GatF gene knockout bovine pasteurella multocida attenuated strain as well as construction method and application thereof

Abstract

The invention discloses a gatF gene knockout bovine pasteurella multocida attenuated strain as well as a construction method and application thereof, and belongs to the technical field of gene engineering and biology. The attenuated strain is obtained by knocking out a gatF gene in pasteurella multocida through a homologous recombination method. The strain is stable in heredity, the in-vitro growth characteristic is the same as that of a wild strain, but the toxicity to mice is obviously weakened. Animal tests show that after mice are immunized by the low virulent strain, high-level specific antibodies can be induced to be generated, and up to 80% of immune protection can be provided for attack of the high virulent strain. The invention provides a safe and effective candidate vaccine strain for preventing pasteurellosis multocida, particularly bovine respiratory disease syndrome caused by L3 type strains.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to the construction and application of an attenuated multi-toxic Pasteurella multocida strain. Background Technology

[0002] Pasteurella multocida ( Pasteurella multocida Pasteurella multocida is an important animal pathogen that can infect various hosts such as cattle, pigs, and poultry, causing hemorrhagic septicemia or respiratory diseases, resulting in significant economic losses to the livestock industry. Based on differences in capsular polysaccharide composition and lipopolysaccharide (LPS) structure, Pasteurella multocida is classified into 5 capsular serotypes (A, B, D, E, and F) and 8 LPS genotypes (L1-L8). In recent years, L3 Pasteurella multocida has gradually increased in the domestic cattle industry, becoming the dominant serotype and one of the main pathogens of bovine respiratory disease syndrome (BRDC). It is highly pathogenic and difficult to control.

[0003] Currently, prevention and control of this disease mainly rely on vaccination and antibiotic treatment. Commercial vaccines are mostly inactivated vaccines, but they have drawbacks such as high immunization doses, short immune cycles, and primarily stimulating humoral immunity while offering relatively weak cellular immunity. Although some research has been conducted on live attenuated vaccines, their attenuation mechanisms, safety profiles, and immunoprotective effects are often unsatisfactory. Therefore, finding new attenuated targets with clear attenuation mechanisms, high safety, and strong immunoprotective efficacy is crucial for developing novel vaccines.

[0004] Lipopolysaccharide (LPS) is a key virulence factor and protective antigen of Pasteurella multocida, and the integrity of its outer core oligosaccharide structure is crucial for the complete virulence of the bacteria. Numerous LPS serotypes exist, and based on epidemiological data from bovine and avian clinical isolates, recent research has primarily focused on L1, L3, and L6 LPS serotypes. [1-3] Studies have shown that the synthetic pathways of the extracellular oligosaccharides in different types of LPS are dominated by independent gene clusters. These gene clusters encode various transferases, whose function is to catalyze the addition and linkage of specific structures during LPS biosynthesis to maintain the complete conformation and biological activity of the LPS molecule, thereby ensuring the complete virulence of bacteria. Previous reports have confirmed that... hptE , pcgD and gatA The deletion of multiple transferase genes can lead to a decrease in the virulence of the strain. [4] ,in gatA The potential of deletion strains in live attenuated vaccines has been demonstrated. [5] .

[0005] and gatA similar, gatF It also encodes a glycosyltransferase. Among them,gatA In L1-type LPS, it is responsible for linking galactose molecules 1 and 2 (Gal I and Gal II) to heptose molecule 4 (Hep IV). gatF In L3-type LPS, the linkage between galactose molecules (β–Gal I) and glucose molecules (β–Glc IV) is catalyzed. [6] Not only are the types of glycosylation reactions they catalyze completely different from their substrate specificities, but their gene sequences also lack homology. Therefore, targeting L3 Pasteurella multocida... gatF Functional studies of genes can contribute to the development of novel attenuated vaccines.

