Agents that inhibit wls / fzd3 in combination and uses thereof

By jointly inhibiting the expression of WLS and FZD3 and preparing drugs using shRNA, the treatment challenge of colorectal cancer liver metastasis has been solved. The drugs significantly inhibit tumor metastasis and prolong survival time, providing a new strategy for treating colorectal cancer liver metastasis.

CN121380076BActive Publication Date: 2026-03-27NANJING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Currently, there is a lack of effective molecular regulatory networks and mechanisms in the treatment of colorectal cancer liver metastases. Existing targeted therapies face problems of immune escape and drug resistance. It is necessary to identify new potential molecular regulatory networks to enhance the efficacy of anti-tumor metastasis treatment. In particular, the combined regulatory relationship of WLS/FZD3 has not been reported.

Method used

Small interfering RNA (shRNA) is provided to inhibit the expression of WLS and FZD3. By preparing a composition containing shWLS and shFZD3 with nucleotide sequences such as SEQ ID NO.2 and SEQ ID NO.3, it is used to prepare a drug for treating colorectal cancer liver metastases, in combination with substances that inhibit WLS/FZD3 to affect tumor metastasis.

Benefits of technology

By jointly inhibiting WLS/FZD3, tumor metastasis was significantly suppressed, mouse survival time was prolonged, the number of liver metastases was reduced, and tumor proliferation was synergistically inhibited, providing a new potential therapeutic strategy to suppress liver metastasis of colorectal cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380076B_ABST
    Figure CN121380076B_ABST
Patent Text Reader

Abstract

The present application provides a kind of substance for jointly inhibiting WLS / FZD3 and its application, i.e., the substance for inhibiting WLS expression and the substance for inhibiting FZD3 expression are jointly applied to prevent and treat colorectal cancer liver metastasis drugs;The present application first proves that WLS in colorectal cancer regulates the relationship of colorectal cancer liver metastasis through FZD3, WLS from CAF can promote colorectal cancer liver metastasis by acting on vascular FZD3 receptor, therefore, the substance for inhibiting WLS expression and the substance for inhibiting FZD3 expression can be better inhibited in combination to inhibit the liver metastasis ability of tumor cells, thereby developing and verifying the new application of the substance for jointly inhibiting WLS / FZD3 in preparing colorectal cancer treatment drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a substance for jointly inhibiting WLS / FZD3 and application thereof. BACKGROUND

[0002] Wnt Ligand Secretion Mediator (WLS) is an important protein in the synthesis and secretion process of Wnt ligand, which can bind to various Wnt ligands and regulate their sorting and secretion.

[0003] Frizzled Class Receptor 3 (FZD3) is a G protein-coupled receptor belonging to the frizzled family, which is mainly responsible for intercellular signal transduction, especially playing a key role in the Wnt signaling pathway. FZD receptors on the cell membrane are coupled with downstream β-catenin classical signaling pathways or PKC and calcium flow signaling pathways to play different physiological or pathological functions.

[0004] Current research shows that the above two proteins have different pathways and functions in different physiological or pathological states of different tissues and different cells. Their relationship with tumor progression and metastasis is not clear.

[0005] Colorectal cancer is one of the most malignant tumors. According to the latest world cancer data, the incidence and mortality of colorectal cancer rank among the top three, and more than half of colorectal cancer patients will develop liver metastasis, leading to poor prognosis. Although in addition to traditional surgical resection, targeted therapy and immunotherapy have emerged, considering the influence of immune escape or drug resistance and other factors, it is urgent to identify potential molecular regulatory networks / regulatory mechanisms to enhance the efficacy of anti-colorectal cancer liver metastasis. There is no report on the joint regulation of WLS / FZD3 in colorectal cancer. SUMMARY

[0006] In view of the deficiencies in the prior art, the present application provides an application of a substance for jointly inhibiting WLS / FZD3 in the preparation of a drug for treating colorectal cancer liver metastasis on the basis of the first discovery of the joint regulation of WLS / FZD3. The discovery of the regulation relationship of WLS / FZD3 will provide a new valuable potential joint target for the diagnosis and treatment of colorectal cancer liver metastasis. Through joint intervention of the two nodes, the process of tumor metastasis can be affected to a certain extent, and the effect of better inhibiting tumor metastasis can be achieved.

[0007] The technical scheme of the present application is as follows:

[0008] The first object of the present application is to provide shRNA of WLS, which is shWLS with a nucleotide sequence as shown in SEQ ID NO. 2.

[0009] A second object of the present application is to provide an shRNA of FZD3, and the shFZD3 is shown in the nucleotide sequence of SEQ ID NO. 3.

[0010] A third object of the present application is to provide a composition for inhibiting colorectal tumor, and the active ingredient of the composition is a substance for inhibiting WLS expression and a substance for inhibiting FZD3 expression.

[0011] Further, the substance for inhibiting WLS expression is a small interfering RNA or shRNA which takes the WLS protein or its transcript as a target sequence and can inhibit the expression of WLS protein or gene transcription; and the substance for inhibiting FZD3 expression is a small interfering RNA or shRNA which takes the FZD3 protein or its transcript as a target sequence and can inhibit the expression of FZD3 protein or gene transcription.

