Apple laccase LAC6 gene and application of apple laccase LAC6 gene in improving apple lanigera lanigera resistance of apples

By overexpressing the apple laccase LAC6 gene in apple plants to enhance lignin synthesis, the problems of chemical control resistance and low success rate of biological control were solved, achieving effective control of the apple woolly aphid and providing a sustainable breeding program.

CN121379999APending Publication Date: 2026-01-23QINGDAO AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511494905.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

Existing chemical control methods for apple woolly aphids have led to increased resistance and excessive pesticide residues. Biological control has a low success rate and high agricultural control costs, and there is a lack of sustainable strategies for controlling apple woolly aphids.

Method used

By cloning the apple laccase LAC6 gene, an overexpression vector pBI121-CutGUS-LAC6 was constructed and transformed into apple plants to increase the expression level of apple laccase LAC6, enhance lignin synthesis in apples, and improve resistance to the woolly aphid.

Benefits of technology

It improved the resistance of apples to the woolly apple aphid, reduced the aphid feeding time and survival rate, enhanced the growth capacity of apples, and provided a theoretical basis for sustainable aphid-resistant breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121379999A_ABST
    Figure CN121379999A_ABST
Patent Text Reader

Abstract

The invention provides an apple laccase LAC6 gene and application of the apple laccase LAC6 gene in improving apple lanigera lanigera resistance of apples, the coding amino acid sequence of the apple laccase LAC6 gene is SEQ ID NO: 1, and the nucleotide sequence of the apple laccase LAC6 gene is SEQ ID NO: 2. Apples are used as materials, LAC6 genes are obtained through cloning, an overexpression vector pBI121-CutGUS-LAC6 is constructed on the basis and transferred into the apples to obtain transgenic plants, the transgenic plants are screened to obtain plants capable of stably inheriting and transferring genes, phenotype observation and biological index determination are carried out on the plants, and gene function identification results show that compared with non-transgenic plants, the LAC6 genes have the advantages that the transgenic plants are more stable in genetic transformation; the transgenic apple plant has the function of resisting the eriosoma lanigerum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of functional gene screening and application technology, specifically relating to an apple laccase LAC6 gene and its application in improving apple resistance to the apple aphid. Background Technology

[0002] Apples are one of the most economically valuable fruit crops in temperate regions worldwide. The woolly apple aphid is a major pest of apple trees, primarily damaging the branches and roots. It sucks sap from the branches, causing the bark to swell and form tumors. This damages the nutrient transport organs of the branches, hindering the transport of substances within the tree. When the roots are attacked, dense tumors form, reducing or even eliminating the ability to grow new roots. In severe cases, the roots rot, reducing the tree's ability to absorb water and minerals. The roots struggle to synthesize organic nutrients, leading to weakened tree vigor and, in severe cases, tree death.

[0003] Control strategies for the woolly apple aphid mainly focus on three major methods: agricultural, biological, and chemical. Agricultural control includes physical methods such as scraping off galls and whitewashing tree trunks; however, these methods are not only labor-intensive but also difficult to completely eradicate the pest. Biological control primarily involves introducing the dominant natural enemy, the solar wasp, but the colonization success rate of this natural enemy is limited by climatic conditions and ecosystem stability. Chemical control, due to its high efficiency and convenience, has become the most widely used method. However, over time, the drawbacks of long-term, large-scale application of these chemical agents have gradually become apparent. On the one hand, under continuous selective pressure from pesticides, the woolly apple aphid population is developing increasing resistance, forcing increased dosage and frequency of pesticide application during control. On the other hand, excessive use of chemical agents inevitably leads to the risk of pesticide residue exceeding standards, which not only threatens the quality and safety of fruit but also has potential negative impacts on the ecological environment. Therefore, alternative aphid control methods to replace chemical control urgently need to be developed.

