initial stage of invasion of macrophages. It participates in Brucella's invasion and survival and reproduction in host cells, and is an important virulence factor of Brucella.

[0035] In an optional embodiment, the modified Brucella is obtained by modifying Brucella bovis, Brucella ovis, or Brucella swine.

[0036] In an optional embodiment, the bovine Brucella includes strains A19, S19, 2308, RB51, ATCC 544, ATCC 86 / 8 / 59, or ATCC 292.

[0037] In an optional embodiment, the Brucella ovis includes strain M5, strain Tulya, or strain B3196.

[0038] In an optional embodiment, the swine brucellosis includes strain S2.

[0039] In an optional embodiment, the modified Brucella is obtained by modifying Brucella bovis strain A19.

[0040] In an optional embodiment, the 5' end of the IFN-γ gene contains a nucleotide sequence encoding the unstable domain of the BtpB protein, that is, replacing the stable domain encoding the Brucella BtpB gene with the IFN-γ gene sequence. Here, "stable domain" refers to a region in a protein or other macromolecule that has a relatively independent and stable three-dimensional structure. These regions typically maintain their conformation under different conditions, exhibiting high structural conservation and functionality. "Instantaneous domain" refers to the remaining portion of a protein excluding the "stable domain" defined above. Replacing the stable domain encoding the Brucella BtpB gene with the IFN-γ gene sequence allows IFN-γ to be successfully secreted outside the bacterial cell after expression within Brucella.

[0041] In an optional embodiment, the unstable domain of the BtpB protein is located at positions 1 to 90 of the BtpB protein amino acid sequence.

[0042] In an optional embodiment, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9.

[0043] In an optional embodiment, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO. 2.

[0044] In an optional embodiment, the IFN-γ gene contains the bovine IFN-γ gene.

[0045] In an optional embodiment, the nucleotide sequence of the IFN-γ gene is obtained through sequence optimization.

[0046] In an optional embodiment, the nucleotide sequence of the bovine IFN-γ gene after sequence optimization, as shown in SEQ ID NO.1, is more suitable for expression in Brucella.

[0047] In an optional embodiment, the nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.3.

[0048] In a second aspect, an IFN-γ gene for secretory expression in Brucella is provided, wherein the IFN-γ gene contains, sequentially from the 5' to the 3' segment, a nucleotide sequence encoding an unstable domain of the BtpB protein and a nucleotide sequence encoding IFN-γ.

[0049] In an optional embodiment, the unstable domain of the BtpB protein is located at positions 1 to 90 of the BtpB protein amino acid sequence.

[0050] In an optional embodiment, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9.

[0051] In an optional embodiment, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO. 2.

[0052] In an optional implementation, the IFN-γ includes bovine IFN-γ.

[0053] In an optional implementation, the nucleotide sequence encoding IFN-γ is obtained through sequence optimization.

[0054] In an optional implementation, the sequence-optimized nucleotide sequence encoding bovine IFN-γ is shown in SEQ ID NO.1.

[0055] In an optional embodiment, the nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.3.

[0056] Thirdly, a method for preparing the modified Brucella described in the first aspect is provided, the method comprising replacing the Omp25 gene of Brucella with the IFN-γ gene.

[0057] In an optional embodiment, the preparation method includes replacing the Omp25 gene of Brucella with the IFN-γ gene using a homologous recombination method.

[0058] In an optional implementation, the homologous arm for homologous recombination includes an upstream homologous arm and a downstream homologous arm, wherein the upstream homologous arm is 501 bp upstream of the Omp25 gene and the downstream homologous arm is 501 bp downstream of the Omp25 gene.

[0059] In an optional embodiment, in the vector used for homologous recombination, the 5' end of the IFN-γ gene contains an upstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.4, and the 3' end contains a downstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.5.

[0060] In an optional embodiment, the preparation method uses the IFN-γ gene for secretion and expression in Brucella as described in the second aspect to replace the Omp25 gene of Brucella.

[0061] Fourthly, the modified Brucella bacteria described in the first aspect, or the IFN-γ gene for secretion and expression in Brucella bacteria described in the second aspect, or the preparation method described in the third aspect, are provided for use in the preparation of vaccines.

[0062] Fifthly, a vaccine is provided that contains the modified Brucella bacteria described in the first aspect.