[0012] Further, the substance for inhibiting WLS expression is shWLS shown in the nucleotide sequence of SEQ ID NO. 2.

[0013] Further, the substance for inhibiting FZD3 expression is shFZD3 shown in the nucleotide sequence of SEQ ID NO. 3.

[0014] Further, the composition further comprises a pharmaceutically acceptable excipient.

[0015] Further, the composition is in the form of oral administration or non-oral administration.

[0016] A fourth object of the present application is to provide the use of the aforementioned composition in the preparation of a medicament for preventing and / or treating colorectal cancer liver metastasis.

[0017] Further, the colorectal cancer includes colon cancer and rectal cancer.

[0018] The present application has the following advantages:

[0019] The present application first discovers that the WLS from tumor-associated fibroblasts (CAF) can act on the FZD3 receptor on the vascular endothelial cells, thereby promoting the progression of liver metastasis of intestinal cancer. Therefore, a new potential treatment strategy for WLS function is provided, i.e. using a substance for inhibiting WLS / FZD3 (using a substance for inhibiting WLS expression and a substance for inhibiting FZD3 expression in combination) as a colorectal cancer drug to treat colorectal cancer, so as to effectively inhibit the occurrence of liver metastasis of intestinal cancer.

[0020] The present application finds that WLS is significantly positively correlated with the occurrence of liver metastasis through immunohistochemistry and qRT-PCR. After verifying the knockdown and overexpression efficiency of WLS and FZD3, it is found through experiments that WLS and FZD3 can promote liver metastasis of intestinal cancer. Further research shows that WLS can produce effects by combining with FZD3 receptors on vascular endothelial cells. Further, it is proved that the combined application of substances (shWLS) inhibiting WLS expression and substances (shFZD3) inhibiting FZD3 expression can better inhibit the tumor metastasis ability in a synergistic manner, thereby developing and verifying the new application of the substance inhibiting WLS / FZD3 in the preparation of a drug for treating colorectal cancer liver metastasis. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Fig. 1 is the IHC examination results of WLS in TvsN intestinal cancer tissues, wherein:

[0022] a is the staining results;

[0023] b is the scoring results of WLS staining.

[0024] Figure 2 Fig. 2 is the WLS qRT-PCR detection results of sample tumor tissues (tumor) and normal intestinal tissues (adjacent).

[0025] Figure 3 Fig. 3 is the detection results of the mRNA level of WLS in M1 patient tumor-associated fibroblasts (CAF).

[0026] Figure 4 Fig. 4 is the comparison of WLS in parenchymal and mesenchymal tissues of M1 and M0 intestinal cancer tissues, wherein:

[0027] a is the staining results;

[0028] b is the scoring results of WLS staining in parenchymal components;

[0029] c is the scoring results of WLS staining in mesenchymal components.

[0030] Figure 5 Fig. 5 is the qRT-PCR and WB detection results after WLS knockdown in M1 CAF cells and WLS overexpression in M0 CAF, wherein:

[0031] a is the qRT-PCR detection results (upper panel) and the corresponding WB detection results (lower panel) after WLS overexpression in M0 patient CAF;

[0032] b is the qRT-PCR detection result of M1 patient CAF after WLS knockdown (upper panel) and the WB detection result of M0 patient after WLS knockdown (lower panel).

[0033] Figure 6 The qRT-PCR and WB detection results of WLS knockdown or overexpression in mouse tumor-associated fibroblasts (Caf) are constructed, wherein:

[0034] a is the qRT-PCR detection result of mouse Caf after WLS overexpression (upper panel) and the WB detection result of mouse Caf after WLS overexpression (lower panel);

[0035] b is the qRT-PCR detection result of mouse Caf after WLS knockdown (upper panel) and the WB detection result of mouse Caf after WLS knockdown (lower panel).

[0036] Figure 7 The qRT-PCR and WB detection results of FZD3 knockdown in human vascular endothelial cells (HUVEC) are constructed, wherein:

[0037] a is the qRT-PCR detection result of FZD3 knockdown in HUVEC cell line;

[0038] b is the WB detection result of FZD3 knockdown in HUVEC.

[0039] Figure 8 The WLS-related transendothelial cell migration experiment (TEM), transendothelial cell membrane resistance experiment (TEER) and in vitro permeability experiment detection results are constructed, wherein:

[0040] a is the detection photo of transendothelial cell migration experiment of M1 patient CAF in untreated WLS (CAF-M1-shNC), knockdown WLS (CAF-M1-shWLS) state, M0 patient in untreated WLS (CAF-M0-Vector), overexpression WLS (CAF-M0-WLS) state;

[0041] b is the counting result analysis result of M1 patient CAF, M0 patient CAF transendothelial cell migration experiment;

[0042] c is the counting result analysis result of M1 patient CAF, M0 patient CAF transendothelial cell membrane resistance experiment;

[0043] d is the counting result analysis result of M1 patient CAF, M0 patient CAF in vitro permeability experiment.