[0006] References: [1]Marina Harper et al. Protective efficacy afforded by livePasteurella multocida vaccines in chickens is independent of lipopolysaccharide outer core structure [J]. Vaccine vol. 34,14 (2016): 1696-1703. [2]Lida Omaleki et al. Phase variation in the glycosyltransferasegenes of Pasteurella multocida associated with outbreaks of fowl cholera onfree-range layer farms [J]. Microbial genomics vol. 8,3 (2022): 0-0. [3]Tamara Alhamami et al. Genomic profiling of Pasteurella multocidaisolated from feedlot cases of bovine respiratory disease [J]. Veterinarymicrobiology vol. 283,0 (2023): 109773-109773. [4] Liang Sheng. The role of exogenous core oligosaccharides in Pasteurella multocida's response to stress environment and host infection [D]. Sichuan Agricultural University, 2019. [5] Shen Hui. Evaluation of the immunoprotective effect of Pasteurella multocida gatA mutant strain [D]. Sichuan Agricultural University, 2020. [6]Marina Harper et al. The Myriad Properties of Pasteurellamultocida Lipopolysaccharide [J]. Toxins vol. 9,8 (2017): 254-254. Summary of the Invention The LPS synthesis pathways differ among different serotypes of LPS strains, and the functions of their key enzymes are not the same. For example, in L3 LPS, the enzymes are responsible for catalyzing the linkage between galactose and glucose. gatF The function of the gene and its potential application in attenuated vaccines have not yet been revealed, and existing technologies lack specific, safe, and effective attenuated vaccine candidate strains against the dominant circulating serotype L3. Therefore, this invention provides a novel attenuated live vaccine strain against L3-type Pasteurella multocida, possessing a clear attenuation mechanism, good safety profile, and the ability to provide effective immunoprotection.

[0007] To achieve the above objectives, the applicant analyzed the extracellular core oligosaccharide synthesis gene cluster of the parent strain *Pasteurella multocida* PmA-HG, screened candidate targets, constructed multiple deletion strains, and compared them using a virulence evaluation model. gatF The gene deletion strain resulted in a significant decrease in virulence. Finally, a multidrug-attenuated Pasteurella multocida strain was constructed using homologous recombination and its function was verified.

[0008] The attenuated strain was constructed as follows: using a temperature-sensitive plasmid as a vector, a strain containing... gatF Recombinant plasmids containing upstream and downstream homologous arms of the gene. The recombinant plasmid was introduced into wild-type Pasteurella multocida via electroporation. Under conditions of 28°C and kanamycin resistance, the first homologous recombination (single crossover) occurred, integrating the plasmid into the genome. Subsequent passages at 37°C without antibiotics induced a second homologous recombination (double crossover), thereby integrating the plasmid into the genome. gatF Precise deletion of the gene coding region and elimination of the plasmid sequence ultimately yields a marker-free antibody. gatF Gene deletion strain (Δ) gatF This method is highly efficient, accurate in knockout, and does not introduce exogenous resistance genes, thus exhibiting good biosafety.

[0009] The specific construction method is as follows: (1) Using Pasteurella multocida genomic DNA as a template, primer pairs were used to amplify and obtain gatFThe upstream and downstream homologous arm fragments of the gene; the upstream and downstream homologous arm fragments are ligated with the linearized temperature-sensitive plasmid pSHK5(Ts)-NgAgo using homologous recombinase to obtain a recombinant plasmid; (2) The recombinant plasmid is introduced into Pasteurella multocida to induce the first homologous recombination, so that the recombinant plasmid is integrated into the genome of the strain, and strains that have undergone the first homologous recombination are screened. (3) Under conditions where the selection pressure is removed, the strain obtained in step (2) is cultured, a second homologous recombination is induced, and the strain is screened to obtain the desired strain. gatF Strains that are gene-deleted and do not contain exogenous resistance genes.

[0010] Among them, used for amplification gatF The primer pair for the upstream homologous arm fragment of the gene is gatF -LF / LR, with sequences ATCGAATTCCTGCAGCCCGGAAGTGTTTTGCCATTAATACC (SEQ ID NO: 3) and GATATTTTTTACATTACAAATTAATTAAAGGGAT (SEQ ID NO: 4); used for amplification gatF The primer pair for the downstream homologous arm fragment of the gene is gatF -RF / RR, with sequences such as ATTTGTAATGTAAAAATATCTTTTTATTTGAGGGA (SEQ ID NO: 5) and CTCTAGAACTAGTGGATCCCAGTATGTTGATAAGCAGGATCA (SEQ ID NO: 6). In step (2), the recombinant plasmid is introduced into Pasteurella multocida by electroconversion.

[0011] In step (2), screening is carried out at 28°C and in the presence of kanamycin resistance to obtain strains that undergo the first homologous recombination.

[0012] In step (3), the culture is passaged at 37°C and without kanamycin resistance pressure to induce a second homologous recombination and eliminate the plasmid.

[0013] The gatF The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein is shown in SEQ ID NO: 2.