[0063] It is understood that the vaccine may optionally contain any other antigens acceptable in the art, including but not limited to antigens derived from other strains of Brucella or antigens from other pathogens. The antigens include, but are not limited to, one or more of attenuated live pathogens, inactivated pathogens, polypeptide antigens, and polynucleotides encoding antigens. The other pathogens include, but are not limited to, Mycobacterium bovis (…). Mycobacterium bovis Bacillus anthracis ( Bacillus anthracis Pasteurella multocida ( ) Pasteurella multocida ), hemolytic Mansonia ( Mannheimia haemolytica ), Escherichia coli ( Escherichia coli ) and bovine mycoplasma ( Mycoplasma bovis One or more of the following.

[0064] In an optional embodiment, the vaccine may further include one or more excipients acceptable in the art, including but not limited to solvents, buffer components, pH adjusters, vaccine adjuvants, preservatives, immune enhancers, and stabilizers.

[0065] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0066] Example 1 Bovine IFN-γ gene sequence optimization: To facilitate better expression of bovine IFN-γ mRNA in Brucella strain A19, the original bovine IFN-γ gene sequence was optimized. The original bovine IFN-γ gene sequence is shown in SEQ ID NO.6, and the optimized sequence is shown in SEQ ID NO.1. 2. ST IFN-γ gene design: To ensure that bovine IFN-γ mRNA can be successfully secreted outside Brucella after expression within Brucella, bovine IFN-γ was expressed using the Brucella type IV secretion system. The Brucella type IV secretion system (T4SS) mainly exerts its biological functions by acting on host cells through secretory effector proteins. By analyzing 15 effector proteins of Brucella T4SS, the BtpB effector protein was finally selected. Analysis of the structural domains of this protein revealed that its stable structural domain is 91–292 amino acids. The stable structural domain of the BtpB effector protein was replaced by the bovine IFN-γ gene sequence, enabling bovine IFN-γ to be expressed in a secretory form. This gene was named ST IFN-γ. The BtpB unstable domain sequence is shown in SEQ ID NO.2, and the ST IFN-γ gene sequence is shown in SEQ ID NO.3.

[0067] 3. Design and synthesis of the △Omp25-ST-IFN-γ gene: To enable the ST-IFN-γ gene to replace the Omp25 gene via homologous substitution recombination, 501 bp homologous arms were selected from both ends of the Omp25 gene through genomic analysis. The ST-IFN-γ gene was then inserted between these homologous arms, named the △Omp25-ST-IFN-γ gene, and synthesized by GenScript. The 5' homologous arm sequence of Omp25 is shown in SEQ ID NO.4, and the 3' homologous arm sequence is shown in SEQ ID NO.5. The △Omp25-ST-IFN-γ gene sequence is shown in SEQ ID NO.7.

[0068] The △Omp25-ST-IFN-γ gene was inserted into the pK18mobSacB plasmid (EcoRⅠ and BamHⅠ) to obtain the pK18mobSacB-△Omp25-ST-IFN-γ plasmid. The pK18mobSacB plasmid contains a kanamycin resistance gene (KanR) and a sucrose sensitivity gene (SacB). The kanamycin resistance gene (KanR) confers resistance to kanamycin and neomycin to host cells; the sucrose sensitivity gene (SacB) converts sucrose into fructan, and cells containing the SacB gene cannot grow in sucrose-containing media, thus it can be used for screening. The sequence of the pK18mobSacB-△Omp25-ST-IFN-γ plasmid is shown in SEQ ID NO.8. 5. Screening and identification of A19-△Omp25-ST-IFN-γ strain: 5.1 Preparation of competent Brucella A19 strain: Brucella A19 strain was streaked onto TSA plates and incubated at 36–38°C for 72 hours. Single colonies were picked and inoculated into 10 ml of TSB medium and incubated at 200 rpm at 36–38°C for 48 hours. The bacterial culture was then inoculated into 200 ml of TSB medium at a ratio of 2% and incubated at 200 rpm at 36–38°C for 18–24 hours. The cells were collected by centrifugation at 8000 rpm for 20 minutes. The cells were washed twice with pre-cooled distilled water and twice with pre-cooled 15% glycerol. The supernatant was discarded as much as possible. The precipitate was resuspended in 2 ml of pre-cooled 15% glycerol and dispensed into 100 µl tubes. The tubes were stored at -80°C for later use.