[0004] Plant insect-resistant breeding and enhancing plants' own resistance to pests are sustainable development strategies for controlling agricultural pests. Identifying the insect-resistant characteristics of plants and discovering their insect-resistant genes are key issues in insect-resistant breeding. Developing insect-resistant genes and elucidating their functional mechanisms will provide important theoretical support for crop insect-resistant breeding, and utilizing the inherent insect resistance of apples can sustainably control orchard pests. Summary of the Invention

[0005] The purpose of this invention is to provide an apple laccase LAC6 gene and its application in improving apple resistance to the woolly apple aphid, thereby overcoming the shortcomings of the prior art.

[0006] This invention first provides an apple laccase LAC6 gene, which encodes a protease with the amino acid sequence SEQ ID NO:1; ; As a specific example, the apple laccase LAC6 gene is described in one embodiment. The specific nucleotide sequence is as follows:

[0007] In another aspect, the present invention provides a plant expression vector carrying a nucleic acid fragment of the apple laccase LAC6 gene.

[0008] The present invention also provides a recombinant Agrobacterium, wherein the recombinant Agrobacterium carries the above-mentioned plant expression vector; The present invention also provides an application of the apple laccase LAC6 gene, namely, its application in increasing the biosynthesis of lignin in apples; In another aspect, the present invention provides a method for improving the resistance of apples to the woolly apple aphid, wherein the method is to increase the expression level of the apple laccase LAC6 gene in apple plants. The present invention also provides a method for screening apple plants with better resistance to the woolly apple aphid, which is to screen by screening the expression level of the apple laccase LAC6 gene.

[0009] This invention uses apple as material, clones the LAC6 gene, constructs an overexpression vector pBI121-CutGUS-LAC6 based on this gene, transforms it into apples to obtain transgenic plants, and screens plants that can stably inherit the transformed gene for phenotypic observation and biological index determination. The gene function identification results show that, compared with non-transgenic plants, transgenic apple plants have the function of resisting apple aphids. Attached Figure Description

[0010] Figure 1 This is a graph showing the electrophoresis gel image of the MdLac6 gene clone in this invention; Figure 2 This is a diagram of the MdLac6 nucleic acid sequence in this invention; Figure 3 This is a graph showing the expression level of MdLac6 in the transgenic apple plants of this invention. Figure 4 This is a graph showing the duration of the EPG waveform during the 8-hour feeding period of the woolly apple aphid on an apple in this invention. Figure 5 This is a comparative diagram showing the survival status of the woolly apple aphid on apples in this invention; Figure 6 This is a comparison chart of the average aphid production of the woolly apple aphid on apples in this invention; Figure 7 This is a diagram showing the laccase activity of apple leaves in this invention; Figure 8 This is a diagram showing the total lignin content of apple leaves in this invention; Figure 9 Photos showing the growth of control group and Lac6 gene-transgenic apples in January. Detailed Implementation

[0011] This invention discovers that the apple laccase LAC6 gene can enhance apple resistance to the woolly apple aphid. After cloning the apple laccase LAC6 gene and clarifying its nucleic acid sequence and protein structure, primers were designed to construct its overexpression vector and interference vector. These vectors were then transferred into apple plants via tissue culture and Agrobacterium-mediated transformation, resulting in transgenic plants. Aphid feeding behavior was observed using EPG technology, and the aphid resistance function was investigated by inoculating the plants with the woolly apple aphid. Compared to the wild type, the transgenic plants exhibited enhanced laccase activity and increased lignin, demonstrating excellent resistance to the woolly apple aphid and providing a theoretical basis for molecular improvement breeding of apples with aphid resistance.

[0012] The present invention will be further described below with reference to specific embodiments. In the following embodiments, operations not described in detail are routine biological experimental procedures, which can be performed with reference to molecular biology experimental manuals and existing publicly available journal articles, or according to kit and product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0013] The plant material used in this embodiment of the invention is apple ( Malus domestica Its cultivation conditions are 25℃ and 16h light exposure.