[0014] The strain is Pasteurella multocida Pm A-HG strain with preservation number CCTCC NO: M 2021805.

[0015] In the gene knockout method described in this invention, the core objective is to achieve the knockout of specific genes in the bacterial genome ( gatF Knockout is achieved using homologous recombination and temperature-sensitive plasmids, a classic and reliable strategy, but not the only option. Inspired by the concept of this invention, those skilled in the art will understand that other mature gene-editing technologies, such as the CRISPR-Cas system and the λ-Red recombination system, can also be used to achieve knockout. gatF Gene knockout.

[0016] The present invention further provides a vaccine comprising the components described above. gatF Gene knockout Pasteurella multocida strains were used as immunogens, as well as pharmaceutically acceptable adjuvants and / or vectors.

[0017] In a preferred embodiment, the vaccine is a live attenuated vaccine.

[0018] The present invention also provides, as described above gatF The use of gene-knockout Pasteurella multocida strains or vaccines as described above in the preparation of drugs for the prevention or treatment of bovine respiratory disease syndrome caused by Pasteurella multocida.

[0019] The beneficial effects of this invention are: Novel target, clear effect: This invention is the first to discover and demonstrate the knockout effect in L3 bovine Pasteurella multocida. gatF The gene can lead to a significant and safe reduction in the virulence of the strain. Compared with the wild-type parent strain (LD... 50 Compared to <10 CFU), the deletion strain Δ gatF LD 50 Up to 1.26×10 6 CFU has been reduced in toxicity by more than 100,000 times.

[0020] High security: the constructed Δ gatF The strain does not carry any exogenous resistance genes, meeting the biosafety requirements for vaccines. Its in vitro growth characteristics are indistinguishable from those of the wild-type strain, and it has remained genetically stable for 30 consecutive generations, ensuring its stability and safety as a vaccine candidate.

[0021] Strong immune protection: Δ gatF The strain, as a live attenuated vaccine, can induce a strong specific humoral immune response and provide up to 80% immune protection against virulent strains, which is superior to many attenuated strains reported in the prior art.

[0022] The construction method is precise and reliable: the method based on homologous recombination and temperature-sensitive plasmids achieves accurate and reliable construction. gatF The precise and scarless gene knockout method is stable and highly reproducible, laying the technological foundation for industrial production. Attached Figure Description

[0023] Figure 1 This is an identification diagram of the recombinant plasmid. In the diagram, M: DL2000; 1-2: identified single colonies; 3: ddH2O.

[0024] Figure 2 It is Δ gatF The identification diagram. In the diagram, M: DL5000; 1: Pm A-HG; 2: Δ gatF 3: ddH2O.

[0025] Figure 3 It is Δ gatF Results of genetic stability assessment of the strain. In the figure, M: DL5000; 1: Pm A-HG; 2-8: Δ generations 0, 5, 10, 15, 20, 25, and 30. gatF ;9: ddH2O.

[0026] Figure 4 This is the result of the growth curve measurement.

[0027] Figure 5 It is Δ gatF Analysis of bacterial load in mouse tissues after infection. *** p<0.001.

[0028] Figure 6 It is Δ gatF Analysis of pathological changes after infection in mice.

[0029] Figure 7 It is Δ gatF Serum antibody test results after immunization of mice. * p<0.05. Detailed Implementation

[0030] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or conditions described in reference books such as *Molecular Cloning: A Laboratory Guide*, or according to the methods recommended in the manufacturer's operating manual.

[0031] Key materials and their descriptions: Pm A-HG strain: Wild-type strain of Pasteurella multocida, isolated and identified by our laboratory from lung tissue of cattle suffering from bovine respiratory disease syndrome. It has been disclosed in the patent document CN 113801812 A “A strain of Pasteurella multocida and its application”, with accession number CCTCC NO:M 2021805.

[0032] pSHK5(Ts)- NgThe Ago plasmid was kindly provided by Professor Zhang Anding of Huazhong Agricultural University. Its application was first reported in the literature "Lei Fu, Cai-Yun Xie, Zehua Jin, et al. The prokaryotic Argonaute proteins enhance homology sequence-directed recombination in bacteria[J]. Nucleicacids research. 2019, 47 (7):3568-3579". It is a temperature-sensitive plasmid that can replicate at 28℃ but cannot replicate at 37℃.