[0069] 5.2 Electroporation of Brucella A19 competent cells with pK18mobSacB-△Omp25-ST-IFN-γ plasmid: Brucella A19 competent cells were removed from 80℃ and placed on ice. 10µl of the recombinant pK18mobSacB-△Omp25-ST-IFN-γ plasmid was slowly added to the competent cells and gently mixed. 100µl of the mixture was transferred to a 0.1cm diameter electroporation cuvette and the rubber cap was tightened. Excess moisture was wiped off the outside of the cuvette, and the cuvette was placed in an electroporator at 1.8kV and 400Ω for electroporation. Immediately after electroporation, 1ml of TSB medium was added to the cuvette, and the cells were incubated at 160r / min at 27–29℃ for 4 hours. 200µl of the bacterial culture was then plated onto TSA plates (Kan 100µg / ml) and incubated at 27–29℃ for 3–7 days.

[0070] 5.3 Screening and identification of Brucella A19-pK18mobSacB-△Omp25-ST-IFN-γ strain: Single colonies were selected for identification of the SacB gene and ST-IFN-γ gene. Positive clones were Brucella A19-pK18mobSacB-△Omp25-ST-IFN-γ strain.

[0071] 5.4 Screening and identification of Brucella A19-△Omp25-ST-IFN-γ strains: Brucella A19-pK18mobSacB-△Omp25-ST-IFN-γ strains were passaged 3–5 times in TSB liquid medium containing kanamycin resistance, followed by 3–5 passages in TSB-free liquid medium. The final passages were plated on TSA plates containing 5–10% sucrose (Brucella containing the SacB gene dies) and incubated at 37°C for 4–7 days. Single colonies were picked for Omp25 and ST-IFN-γ gene identification. Strains negative for Omp25 and positive for ST-IFN-γ were identified as Brucella A19-△Omp25-ST-IFN-γ strains. Strains 4, 5, 7, 8, and 9 were identified as Brucella A19-△Omp25-ST-IFN-γ strains. Results are as follows: Figure 1 and Figure 2 As shown.

[0072] Omp25 gene amplification, primers are as follows: Omp25F:atgcgcactcttaagtctctcg (SEQ ID NO. 10); Omp25R:ttagaacttgtagccgatgccg (SEQ ID NO. 11).

[0073] Amplification system: 12.5 μl of 2×Taq Mix, 1 μl of Omp25F, 1 μl of Omp25R, 9 μl of sterile water, and 1.5 μl of template; Amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 40 s, for 35 cycles; Final extension: 72℃ extension for 10 min.

[0074] ST-IFN-γ gene amplification, primers are as follows: ST-IFN-γF: atgtacaatttatttgtttcggggctg (SEQ ID NO. 12); ST-IFN-γR: ggTgcttgcacggcgacc (SEQ ID NO. 13).

[0075] Amplification system: 12.5 μl of 2×Taq Mix, 1 μl of ST-IFN-γF, 1 μl of ST-IFN-γR, 9 μl of sterile water, and 1.5 μl of template; Amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles; Final extension: 72℃ extension for 10 min.

[0076] Example 2 Experimental Group 1: A19-△Omp25-IFN-γ strain. The only difference between this strain and Example 1 is that the IFN-γ gene does not have the BtpB gene unstable domain at the 5' end. The preparation method is the same as that of Example 1.

[0077] Experimental group 2: A19-△Omp25-ST-IFN-γ strain, prepared in Example 1.

[0078] Experimental group 3: A19-△Omp25-ST-IFN-γwd strain. The only difference between this strain and Example 1 is that the IFN-γ gene was not sequence optimized. The preparation method is the same as that of Example 1.

[0079] Strains A19-△Omp25-IFN-γ, A19-△Omp25-ST-IFN-γ, and A19-△Omp25-ST-IFN-γwd were all inoculated into 50 ml of TSB liquid medium at a 1:200 inoculation ratio and cultured at 37°C and 200 rpm for 48 h. A portion of the bacterial culture was then diluted with TSB liquid medium to a concentration of 2 OD. 600 The diluted bacterial culture was centrifuged at 12,000 rpm for 10 min, and the supernatant was subjected to SDS-PAGE to compare IFN-γ secretion expression. The results are as follows: Figure 3 As shown, comparing experimental groups 1 and 2, it is demonstrated that the presence of the BtpB stable domain enables the secretion and expression of IFN-γ; comparing experimental groups 2 and 3, it is demonstrated that the sequence-optimized IFN-γ is more suitable for secretion and expression in Brucella.