[0044] Figure 9The results of WLS-related transwell and tube formation experiments are shown in the following figures:

[0045] a is a photograph showing the results of the endothelial cell migration experiment affected by M1 patient CAF in the untreated WLS (CAF-M1-shNC) and knockdown WLS (CAF-M1-shWLS) states, and M0 patient CAF in the untreated WLS (CAF-M0-Vector) and overexpressed WLS (CAF-M0-WLS) states;

[0046] b is a count result analysis of the endothelial cell migration experiment affected by M1 patient CAF and M0 patient CAF;

[0047] c is a photograph showing the results of the endothelial cell tube formation experiment affected by M1 patient CAF in the untreated WLS (CAF-M1-shNC) and knockdown WLS (CAF-M1-shWLS) states, and M0 patient CAF in the untreated WLS (CAF-M0-Vector) and overexpressed WLS (CAF-M0-WLS) states;

[0048] d is a count result analysis of the endothelial cell tube formation experiment affected by M1 patient CAF and M0 patient CAF.

[0049] Figure 10 The results of FZD3-related TEM, TEER, and in vitro permeability experiments are shown in the following figures:

[0050] a is a photograph showing the results of the transendothelial cell migration experiment affected by M1 patient CAF in the untreated WLS (CAF-Vec) and overexpressed WLS (CAF-WLS) states, and the endothelial cells treated with untreated FZD3 (shNC) or knockdown FZD3 (shFZD3);

[0051] b is a count result analysis of the transendothelial cell migration experiment affected by M1 patient CAF and the endothelial cells treated with FZD3;

[0052] c is a count result analysis of the transendothelial cell membrane resistance experiment affected by M1 patient CAF in the untreated WLS (CAF-Vec) and overexpressed WLS (CAF-WLS) states, and the endothelial cells treated with untreated FZD3 (shNC) or knockdown FZD3 (shFZD3);

[0053] d is a count result analysis of the in vitro permeability experiment affected by M1 patient CAF in the untreated WLS (CAF-Vec) and overexpressed WLS (CAF-WLS) states, and the endothelial cells treated with untreated FZD3 (shNC) or knockdown FZD3 (shFZD3).

[0054] Figure 11 The detection results of FZD3 related Transwell experiment and Tube formation experiment, wherein:

[0055] a is the detection photo of the influence of M1 patient CAF on the endothelial cell migration experiment of the endothelial cells in the untreated WLS (CAF-Vec) and overexpressed WLS (CAF-WLS) state, and the untreated FZD3 (shNC) or knocked down FZD3 (shFZD3) state of the endothelial cells;

[0056] b is the counting result analysis result of the influence of M1 patient CAF on the endothelial cell migration experiment of the treated endothelial cells;

[0057] c is the detection photo of the influence of M1 patient CAF on the endothelial cell tube formation experiment of the endothelial cells in the untreated WLS (CAF-Vec) and overexpressed WLS (CAF-WLS) state, and the untreated FZD3 (shNC) or knocked down FZD3 (shFZD3) state of the endothelial cells;

[0058] d is the counting result analysis result of the influence of M1 patient CAF on the endothelial cell tube formation experiment of the treated endothelial cells.

[0059] Figure 12 The liver metastasis nodule results of mouse WLS related cecum orthotopic liver metastasis experiment, wherein:

[0060] a is the general photo of the liver metastasis nodule of mouse tumor related fibroblasts Caf in the untreated WLS (Caf-shNC), knocked down WLS (Caf-shWLS), untreated WLS (Caf-Vector), and overexpressed WLS (Caf-WLS) groups;

[0061] b is the statistical analysis result of the number of metastasis nodules in the corresponding group.

[0062] Figure 13 The cecum results of mouse WLS related cecum orthotopic liver metastasis experiment, wherein:

[0063] a is the general photo of the orthotopic cecum tumor of mouse tumor related fibroblasts Caf in the untreated WLS (Caf-shNC), knocked down WLS (Caf-shWLS), untreated WLS (Caf-Vector), and overexpressed WLS (Caf-WLS) groups;

[0064] b is the statistical analysis result of the tumor size load in the corresponding group.

[0065] Figure 14Survival analysis results of the WLS-related orthotopic liver metastasis experiment in mice.

[0066] Figure 15 Results of liver metastasis foci of the FZD3-related orthotopic liver metastasis experiment in mice, wherein:

[0067] a is a general photo of liver metastasis foci of the mouse Caf untreated WLS with mouse endothelial cells untreated Fzd3 (Caf-Vec+AAV-shNC), mouse Caf untreated WLS with mouse endothelial cells knocked down Fzd3 (Caf-Vec+AAV-shFzd3), mouse Caf overexpressed WLS with mouse endothelial cells untreated Fzd3 (Caf-Wls+AAV-shNC), and mouse Caf overexpressed WLS with mouse endothelial cells knocked down Fzd3 (Caf-Wls+AAV-shFzd3) group;

[0068] b is a statistical analysis result of the number of metastasis foci in the corresponding group.