[0033] Example 1: Pasteurella multocida gatF Construction of gene deletion strains The PCR primers used in the examples are shown in Table 1. Table 1: Primer Sequences

[0034] Construction of recombinant plasmids (1) Amplification of upstream and downstream homologous arms and plasmid vector: The genome of Pm A-HG was extracted using a bacterial genome extraction kit (DP302-02, purchased from Tiangen Biotech Co., Ltd.), and amplified using it as a template through two pairs of primers. gatF -LF / R and gatF -RF / R amplification gatF Upstream and downstream homologous arms of the gene; with pSHK5(Ts)- Ng Using the Ago plasmid as a template, PCR was performed using primers pN-F / R to linearize the plasmid. The reaction system and procedure for the above PCR are shown in Tables 2, 3, and 4.

[0035] Table 2: PCR reaction system

[0036] Table 3: PCR program for amplification of upstream and downstream homologous arms

[0037] Table 4: pSHK5(Ts)- Ng Ago plasmid linearization PCR procedure

[0038] After the amplification products were subjected to nucleic acid electrophoresis, the target fragment was excised and recovered by gel extraction reagent (D2500-01, purchased from OMEGA) to obtain a purified 656bp upstream homologous arm fragment, a 638bp downstream homologous arm fragment, and a 5429bp linearized plasmid. (2) Recombination of homologous arms and vector: The amplified fragments were subjected to agarose gel electrophoresis and then recovered using a gel recovery kit (D2500, purchased from OMEGA) to obtain three fragments. These three fragments were then ligated using a multi-fragment one-step cloning kit (C113-01, purchased from Vazyme). The system is shown in Table 5. The recombinant product was obtained after reacting at 37°C for 30 min.

[0039] Table 5: Reaction systems for one-step cloning

[0040] (3) Transformation of recombinant product: 10 μL of recombinant product was added to competent DH5αE.coli and placed on ice for 30 min; then heat-shocked in a 42℃ water bath for 45 s, and after the end, it was quickly placed on ice to cool for 2 min, 1 mL of LB liquid medium was added, and after recovery at 37℃ for 1 h, it was spread on LB agar plates containing kanamycin and placed in a 37℃ incubator to wait for single colonies to grow.

[0041] (4) Identification of recombinant plasmid transformants and extraction of plasmids: Single colonies were identified by PCR using pN44 primers. - MCS - F / R ( Figure 1 The products identified as positive were sequenced. After confirming the sequencing was accurate, the bacterial culture was expanded and cultured. The recombinant plasmid pSHK5(Ts)- was then extracted using a plasmid extraction kit (DP103-02, purchased from Tiangen Biotech Co., Ltd.). Ng Ago-LR- gatF .

[0042] 3. Construction of deletion strains (1) Electroporation of recombinant plasmid: 10 mL of Pm A-HG bacterial culture in the logarithmic phase was pre-cooled on ice for 30 min, centrifuged at 5000 r / min for 10 min at 4 °C, the supernatant was discarded, and the bacterial cells were washed twice with sterile pre-cooled 10% glycerol. The bacterial cells were then resuspended in 100 μL of sterile pre-cooled 10% glycerol, and 1 μg of recombinant plasmid was added. The mixture was transferred to a pre-cooled 2 mm electroporation cuvette, placed on ice for 10 min, and then the voltage was adjusted to 2.5 kV for one electroporation. After electroporation, 1 mL of TSB medium was quickly added to the bacterial culture, and the culture was restored at 28 °C for 2-3 h. Finally, the restored bacterial culture was spread on TSA plates containing kanamycin and incubated at 28 °C for 36-48 h until colonies grew.

[0043] (2) Screening and identification of deletion strains: Single colonies after electroporation were picked and placed in TSB medium containing kanamycin. After subculturing 2-3 times in a shaker at 28°C, they were spread on TSA plates containing kanamycin and cultured at 28°C until single colonies grew. The deletion strains were then identified using primers ExLR- gatF-F / R identification was performed. Once homologous recombination bands appeared, single colonies were transferred to antibiotic-free TSB medium and incubated at 37°C for 12 hours in a shaker as one generation. This was repeated for 3-5 generations to eliminate plasmids. The bacterial culture from the 37°C subculture was diluted to an appropriate gradient and spread onto antibiotic-free TSA plates. After incubation at 37°C until single colonies grew, single colonies were picked and dipped onto agar medium containing kanamycin and antibiotic-free medium, respectively. After incubation at 37°C, single colonies that grew on antibiotic-free plates but not on kanamycin-containing plates were selected for further identification using the ExLR- primers. gatF -F / R was used for PCR verification ( Figure 2 After PCR validation, sequencing analysis was performed to determine... gatF Gene deletion was successful. The successfully constructed deletion strain was continuously passaged at 37℃ for 30 generations, and samples were taken every 5 generations for PCR identification to determine the genetic stability of the deletion strain. Figure 3 ).