[0014] The vector used in this invention is pBI121, which was purchased from Shandong Miaoling Plasmid Platform; The Escherichia coli strain used in this invention is DH5α, which was purchased from Novizan Biotechnology Co., Ltd. The Agrobacterium used in this invention is EHA105, which was purchased from Angyu Biotechnology Co., Ltd. Example 1: Cloning of the apple laccase LAC6 gene 1. Primer design The LAC6 gene sequence was screened by BLAST comparison in the NCBI database. Primers were designed using Primer Premier 5 software. The primer sequences are as follows: LAC6-F: atgggcaactgtaacaacat, LAC6-R: ttaagacttggaacaaggag.

[0015] 2. Gene cloning and target fragment recovery ①Total RNA was extracted from the branches of New Red Star apple using the FastPure Universal Plant Total RNA Isolation Kit (Novizan). The specific method is described in the instruction manual.

[0016] ② Prepare the reverse transcription reaction solution 1: Total RNA 1 μg, StarScript Pro All-in-one RT Mix 1 μL, 5×StarScript Pro All-in-one RT Buffer 4 μL, and Nuclease-free Water to a final volume of 20 μL. Perform the reverse transcription reaction using a PCR instrument. The reaction program is as follows: 37℃ for 2 min; 50℃ for 15 min; 85℃ for 2 min; store at -20℃.

[0017] ③ Using cDNA synthesized by reverse transcription as a template, gene cloning was performed using the P525 high-fidelity enzyme.

[0018] The PCR reaction system consisted of: 2 μL cDNA, 2 μL Primer-F (10 μM), 2 μL Primer-R (10 μM), 25 μL 2×Phanta Max Master Mix, and 31 μL ddH2O, for a total volume of 50 μL.

[0019] The PCR reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 2 min, for a total of 35 cycles; 72℃ for 5 min; and stored at -20℃.

[0020] After the reaction was completed, the amplification products were separated by electrophoresis using a 1% agarose gel; the correctly sized bands were cut off and purified.

[0021] The nucleotide sequence of the CDS region of the amplified apple laccase LAC6 gene is identified as SEQ ID NO:2, and the amino acid sequence of the protein it encodes is SEQ ID NO:1.

[0022] Example 2: Construction of expression vectors and transformation of Escherichia coli and Agrobacterium tumefaciens 1. Constructing expression carriers Homologous recombination primers were designed using the Novizan single-fragment cloning website. The primer sequences are as follows: PBI121-LAC6-F: gagaacacgggggactctagaATGGGCAACTGTAACAACATGGA; PBI121-LAC6-R: cgatcggggaaattcgagctcTTAAGACTTGGAACAAGGAGGCA.

[0023] The plant expression vector PBI121 used in this invention was purchased from the Shandong Miaoling Plasmid Platform. Glycerol-containing bacteria (Kan resistant) were cultured and the plasmid was extracted using a plasmid purification kit (Tiangen).

[0024] The PBI121 vector was double-digested with the rapid digestive enzymes XbaI and SacI according to the instructions to remove the Gus region. After gel electrophoresis, the PBI121 vector (without GUS) was recovered and purified using a gel extraction kit. The target gene was constructed into the pBI121 vector using the Novitane Original Recombinant Kit to obtain the recombinant plant expression vector pBI121-Lac.

[0025] The recombination reaction system is as follows: linearized vector X μL, insert fragment Y μL, 5×CEII Buffer 4 μL, Exnase II 2 μL, and ddH2O added to a total volume of 20 μL. The volumes of the linearized vector and the target fragment depend on their plasmid concentrations. The reaction program is: 37℃ for 0.5 h.

[0026] 2. Escherichia coli transformation The reaction product was transformed into competent E. coli cells, plated on LB agar containing Kans, and incubated overnight at 37°C. Single colonies were picked from the plate for propagation and subjected to colony PCR and gel electrophoresis. Colonies with the correct bands were sent to the company for sequencing. The optimal strain was preserved based on the sequencing results and subsequently transformed into Agrobacterium.