[0080] Example 3 Animal experiments: 1. Antibody expression level: Cattle were immunized with strain A19-△Omp25-ST-IFN-γ, and the expression level of antibodies in the animals after immunization was detected. The results are shown in Table 1: Table 1. Results of antibody tube agglutination assay (SAT) after immunization of cattle with strain A19-△Omp25-ST-IFN-γ.

[0081] 2. Antigen-specific T-cell immune capacity: Experimental methods: 6-8 week old female Naïve C57BL / 6 mice were randomly divided into two groups (6 mice / group): the A19 treatment group and the A19-△Omp25-ST-IFN-γ treatment group. On day 0, they were injected with 10 mg of IFN-γ via the tail vein. 5 Spleens were isolated from CFU A19 and A19-△Omp25-ST-IFN-γ strains on day 30. Spleen suspensions were prepared in a clean bench, and spleen cells were cultured at 2×10⁻⁶ cells / mL. 6Cells were seeded at a concentration of 1 mL / mL into two wells (24-well plate), and treated with A19 lysate at a concentration of 10 μg / mL. The other well was left untreated as a control. After 2 h, 0.66 μl of the protein transport inhibitor GolgiStop™ was added to each well, and the cells were cultured for another 10 h. Cells were then collected, and antigen-specific T-cell immune responses were detected using the following steps: (1) Collect spleen cells, add 7 mL PBS, centrifuge (1200 r / min, 7 min) and wash, and discard the supernatant.

[0082] (2) Add anti-CD4 and anti-CD8 flow cytometry antibodies to the cell pellet and incubate the cell surface in the dark for 15 min.

[0083] (3) After the flow cytometry antibody incubation is completed, add 5 mL of PBS, centrifuge (1200 r / min, 7 min) and wash, and discard the supernatant.

[0084] (4) Add 100 μL of cell permeabilizing solution to the cell pellet and treat the cells. Incubate in a dark room at 4°C for 30 min. Then wash the cells once with 1 mL of washing buffer, centrifuge (1200 r / min, 7 min) and discard the supernatant.

[0085] (5) Add anti-IFN-γ flow cytometry antibody to the cell pellet and incubate in the dark for 15 min.

[0086] (6) After the flow cytometry antibody incubation is completed, add 7 mL PBS, centrifuge (1200 r / min, 7 min), wash, and discard the supernatant.

[0087] (7) The cell pellet was resuspended in 300 μL PBS, filtered through a 200-mesh copper grid into a flow cytometer tube, and analyzed by flow cytometry.

[0088] Gating strategies for flow cytometry data, such as Figure 4 As shown, CD4+IFN-γ+ T cells and CD8+ were detected by flow cytometry after immunization with A19 and A19-△Omp25-ST-IFN-γ, respectively. + IFN-γ + T cell results as follows Figure 5 As shown, compared with the A19 group, A19-△Omp25-ST-IFN-γ significantly enhanced the specific CD4+IFN-γ+ T and CD8+IFN-γ+ T cell responses of A19 lysate cells. These results indicate that A19-△Omp25-ST-IFN-γ enhances antigen-specific immune responses.

[0089] 3. Animal bacterial shedding time: Experimental Methods: Sixteen 4-month-old Holstein cows were randomly divided into two groups of eight each. One group was immunized with A19-ΔOmp25-ST-IFN-γ, and the other group was immunized with A19. The immunization dose for both groups was 6.0 × 10⁻⁶. 10 CFU / head was collected from vaginal swabs on days 3, 7, 14, 21, 28, and 35 post-immunization for Brucella testing. The bacterial shedding status of the two Brucella strains after immunization was statistically analyzed.

[0090] Brucella detection based on the BCSP31 gene using the following primers: BCSP31F: atgaaattcggaagcaaaatccgtcg (SEQ ID NO. 14); BCSP31R: ttattcagcacgcccgcttc (SEQ ID NO. 15).