[0044] (3) Growth characteristics of the deletion strain: Pm A-HG and Δ gatF The bacterial strains were streaked onto TSA plates and incubated overnight at 37°C. Single colonies were then picked and inoculated into TSB medium, and incubated for 12 hours at 37°C in a shaker. The OD values ​​of both strains were then measured using TSB medium. 600 After adjustment to ensure consistency, the bacterial culture was transferred to new TSB medium at a ratio of 1%, and the bacterial culture was taken out every 2 hours for OD analysis. 600 The test was conducted, with continuous sampling for 20 hours. A growth curve was plotted based on the results, which showed that Δ... gatF Consistent with the growth of Pm A-HG strain ( Figure 4 ).

[0045] Example 2: Determination of the pathogenicity of the deletion strain 1. Tissue bacterial load determination and pathological change analysis Fifteen female BALB / c mice were randomly divided into three groups of five each. Groups 1 and 2 were injected intraperitoneally with 10 mg of ... 3 CFU Pm A-HG bacterial suspension and 10 3 CFU's Δ gatF Mice were challenged with bacterial culture medium, with the third group receiving an equal volume of TSB medium as a control. The mice were observed for 12 hours after challenge, and then euthanized. Lungs, livers, and spleens were dissected, and 0.1g of each was homogenized, diluted, and spread onto TSA plates. After 12-16 hours of incubation, bacterial counts were performed, and the bacterial load in each tissue was calculated. Results showed that the Pm A-HG challenge group had high bacterial loads in the lungs, liver, and spleen, all exceeding 10-1. 10 CFU / g or higher, while at the same challenge dose, Δ gatFThe bacteria were undetectable in the challenge group, and their virulence was significantly reduced. Figure 5 ).

[0046] Simultaneously, lung tissue from each group was fixed in 0.4% paraformaldehyde, and tissue sections were prepared. After HE staining, pathological changes were observed. Results showed that the Pm A-HG strain challenge group exhibited extensive congestion and edema, and histopathological analysis revealed significant alveolar wall thickening and congestion, accompanied by inflammatory cell infiltration; while Δ gatF The group challenged with the strain showed only mild lesions, with a small number of alveolar walls showing slight thickening. Figure 6 ).

[0047] 2. LD 50 Measurement To determine Δ gatF The decrease in toxicity level, and its LD 50 The assay was performed by randomly dividing 30 female BALB / c mice into 6 groups of 5 mice each: one Pm A-HG challenge group and four Δ gatF The study included an infection challenge group and a control group. The infection dose of the PmA-HG strain was 10 CFU / 0.2 mL / animal, Δ... gatF The challenge doses were 10 4 10 5 10 6 10 7 Mice were injected with CFU / 0.2 mL / mouse. The control group was injected with TSB culture medium (containing 5% newborn calf serum). Mice in each group were infected by intraperitoneal injection. The mice were observed for 7 consecutive days, and the mortality of mice in each group was recorded.

[0048] The results showed that when Pm A-HG was administered at an infectious dose of 10 CFU / mouse, all 5 mice died after challenge. gatF At an infection dose of 10 4 CFU / only 10 5 At a CFU / mouse dose, no mice died, and at an infectious dose of 10... 6 CFU / only 10 7 At CFU / bird, the mortality rates were 40% and 100% respectively, and the LD can be calculated. 50 1.26×10 6 CFU (Table 6). The above results indicate that Δ gatF The toxicity was significantly lower than that of Pm A-HG.

[0049] Table 6: Δ gatF LD 50 Measurement

[0050] Example 3: Preparation and efficacy evaluation of attenuated live vaccine 1. Vaccine preparation and immunization Δ gatF The strain was diluted with PBS to prepare a live attenuated vaccine, which was then formulated into 5×10⁻⁶ doses. 3 5×10 4 and 5×10 5 CFU / mL bacterial suspension. The experiment included three immunization dose groups (low, medium, and high) and a challenge control group, with five BALB / c mice in each group. The immunization groups received 0.2 mL of vaccine subcutaneously per mouse, corresponding to a dose of 1×10⁻⁶ CFU / mL. 3 1×10 4 and 1×10 5 CFU / mouse; mice in the challenge control group were subcutaneously inoculated with an equal volume of PBS. A booster immunization was administered on day 14 following the initial immunization, using the same dose and method.