[0069] Figure 16 Results of the orthotopic cecum of the FZD3-related orthotopic liver metastasis experiment in mice, wherein:

[0070] a is a general photo of orthotopic cecum tumor of the mouse Caf untreated WLS with mouse endothelial cells untreated Fzd3 (Caf-Vec+AAV-shNC), mouse Caf untreated WLS with mouse endothelial cells knocked down Fzd3 (Caf-Vec+AAV-shFzd3), mouse Caf overexpressed WLS with mouse endothelial cells untreated Fzd3 (Caf-Wls+AAV-shNC), and mouse Caf overexpressed WLS with mouse endothelial cells knocked down Fzd3 (Caf-Wls+AAV-shFzd3) group;

[0071] b is a statistical analysis result of tumor size load in the corresponding group.

[0072] Figure 17 Survival analysis results of the FZD3-related orthotopic liver metastasis experiment in mice. DETAILED DESCRIPTION

[0073] The present application will be further explained in conjunction with the following examples, which do not limit the present application in any form.

[0074] The present application will be further explained in conjunction with the following examples, which do not limit the present application in any form.

[0075] In the following examples, various processes and methods well known in the art of which are not described in detail. The source of the reagents used, trade names, and where necessary the composition of the ingredients are indicated at first occurrence, and used identically thereafter unless otherwise specified.

[0076] The tissue samples used in the following examples were from patients with colorectal cancer surgery in Jiangsu Province People's Hospital. The patients and their families were fully informed of the purpose and process of the study before surgery, and signed the informed consent form. This study has been approved by the Ethics Committee of the unit.

[0077] The colorectal cancer cell lines HCT116 and DLD-1 used in the examples, the endothelial cell line HUVEC, and the mouse tumor cell CT26 were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. Primary tumor-associated fibroblasts were extracted according to the standard process of previous studies.

[0078] The cell culture medium formula used: DMEM / F12, RPMI1640 added with a final concentration of 10% fetal bovine serum, a final concentration of 1% penicillin, and a final concentration of 1% streptomycin. Raw materials were purchased from Vincent Biotechnology Co., Ltd.

[0079] The serum-free medium involved in the examples is DMEM / F12 medium.

[0080] TRIzol used for RNA extraction was purchased from Invitrogen Company.

[0081] The reagents used for qRT-PCR were purchased from Nanjing Nuozan Company.

[0082] Example 1 WLS expression level positively correlated with metastasis

[0083] 1. Tissue microarray (TMA) immunohistochemistry (IHC) and IHC scoring

[0084] 1.1 Hydrated paraffin section:

[0085] 1) Place the sections obtained from the M1 and M0 patient tissue wax blocks or patient tumor and normal tissue wax blocks in order: 15 min in xylene, 5 min in 100% alcohol, 5 min in 95% alcohol, 5 min in 70% alcohol, and finally 5 min in water.

[0086] 2) After washing once with PBS, soak for 5 min.

[0087] 1.2 Antigen recovery:

[0088] 1) Place the sections on the slide rack and place the slide rack in a 10 mM sodium citrate solution (stock solution is 100 mM, pH 6.0) in boiling water for 2 h.

[0089] 2) Take out the slide, cool to room temperature naturally, wash with clean water for 3 times, 5 min each time, then soak in PBS for at least 5 min.

[0090] 1.3 Blocking endogenous peroxidase:

[0091] 1) Put the slice in 90ml methanol / 10ml 30% H2O2, soak at room temperature for 20 min (not more than 30 min).

[0092] 2) Wash with PBS for 3 times, 5 min each time.

[0093] 3) Absorb the excess PBS with toilet paper, and draw a circle around the tissue with a PAP pen.

[0094] 1.4 Blocking and incubation of primary antibody overnight:

[0095] 1) Add blocking solution (5% BSA + 1% goat serum + 0.1% Tween 20) to the tissue, block for at least 1 h.

[0096] 2) Dilute the primary antibody (purchased from abcam company, the primary antibody for WLS detection has the product number ab323481) with the blocking solution.

[0097] 3) Absorb the blocking solution on the tissue, and add the diluted primary antibody to the tissue, incubate at 4°C overnight.

[0098] 1.5 Secondary antibody, DAB color development:

[0099] 1) Wash away the primary antibody.

[0100] 2) Wash with PBS for 3 times, 5 min each time.

[0101] 3) Dilute the secondary antibody (purchased from Biyun company, product number A0277) (biotin labeled, dilute at 1:1000 by volume ratio) with the blocking solution, incubate at room temperature for 1 h.

[0102] 4) Wash the slice with PBS for 3 times, 5 min each time.

[0103] 5) Prepare ABC reagent (containing avidin) (purchased from Thermo company, product number PK-4000, see the reagent kit instruction): add one drop of reagent A to 2.5ml PBS, mix well, then add one drop of reagent B, mix well, stand at room temperature for 30 min.

[0104] 6) Add the ABC reagent to the tissue slice, incubate at room temperature for 30 min.

[0105] 7) Wash with PBS for 3 times, 5 min each time.

[0106] 8) Prepare DAB reagent: add 1 drop of DAB Buffer to 2.5 ml distilled water, mix well, then add 2 drops of DAB, mix well, and finally add 1 drop of H2O2, mix well and keep for use.