[0027] 3. Agrobacterium-mediated transformation Take 1 μg of the plasmid to be transformed, add 100 μl of EHA105 Agrobacterium competent cells, mix well, and then incubate sequentially on ice for 5 min, followed by liquid nitrogen flash freezing for 5 min, heat shock at 28℃ for 5 min, and rapid ice bath for 5 min. Add 700 μL of LB liquid medium, shake at 200 rpm for 3 h at 28℃, then spread on plates and incubate at 28℃ for 48 h. On the third day, select single clones for colony PCR detection. Store the correct bacteria at -80℃ using glycerol.

[0028] Example 3: Apple tissue culture seedling culture, Agrobacterium-mediated transformation into apples, screening and identification of transgenic apples. 1. Cultivation of apple tissue culture seedlings Sterile apple seedlings were inoculated into MS propagation medium and cultured at 25°C under light for 8 weeks. Leaves from the tissue culture seedlings were used for transformation experiments.

[0029] 2. Agrobacterium-mediated transformation into apple 2.1 Activation of Agrobacterium Take the verified Agrobacterium and inoculate it into YEB liquid medium (Rif 100 mg / L, Kan 50 mg / L) to activate Agrobacterium. Mix the activated and saturated bacterial solution with fresh YEP liquid medium containing antibiotics at a ratio of 1:50, and incubate with shaking until the OD600 reaches 0.4-0.6. Collect the bacterial cells by centrifugation at 25°C and 5000 rpm for 5 minutes. Resuspend the bacterial cells in MS liquid medium containing 15 g / L sucrose and 5 g / L glucose until the OD600 reaches 0.5 (the resuspended bacterial cells should be used within one hour).

[0030] 2.2 Agrobacterium-mediated apple transformation Select tender young leaves from the top of apple tissue culture seedlings that have been subcultured for about 50 days, make 2-3 wounds perpendicular to the leaf veins, and pre-culture them in MS medium for 3 days. Infect the pre-cultured apple leaves with Agrobacterium tumefaciens solution, and then transfer them to the pre-culture medium for co-culture at 23-25℃. After 3 days, wash the leaves twice in liquid medium. Then, delay and select culture in solid regeneration medium until callus tissue appears. Culture under light, and after small buds grow, transfer them to solid proliferation medium for selection. Finally, transfer them to rooting medium, and after rooting, transfer them to nutrient soil for culture.

[0031] 3. Identification of transgenic apple tissue culture seedlings Leaves from both genetically modified and conventional apple plants were collected, and apple plant DNA was extracted using the FastPurePlant DNA Isolation Mini Kit from Novizan Biotechnology Co., Ltd., following the instructions for use, to identify DNA at the anatomical level.

[0032] PCR detection was performed using an upstream primer (35S-F: gacgcacaatcccactatcc) and a downstream primer (LAC6-R: TTCGTCACCTGTAGCGAGAGCC). The PCR reaction mixture consisted of 1 μL template, 12.5 μL 2xTaq Plus Master Mix II, 1 μL 35S-F (10 μM), 1 μL LAC6-R (10 μM), and 9.5 μL ddH2O, for a total volume of 25 μL. The PCR program was as follows: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 20 s, 72℃ for 3 min, for a total of 35 cycles; 72℃ for 10 min; and storage at 4℃. Finally, 1% agarose gel electrophoresis was performed for detection.

[0033] RNA was extracted from tobacco plants using the FastPure Universal Plant Total RNA Isolation Kit from Novizan Biosciences Co., Ltd., following the manufacturer's instructions. RNA level identification was performed. Quantitative PCR was performed using the q-Lac6 upstream primer (q-Lac6–F: caccctcacagtcgtagc) and the q-Lac6 downstream primer (q-Lac6-R: ggaggttggtttgcggtca). The quantitative reaction mixture consisted of 1 μL of sample, 5 μL of 2xRealStar FastSYBR qPCR Mix, 0.25 μL of q-Lac6-F (10 μM), 0.25 μL of q-Lac3-6 (10 μM), and 3.5 μL of ddH2O, for a total volume of 10 μL. The qPCR reaction program was as follows: 95℃ for 30s; 95℃ for 5s, 60℃ for 30s, for a total of 39 cycles; Melt Curve 65℃ to 95℃, increment 0.5℃, 5s. Based on the data processing results, plants with high expression levels were selected for subsequent experiments to determine resistance to the woolly apple aphid.