[0051] 2. Detection of serum IgG antibodies Serum samples were collected from mice in each group before immunization, 14 days after the first immunization, and 14 days after the booster immunization. Serum IgG antibody levels were detected using an indirect ELISA method. This method used PmA-HG whole bacterial protein as the coating antigen, the test serum as the primary antibody, and horseradish peroxidase-labeled goat anti-mouse IgG as the secondary antibody. Results showed a positive correlation between immunization dose and antibody response. 14 days after the first immunization, antibody levels began to rise in the medium- and high-dose groups. 14 days after the booster immunization, the average antibody titer in the low-dose group was 3360, with no difference compared to the control group; the average antibody titer in the medium-dose group increased to 23040, and the average antibody titer in the high-dose group reached 66560, both significantly higher than the control group. Figure 7 The above results indicate that 1×10 5 CFU / only Δ gatF Immunization doses can induce a better humoral immune response.

[0052] 3. Immune protection efficiency To evaluate Δ gatF The immunoprotective efficacy of different doses of the strain was investigated. All mice were challenged intraperitoneally 14 days after booster immunization with Pm A-HG strain at a dose of 100 CFU / mouse. Immunoprotection rates were recorded and observed for 14 days. Results showed a significant increasing trend in protection rate with increasing immunization dose: the low-dose group (1×10⁻⁶ CFU / mouse) showed a significantly higher protection rate. 3 CFU / vial) showed no protection, while the medium-dose group (1×10) showed no protection. 4 The protection rate of CFU / animal was 20%, and the high-dose group (1×10) had a protection rate of 20%. 5 The protection rate of CFU / animal reached 80% (Table 7).

[0053] Table 7: Δ gatFimmune protection rate

[0054] In summary, Δ gatF Strain immunization showed a significant dose-dependent protective effect in mouse models, with the high-dose group (1×10⁻⁶) exhibiting the highest protective effect. 5 The CFU / animal showed a protection rate of up to 80% against Pm-HG challenge, indicating that this strain has the potential to be a candidate vaccine strain.

[0055] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

[0056] Appendix 1: Explanation of Relevant Terms gatF Gene: A specific gene involved in this invention encodes a glycosyltransferase responsible for catalyzing the linking of specific sugar molecules (galactose and glucose) in the biosynthesis of L3-type LPS. Knocking out this gene disrupts the normal structure of LPS, resulting in loss of bacterial virulence.

[0057] Glycosyltransferases are a class of enzymes that catalyze the transfer of glycosyl groups from donor molecules to acceptor molecules (such as proteins, lipids, or other sugar molecules). In this invention, gatF The protein encoded by the gene belongs to this type of enzyme, and its function is a key step in the construction of LPS glycans.

[0058] Homologous recombination: a natural repair process based on DNA sequence homology. In genetic engineering, this principle is used to introduce a segment of foreign DNA (containing a sequence homologous to a genomic target site) into a cell, allowing it to exchange with the genome, thereby achieving targeted gene modification.

[0059] Homology Arm: In gene targeting vectors, two DNA sequences homologous to the sequences flanking the genomic target site act like "navigation arms," ​​guiding foreign DNA to undergo homologous recombination at the correct genomic site. This invention designs... gatF The upstream and downstream homologous arms of a gene are key design elements for successful gene knockout.

[0060] Temperature-sensitive plasmids are plasmids whose replication is temperature-controlled. They typically replicate at lower temperatures (e.g., 28°C) but not at higher temperatures (e.g., 37°C). This invention utilizes this characteristic to screen strains that have integrated the plasmid at 28°C, and then passage them at 37°C to eliminate unintegrated plasmids, ultimately obtaining a knockout strain without plasmid residue.

[0061] Electroporation: A technique that uses high-voltage electrical pulses to create transient micropores in the cell membrane, thereby introducing exogenous DNA molecules into the cell. In this invention, it is a method for introducing recombinant plasmids into competent Pasteurella multocida cells.