[0107] 9) Add DAB reagent to the tissue section, detect DAB reaction, and after appropriate reaction, immerse the section in water to terminate the reaction.

[0108] 1.6 Counterstaining the section:

[0109] 1) Place the section in hematoxylin for 4.5 min.

[0110] 2) Immerse in water for 3 times.

[0111] 3) Replace water and immerse for 5 times.

[0112] 4) Place the section in bluing reagent for 1 min.

[0113] 5) Immerse in water for 10 times.

[0114] 6) Immerse in 100% alcohol for 20 times.

[0115] 7) Immerse in xylene for 15 times.

[0116] 8) Immerse in xylene for 15-20 min.

[0117] 9) Cover the section with a cover glass.

[0118] Immunohistochemical score (H-score) was performed according to the conventional evaluation standard, i.e. the product of staining intensity (i) and staining area (pi). The score of staining intensity was defined as: negative 0 point; weak 1 point; moderate 2 points; strong positive 3 points. H-score =∑(pi x i).

[0119] 2. Quantitative real-time PCR (qPCR) experiment

[0120] Extract RNA from colorectal cancer M0 or M1 tissues and M1-CAF or M0-CAF cells, and verify the expression amount of WLS and FZD3 by qRT-PCR experiment.

[0121] The nucleotide sequence of the upstream primer F of WLS used in the experiment is shown in SEQ ID NO. 4, and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO. 5.

[0122] The results show that: Figure 1 It can be seen that after analyzing the score of staining, it was found that the protein level of WLS was significantly higher in tumor tissues than in normal intestinal tissues.

[0123] The results show that: Figure 2As can be seen, the mRNA level of WLS is significantly higher in tumor tissue than in normal intestinal tissue.

[0124] From Figure 3 As can be seen, the mRNA level of WLS is significantly higher in CAF of M1 patients with metastasis than in CAF of M0 patients without metastasis.

[0125] From Figure 4 As can be seen, the protein level of WLS is significantly higher in tumor tissue of M1 patients with metastasis than in intestinal cancer tissue of M0 patients without metastasis, and is mainly concentrated in CAF in the interstitial tissue, while no difference is detected in the parenchymal tissue.

[0126] In summary, the results of qRT-PCR and IHC show that WLS is significantly higher in M1 patients with metastasis than in M0 patients without metastasis at both mRNA and protein levels, and mainly acts through CAF in the interstitial tissue.

[0127] Example 2 Verification of the efficiency of knockdown and overexpression of WLS and FZD3

[0128] 1. Knockdown or overexpression of WLS in intestinal cancer tumor-associated fibroblasts (CAF) and knockdown of FZD3 in endothelial cells

[0129] 1.1 Transfect when CAF or HUVEC cells are inoculated to 70-90% confluence.

[0130] 1.2 Construction of WLS or FZD3 knockdown

[0131] 1.2.1 Dilute Lipofectamine 3000 reagent with Opti-MEM medium (Gibco) and mix thoroughly.

[0132] 1.2.2 Dilute plasmid solution containing WLS-shRNA sequence (i.e. shWLS, the nucleotide sequence of which is shown as SEQ ID NO. 2) or FZD3-shRNA sequence (i.e. shFZD3, the nucleotide sequence of which is shown as SEQ ID NO. 3) with Opti-MEM medium (the plasmid vector is pLKO.1-puro, the insertion site of shWLS is between the AgeI and EcoRI enzyme cutting sites, and the insertion site of shFZD3 is between the AgeI and EcoRI enzyme cutting sites) to make a plasmid premix solution and mix thoroughly.

[0133] 1.2.3 Add the diluted plasmid premix solution (shWLS and shFZD3) to the diluted Lipofectamine 3000 reagent.

[0134] 1.2.4 The above mixture was added to CAF or HUVEC cells, respectively.

[0135] 1.3 Construction of WLS overexpression

[0136] 1.3.1 The slow virus (vector pLV4ltr-puro-CMV, purchased from GenScript, WLS insertion site between 5'LTR and 3'LTR) inserted with WLS expression sequence (nucleotide sequence as shown in SEQ ID NO. 1) was diluted with Opti-MEM medium (Gibco) to prepare a premix and mix thoroughly.

[0137] 1.3.2 The above premix was added to CAF cells.

[0138] 1.4 After 24 hours of the above WLS knockdown or overexpression CAF cells and FZD3 knockdown cells, the medium was replaced and puromycin was used to remove untransfected cells.

[0139] 1.5 The above obtained cells were continuously cultured for subsequent experiments.

[0140] 2. Western Blotting (WB)

[0141] 2.1 First, wash the glass plate with deionized water, dry and fix the glass plate. Prepare the WB electrophoresis gel solution according to the experimental protocol of the Rapid Preparation Kit for SDS-PAGE Gel (product number PG112). The specific operation is as follows: pour the prepared lower gel along the side until about 2-3 cm from the top, then add 1 ml of isopropanol, and let stand for 30 minutes. After the lower gel is completely solidified, discard the upper isopropanol, add the prepared upper gel, slowly insert the comb, and avoid air bubbles. Let stand for 20 minutes, and then gently pull out the comb.