[0034] Example 4: Verification of the resistance of transgenic apples to the woolly apple aphid 1. EPG analysis of feeding behavior of the woolly apple aphid To observe the feeding behavior of the woolly apple aphid on different apple varieties, adult aphids were used in EPG experiments on two different apple species. Before the experiment, individual aphids were examined under a microscope to ensure their mouthparts were undamaged. The probing potential spectrum of the insects was recorded using a Giga-8dd DC-EPG system (input resistance: 1 GΩ, digital-to-analog converter: 100 Hz / 14-bit resolution). To shield against electromagnetic interference from the external environment, the feeding experiments were conducted in Faraday cages (80 cm × 60 cm × 100 cm). The test insects were placed on an ice box, and then a 18 μm diameter, 3-4 cm long gold wire was attached to the pronotum of the insects using conductive silver glue. The other end of the gold wire was attached to a copper wire end (the copper wire and the copper nail were soldered together). The attached insects were starved for 1 hour, and then the aphids were placed on the underside of tobacco leaves at the same location on different plants. When an aphid's stylet pierces plant tissue, the circuit closes and amplifies the signal, converting it into a digital signal. This signal is then amplified by the Giga-8d control unit and stored in a computer. The digital signal is converted into a waveform and displayed on the screen using Stylet+d software, which also interprets the waveform and converts it into a digital file usable for pattern recognition. Data for each insect experiment was recorded 15 times, with each recording lasting 6 hours. Insects that did not exhibit feeding waves or showed no waveform within the 6-hour recording period were not recorded. After recording, Stylet+a software was used to classify the aphid's EPG waveform according to Tjallingii's criteria into non-probing waves (np), path waves (C), non-active intracellular feeding waves (pd), xylem feeding waves (G), phloem salivary secretion waves (E1), and phloem feeding waves (E2).

[0035] The EPG of the woolly apple aphid feeding on different apple seedlings was compared, and the experimental data were analyzed using SPSS 25.0 software through an independent samples t-test.

[0036] From the perspective of the non-phloem stage of the woolly aphid feeding on apple plants, the time of the first probing, the number of probing, and the number of pd waves (stylet piercing the cell membrane) were significantly higher in transgenic plants than in ordinary plants, while the total time of np waves (non-probing waves), C waves (path waves), and G waves (active water absorption by xylem) did not differ significantly (Table 1).

[0037] Table 1: Comparison of EPG indices from feeding on the non-phloem of different apple plants by the woolly aphid.

[0038] When the woolly aphid feeds in the phloem stage of apple plants, the total time of the E2 (feeding) wave and the number of E1 and E2 waves are significantly lower in transgenic plants than in ordinary plants, while the total time of the E1 (saliva secretion) wave is higher than in ordinary plants, but the difference is not significant. The time taken for the woolly aphid to first reach the phloem and the time taken for the first appearance of the E2 wave are significantly higher in transgenic plants than in ordinary plants (Table 2).

[0039] Table 2: Comparison of EPG indices from feeding on the phloem of different apple plants by the woolly apple aphid.

[0040] In the EPG waveform, the E waveform is divided into E1 and E2 waveforms. The E1 waveform indicates that the aphid's stylet is secreting saliva, preparing to feed; the E2 waveform indicates that the aphid is feeding. Based on the waveform analysis, the following conclusions can be drawn.

[0041] When the woolly apple aphid feeds on common apples, wave G accounts for 1.83% of the total time, wave E1 (saliva secretion in the phloem) accounts for 20.28%, wave E2 (feeding in the phloem) accounts for 3.18%, wave pd accounts for 12.71%, wave C accounts for 57.96%, and wave np accounts for 4.01% (e.g., ...). Figure 4 ).