[0062] LD 50 (Median Lethal Dose): The dose of a pathogen that can cause death in half of the experimental animals within a specific time period; it is the gold standard for measuring pathogen virulence. 50 The higher the value, the weaker the toxicity.

[0063] IgG antibodies: The most abundant type of immunoglobulin in serum, they are the main effector molecules of humoral immune response, providing systemic immune protection. In this invention, the level of IgG in mouse serum is detected by ELISA to quantify the strength of humoral immunity stimulated by the ΔgatF vaccine.

[0064] Appendix 2: Explanation of the sequence list SEQ ID NO: 1: gatF The nucleotide sequence of a gene; SEQ ID NO: 2: gatF The amino acid sequence of the protein encoded by the gene; SEQ ID NO: 3: Used for amplification gatF Forward primer sequence for upstream homologous arm fragment of gene; SEQ ID NO: 4: Used for amplification gatF Reverse primer sequence for the upstream homologous arm segment of the gene; SEQ ID NO: 5: Used for amplification gatF Forward primer sequence for the downstream homologous arm fragment of the gene; SEQ ID NO: 6: Used for amplification gatF Reverse primer sequence for the downstream homologous arm fragment of the gene; SEQ ID NO: 7: Forward primer sequence for linearizing pSHK5(TS)-NgAgo plasmid; SEQ ID NO: 8: Reverse primer sequence for linearizing the pSHK5(TS)-NgAgo plasmid; SEQ ID NO: 9: Recombinant plasmid pSHK5(Ts) NgAgo-LR- gatF PCR identification of forward primer sequences; SEQ ID NO: 10: Recombinant plasmid pSHK5(Ts) NgAgo-LR- gatF PCR identification of reverse primer sequences; SEQ ID NO: 11: gatF Gene deletion strains (Δ gatF PCR identification of forward primer sequences; SEQ ID NO: 12: gatF Gene deletion strains (Δ gatF PCR identification of reverse primer sequences.

Claims

1. A strain of Pasteurella multocida ( Pasteurella multocida The strain is characterized by: The strain gatF The knockout or inactivation of genes leads to attenuation of virulence. gatF The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein is shown in SEQ ID NO:

2.

2. The strain according to claim 1, characterized in that: The strain is Pasteurella multocida Pm A-HG strain with preservation number CCTCC NO: M 2021805.

3. A method for constructing the strain of claim 1 or 2, characterized in that... Includes the following steps: (1) Using Pasteurella multocida genomic DNA as a template, primer pairs were used to amplify and obtain gatF The upstream and downstream homologous arm fragments of the gene; the upstream and downstream homologous arm fragments are ligated with the linearized temperature-sensitive plasmid pSHK5(Ts)-NgAgo using homologous recombinase to obtain a recombinant plasmid; (2) The recombinant plasmid is introduced into Pasteurella multocida to induce the first homologous recombination, so that the recombinant plasmid is integrated into the genome of the strain, and strains that have undergone the first homologous recombination are screened. (3) Under conditions where the selection pressure is removed, the strain obtained in step (2) is cultured, a second homologous recombination is induced, and the strain is screened to obtain the desired strain. gatF Strains that are gene-deleted and do not contain exogenous resistance genes.

4. The construction method as described in claim 3, characterized in that, For amplification gatF The primer pair for the upstream homologous arm fragment of the gene is gatF -LF / LR, whose sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4; used for amplification gatF The primer pair for the downstream homologous arm fragment of the gene is gatF -RF / RR, whose sequences are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

5. The construction method as described in claim 3, characterized in that, In step (2), the recombinant plasmid is introduced into Pasteurella multocida by electroconversion.

6. The construction method as described in claim 3, characterized in that, In step (2), screening is carried out at 28°C and in the presence of kanamycin resistance to obtain strains that undergo the first homologous recombination.

7. The construction method as described in claim 3, characterized in that, In step (3), the culture was passaged at 37°C and without kanamycin resistance pressure to induce a second homologous recombination and eliminate the plasmid.

8. A vaccine, characterized in that, The vaccine comprises the strain described in claim 1 or 2 as an immunogen, and a pharmaceutically acceptable carrier.

9. The vaccine as described in claim 8, characterized in that, The vaccine in question is a live attenuated vaccine.

10. The use of the strain of claim 1 or 2 or the vaccine of claim 8 or 9 in the preparation of a medicament for the prevention or treatment of bovine respiratory disease syndrome caused by Pasteurella multocida.

Images