[0142] 2.2 Insert the glass plate into the electrophoresis tank and fill it with electrophoresis buffer. Add marker (Novagen, product number MP102-01) and protein samples extracted from cell samples (including M1-CAF cells with knockdown of WLS and its control M1-CAF-shNC, M0-CAF cells with overexpression of WLS and its control M0-CAF-Vec, mouse Caf cells with knockdown or overexpression of Wls, Caf-shNC, Caf-shWls, Caf-Vec, Caf-Wls, and HUVEC cells with knockdown of FZD3 and its control) into the wells in order. First, set the voltage to 80 V for electrophoresis. After the protein runs to the separation gel, adjust the voltage to 120 V for continuous electrophoresis. When the target protein reaches the bottom, terminate the electrophoresis. According to the molecular weight, cut the gel where the target protein is located.

[0143] 2.3 Cut the PVDF membrane to the appropriate size, first soak it in methanol, then place it on the cut protein glue, and soak it in the transfer solution, then install it in the order of anode to cathode, add the transfer tank, place an ice bag, constant current transfer, 250 mA, transfer for 90 minutes on ice.

[0144] 2.4 Blocking: Place the transferred membrane in the prepared blocking solution, room temperature, shake for 2 hours, then wash with TBST solution 3 times, 5 minutes each time. Then incubate the primary antibody (purchased from abcam company, WLS detection uses the primary antibody with the product number: ab323481, and FZD3 detection uses the primary antibody with the product number: ab217032), 4°C overnight.

[0145] 2.5 The next day, wash with TBST solution on a shaker 3 times, 10 minutes each time. Incubate the corresponding secondary antibody (purchased from abcam company, product number: ab6761) at room temperature for 2 hours.

[0146] 2.6 Then wash with TBST solution 3 times, 10 minutes each time, then prepare the developing solution (purchased from vazyme company, product number: E412-01 / 02), place it in the developing instrument under light protection conditions for exposure, and save the pictures.

[0147] 3. Quantitative real-time PCR (qPCR) experiment

[0148] Extract CAF and HUVEC cell RNA constructed according to the above steps (M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, M1-CAF-shWLS, Caf-Vec, Caf-Wls, Caf-shNC, Caf-shWls, HUVEC-shNC, HUVEC-shFZD3#1-3), and use qRT-PCR experiment (a method commonly used in the art, see the literature "Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis") to verify the expression of WLS and FZD3.

[0149] The nucleotide sequence of the upstream primer F of WLS used in the experiment is shown in SEQ ID NO. 4, and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO. 5. The nucleotide sequence of the upstream primer F of FZD3 is shown in SEQ ID NO. 6, and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO. 7.

[0150] The results show that: Figure 5The results show that the mRNA and protein levels of WLS in M1 patient CAFs can be significantly successfully knocked down Figure 5 b) and significantly successfully overexpressed in M0 patient CAFs Figure 5 a).

[0151] The results show that the mRNA and protein levels of WLS in mouse Caf cells can be significantly successfully knocked down and significantly successfully overexpressed. Figure 6 The results show that the mRNA and protein levels of WLS in mouse Caf cells can be significantly successfully knocked down and significantly successfully overexpressed.

[0152] Figure 7 The results show that the mRNA and protein levels of WLS in mouse Caf cells can be significantly successfully knocked down and significantly successfully overexpressed.

[0153] The above qRT-PCR and WB detection results show that the expression levels of WLS and FZD3 can be significantly reduced by shRNA in humans and mice.

[0154] Example 3 WLS and FZD3 promote transendothelial migration of intestinal cancer cells and affect vascular permeability

[0155] 1. Transendothelial migration (TEM) experiment

[0156] 1.1 Use 24-well plate transwell chamber: the upper chamber is covered with endothelial cells (HUVEC-shNC or HUVEC-shFZD3), and the lower chamber is inoculated with an appropriate amount of transfected CAF (including CAFs with knocked down or overexpressed WLS: M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, M1-CAF-shWLS).

[0157] 1.2 Prepare DLD1 tumor cell suspension (resuspend tumor cells with cell culture medium) and dye with DIO fluorescent probe (Bi Yun Tian, product number C1038) to count 5*10^4 cells / 100 μl.

[0158] 1.3 Inoculate an appropriate amount of tumor cell suspension on the upper chamber of the 24-well plate, about 100 μl per well, with 3 repeats.

[0159] 1.4 Place the 24-well plate in the incubator for a period of time (37°C, 5% CO2).

[0160] 1.5 Remove the chamber and fix it in 4% paraformaldehyde.

[0161] 1.6 After wiping off the cells in the upper chamber, dye with DAPI working solution.

[0162] 1.7 Take pictures and count the number of tumor cells that have crossed the endothelial cells using a fluorescence microscope.​

[0163] 2. Transendothelial electrical resistance (TEER) experiment

[0164] 2.1 Seed appropriate amount of HUVEC cells (including HUVEC-shNC or HUVEC-shFZD3) on the upper layer of the chamber and incubate to form a monolayer.