[0042] When the woolly aphid feeds on genetically modified apples, wave G accounts for 1.79% of the total feeding time. Wave E1 (saliva secretion in the phloem) accounts for 4.98% of the total feeding time, and wave E2 (feeding in the phloem) accounts for 1.25% of the total feeding time, indicating that the aphid's effective feeding time on genetically modified apples is shorter than that on ordinary apples. Wave pd accounts for 16.27% of the total feeding time, wave C accounts for 73.45% of the total feeding time, and wave np accounts for 2.22% of the total feeding time, indicating that the aphid spends more time on the genetically modified apple to find suitable feeding sites (such as...). Figure 4 ).

[0043] 2. Inoculate with the woolly apple aphid to determine its aphid resistance function. Five control seedlings and five transgenic seedlings from the same batch that had successfully hardened off for one month were selected. Ten adult apple woolly aphids were inoculated on their stems. The surviving aphids and newly produced aphids were observed daily. The observation period for the entire experiment was 7 days.

[0044] The survival rate of the woolly apple aphid on genetically modified and conventional apples is shown in the following data. Figure 5 As shown, the survival rate of aphids on transgenic plants is significantly lower than that on ordinary tobacco.

[0045] 3. Determination of laccase activity and total lignin content in transgenic apple leaves The laccase activity and total lignin content of different apple leaves were determined using a laccase detection kit from Hefei Lier Biotechnology Co., Ltd. and a lignin content assay kit from Gress. Laccase decomposes the substrate ABTS to produce ABTS free radicals, whose absorbance at 420 nm is much higher than that of the substrate ABTS. The laccase activity can be calculated by measuring the rate of increase of ABTS free radicals. The acetylation method was used to acetylate the phenolic hydroxyl groups in lignin, resulting in a characteristic absorption peak at 280 nm. The absorbance at 280 nm is positively correlated with lignin content.

[0046] Apple leaves from the same location and at the same growth stage were selected for sample preparation. The samples were then analyzed using a microcomputer. Data processing and calculation results are as follows: Figure 7 , 8 As shown, the average laccase activity of common apples was approximately 5.12 nmol / min / g, while that of LAC6 gene-transgenic plants was approximately 19.35 nmol / min / g. The laccase activity increased by approximately 2.78 times. The average lignin content of common apples was approximately 67.88 mg / g, while that of LAC6 gene-transgenic plants was approximately 124.46 mg / g. The lignin content of the transgenic plants increased by approximately 0.83 times compared to the wild type. These results indicate that overexpression of the LAC6 gene promotes lignin biosynthesis.

[0047] In summary, the present invention also provides that the apple laccase LAC6 gene can increase the biosynthesis of lignin in apples and can improve the resistance of apples to the woolly aphid.

Claims

1. An apple laccase LAC6 gene, characterized in that, The LAC6 gene encodes a protease with the amino acid sequence SEQ ID NO:

1.

2. The apple laccase LAC6 gene as described in claim 1, characterized in that, The nucleotide sequence of the apple laccase LAC6 gene is SEQ ID NO:

2.

3. A plant recombinant expression vector, characterized in that, The recombinant expression vector carries a nucleic acid fragment of the apple laccase LAC6 gene as described in claim 1.

4. A recombinant Agrobacterium, characterized in that, The recombinant Agrobacterium carries the plant recombinant expression vector of claim 3.

5. The application of the apple laccase LAC6 gene as described in claim 1 in increasing the biosynthesis of lignin in apples.

6. The use of the apple laccase LAC6 gene of claim 1 in the preparation of products for improving the resistance of apples to the apple aphid.

7. A method for improving the resistance of apples to the woolly apple aphid, characterized in that, The method described herein is to increase the expression level of the apple laccase LAC6 gene as described in claim 1 in apple plants.

8. The method as described in claim 7, characterized in that, The method uses the recombinant Agrobacterium as described in claim 4 to increase the expression level of the apple laccase LAC6 gene as described in claim 1 in apples.

9. A method for screening apple plants with better resistance to the woolly apple aphid, characterized in that, The method involves screening based on the expression level of the apple laccase LAC6 gene as described in claim 1.