[0091] Amplification system: 12.5 μl of 2×Taq Mix, 1 μl of BCSP31F, 1 μl of BCSP31R, 9 μl of sterile water, and 1.5 μl of template; Amplification program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 60 s, for 35 cycles; Final extension: 72℃ extension for 10 min.

[0092] The results are as follows Figure 6 As shown, the positive rate of bacterial shedding in cattle after immunization with the A19-△Omp25-ST-IFN-γ strain reached its highest level on day 7, with 6 out of 8 cattle shedding the strain. Subsequently, the number of cattle with positive bacterial shedding gradually decreased, and no cattle shed the strain again on day 28. However, the positive rate of bacterial shedding in cattle after immunization with A19 remained relatively high.

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A modified Brucella, characterized in that, The Omp25 gene of the Brucella bacteria was replaced with the IFN-γ gene.

2. The modified Brucella according to claim 1, characterized in that, The modified Brucella bacteria were obtained by modifying Brucella bovis, Brucella ovis, or Brucella swine. Optionally, the bovine Brucella includes strains A19, S19, 2308, RB51, ATCC 544, ATCC 86 / 8 / 59, or ATCC 292. Optionally, the *Brucella melanogaster* includes strain M5, strain Tulya, or strain B3196; Optionally, the swine brucellosis includes strain S2; Optionally, the modified Brucella is obtained by modifying Brucella bovis strain A19.

3. The modified Brucella according to claim 1, characterized in that, The 5' end of the IFN-γ gene contains a nucleotide sequence encoding the unstable domain of the BtpB protein. Optionally, the unstable domain of the BtpB protein is located at positions 1 to 90 of the BtpB protein amino acid sequence; Optionally, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9; Optionally, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO.

2.

4. The modified Brucella according to any one of claims 1 to 3, characterized in that, The IFN-γ gene contains the bovine IFN-γ gene; Optionally, the nucleotide sequence of the IFN-γ gene is obtained through sequence optimization; Optionally, the nucleotide sequence of the bovine IFN-γ gene after sequence optimization is shown in SEQ ID NO.

1.

5. The modified Brucella according to claim 4, characterized in that, The nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.

3.

6. An IFN-γ gene for secretion and expression in Brucella, characterized in that, The 5' to 3' segments contain, sequentially, the nucleotide sequence encoding the unstable domain of the BtpB protein and the nucleotide sequence encoding IFN-γ; Optionally, the unstable domain of the BtpB protein is located at positions 1 to 90 of the BtpB protein amino acid sequence; Optionally, the amino acid sequence of the unstable domain of the BtpB protein is shown in SEQ ID NO.9; Optionally, the nucleotide sequence encoding the unstable domain of the BtpB protein is shown in SEQ ID NO.2; Optionally, the IFN-γ includes bovine IFN-γ; Optionally, the nucleotide sequence encoding IFN-γ is obtained through sequence optimization; Optionally, the sequence-optimized nucleotide sequence encoding bovine IFN-γ is shown in SEQ ID NO.1; Optionally, the nucleotide sequence of the IFN-γ gene is shown in SEQ ID NO.

3.

7. The method for preparing the modified Brucella according to any one of claims 1 to 5, characterized in that, This includes replacing the Omp25 gene in Brucella with the IFN-γ gene.

8. The preparation method according to claim 7, characterized in that, This includes replacing the Omp25 gene of Brucella with the IFN-γ gene using homologous recombination; Optionally, the homologous arm used for homologous recombination includes an upstream homologous arm and a downstream homologous arm, wherein the upstream homologous arm is 501 bp upstream of the Omp25 gene and the downstream homologous arm is 501 bp downstream of the Omp25 gene. Optionally, in the vector for homologous recombination, the 5' end of the IFN-γ gene contains an upstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.4, and the 3' end contains a downstream homologous arm with a nucleotide sequence as shown in SEQ ID NO.5; Optionally, the IFN-γ gene is the IFN-γ gene for secretory expression in Brucella as described in claim 6.

9. The modified Brucella according to any one of claims 1 to 5, or the IFN-γ gene for secretion and expression in Brucella according to claim 6, or the preparation method according to claim 7 or 8, used in the preparation of a vaccine.

10. A vaccine, characterized in that, Brucella containing the modified Brucella according to any one of claims 1 to 5.