[0165] 2.2 After extracting the supernatant of the above constructed CAF cells (including M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, M1-CAF-shWLS), add it to the upper layer of the chamber for co-culture.

[0166] 2.3 Detect the endothelial cell membrane resistance using Millicell ERS-2 voltage resistance meter, place the electrode of the detection instrument in HBSS preheated to 37°C and balance for 20 minutes.

[0167] 2.4 Remove the culture medium in the culture chamber and add preheated HBSS for balancing.

[0168] 2.5 Start the instrument to detect the transmembrane resistance, and use a blank chamber for normalization, collect data for statistical analysis.

[0169] 3. In vitro permeability experiment

[0170] 3.1 Seed appropriate amount of HUVEC cells (including HUVEC-shNC or HUVEC-shFZD3) on the upper layer of the chamber and incubate to form a monolayer.

[0171] 3.2 After extracting the supernatant of the above constructed CAF cells (including M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, M1-CAF-shWLS), add it to the upper layer of the chamber for co-culture.

[0172] 3.3 Prepare a working solution containing FITC-dextran with appropriate concentration (1 mg / ml).

[0173] 3.4 Remove the liquid in the upper and lower chambers and place the chamber in a new 24-well plate, add the FITC-dextran working solution to the upper chamber, and keep the liquid level consistent between the upper and lower chambers.

[0174] 3.5 Place the culture plate in the incubator for a certain period of time (37°C, 5% CO2).

[0175] 3.6 Take an appropriate amount of lower chamber liquid, measure the absorbance value (OD) at 488 nm using a microplate reader, record the data for statistical analysis.

[0176] 4. Transwell experiment

[0177] 3×10 ^4 HUVEC cells (including HUVEC-shNC or HUVEC-shFZD3) per well were suspended in 200 μL of serum-free medium and seeded into the upper chamber of a Transwell chamber containing uncoated Matrigel. Then, 700 μL of complete medium containing supernatant from transfected CAF cells (including M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, and M1-CAF-shWLS) was added to the lower chamber. After incubation for 48 hours, cells that had migrated to the basal membrane were stained with 0.1% crystal violet. The cells were observed and photographed under a microscope, and the results were analyzed.

[0178] 5. Tube formation experiment

[0179] 5.1 Pre-cool the 96-well plate overnight and melt the matrix adhesive (ABW, part number 082704).

[0180] 5.2 Add 50 μL of matrix adhesive to each well of the pre-cooled 96-well plate and make the liquid surface uniform and smooth.

[0181] 5.3 Incubate in a 37°C cell culture incubator for 30 minutes to 1 hour.

[0182] 5.4 Resuspend HUVEC cells (including HUVEC-shNC or HUVEC-shFZD3) in the CAF cell supernatants (including M0-CAF-Vec, M0-CAF-WLS, M1-CAF-shNC, M1-CAF-shWLS) constructed above and count them.

[0183] 5.5 Resuspend the cells in a system of approximately 2.0 × 10^4 cells / 100 μL of culture medium, mix well, and add to a 96-well plate.

[0184] 5.6 Place the 96-well plate with the cells into a cell culture incubator for incubation.

[0185] 5.7 After 4 hours, images were taken and analyzed using a microscope.

[0186] The results show that: Figure 8 As shown in a and b, overexpression of WLS promotes transendothelial cell migration of tumor cells, while knockdown of WLS inhibits transendothelial cell migration of tumor cells; Figure 8 c. As can be seen, overexpression of WLS can disrupt endothelial cell membranes and reduce transmembrane resistance, while knockdown of WLS inhibits this effect; Figure 8 As can be seen, overexpression of WLS increases endothelial cell permeability, while knockdown of WLS decreases permeability.

[0187] Depend onFigure 9 a and b show that overexpression of WLS promotes endothelial cell migration, while knockdown of WLS reduces endothelial cell migration; from Figure 9 c and d show that overexpression of WLS inhibits endothelial cell tube formation, while knockdown of WLS promotes endothelial cell tube formation.

[0188] from Figure 10 a and b show that the ability of overexpression of WLS to promote tumor cell transendothelial migration is restored after knockdown of FZD3 in endothelial cells; from Figure 10 c shows that the ability of overexpression of WLS to disrupt endothelial cell membrane and reduce transmembrane resistance is restored after knockdown of FZD3 in endothelial cells; from Figure 10 d shows that the ability of overexpression of WLS to increase endothelial cell permeability is restored after knockdown of FZD3 in endothelial cells.

[0189] from Figure 11 a and b show that the ability of overexpression of WLS to promote endothelial cell migration is restored after knockdown of FZD3 in endothelial cells; from Figure 11 c and d show that the ability of overexpression of WLS to inhibit endothelial cell tube formation is restored after knockdown of FZD3 in endothelial cells.

[0190] In summary, from Figures 8-11 the transendothelial migration experiment, transendothelial resistance detection, endothelial cell membrane permeability detection, endothelial cell Transwell and endothelial cell tube formation experiment, a total of five experiments show that tumor-associated fibroblasts affect the migration and metastasis ability of intestinal cancer cells by affecting vascular endothelial cells. This ability is significantly inhibited after knockdown of WLS in tumor-associated fibroblasts, while the migration and metastasis ability of tumor cells is significantly further enhanced after overexpression of tumor-associated fibroblast WLS, and this promoting effect can be inhibited by knockdown of endothelial cell FZD3, indicating that WLS and FZD3 interact in vitro experiments. WLS can significantly promote tumor cell metastasis, and this part of the role can be inhibited by knockdown of FZD3.

[0191] Example 4 Combined application of shWLS and shFZD3 can synergistically inhibit tumor metastasis ability

[0192] 1. Mouse orthotopic liver metastasis experiment:

[0193] 1.1 Female Balb / c mice of 6 weeks old were purchased from the animal center of Nanjing Medical University and raised in the animal center.

[0194] 1.2 Take out the constructed mouse Caf cells (including Caf-Vector, Caf-Wls, Caf-shNC, Caf-shWls), discard the culture solution, wash twice with PBS, and then trypsinize the cells. Transfer the cells to a 10 ml EP tube, and then centrifuge in a centrifuge. After centrifugation, discard the upper culture solution. Similarly, operate the mouse tumor cells CT26.

[0195] 1.3 Mix the mouse Caf cells with the mouse tumor cells (CT26) at a ratio of 3:1, resuspend the cells with PBS, and count to 2*10^6 tumor cells / 100 μl.

[0196] 1.4 After the mouse is anesthetized, open the abdominal cavity, and inject 100 μl of the cell suspension into the cecum wall of the mouse.

[0197] 1.5 After 3 days, inject AAV-shNC or AAV-shFzd3 into the abdominal cavity to knock down Fzd3 in the mouse endothelial cells in vivo.

[0198] 1.6 Observe the survival of the mouse, sacrifice the mouse at the time node, and obtain the cecum and liver metastasis tumor samples of the mouse. Take pictures and measure the tumor size and number for statistical analysis.

[0199] The results show that: Figure 12 and 13 It can be seen that knocking down Wls can significantly reduce the number of liver metastases, and overexpressing Wls can promote tumor liver metastasis.

[0200] The results show that: Figure 14 It can be seen that knocking down Wls can prolong the survival of the mouse, and overexpressing Wls can shorten the survival of the mouse.

[0201] The results show that: Figure 15 and 16 It can be seen that the promoting effect of overexpressing Wls on liver metastasis of tumor cells is inhibited after knocking down endothelial cell Fzd3.

[0202] The results show that: Figure 17 It can be seen that the inhibition of mouse survival time caused by overexpression of Wls is prolonged after knocking down endothelial cell Fzd3.

[0203] In summary, the combined use of shWLS, which inhibits Wls, and shFzd3, which inhibits Fzd3, can synergistically inhibit the proliferation of mouse tumors and the ability of liver metastasis, and increase the prognosis.

[0204] The above test results collectively prove that the substances that inhibit WLS expression, i.e., the small interfering RNA or shRNA (such as shWLS) that takes the WLS protein or its transcript as a target sequence and can inhibit the expression of WLS protein or gene transcription, and the substances that inhibit FZD3 expression, i.e., the small interfering RNA or shRNA (such as shFZD3) that takes the FZD3 protein or its transcript as a target sequence and can inhibit the expression of FZD3 protein or gene transcription, can be combined to be used as active ingredients of drugs for preventing and treating colorectal cancer and applied to the anti-metastasis treatment of colorectal cancer.

[0205] SEQ ID NO. 1: WLS expression sequence

[0206]

[0207] SEQ ID NO. 2: shWLS

[0208] GATCTACAAGTTGACCCGCAA

[0209] SEQ ID NO. 3: shFZD3

[0210] CCTCGACTTGTGGATCTGAAT

[0211] SEQ ID NO. 4: Upstream primer F for WLS

[0212] CCACATCGCAGGGTATTGGA

[0213] SEQ ID NO. 5: Downstream primer R for WLS

[0214] TCCAGCCACGATGATGAAGG

[0215] SEQ ID NO. 6: Upstream primer F for FZD3

[0216] GCCGGGGTCTGAGGTTACT

[0217] SEQ ID NO. 7: Downstream primer R for FZD3

[0218] GTGGATGCTTCCTGCTTTGC

[0219] The above only is the preferred embodiment of the present application, it should be pointed out that, for the ordinary skilled in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A composition for inhibiting colorectal tumors, characterized in that, The active ingredients of the composition are substances that inhibit WLS expression and substances that inhibit FZD3 expression; The substance that inhibits WLS expression is shWLS, with the nucleotide sequence shown in SEQ ID NO.2; The substance that inhibits FZD3 expression is shFZD3, as shown in SEQ ID NO.3; The inhibition refers to the inhibition of liver metastasis of colorectal tumors.

2. The composition according to claim 1, characterized in that, The composition also includes pharmaceutically acceptable excipients.

3. The composition according to claim 1, characterized in that, The composition is an oral dosage form or a non-oral dosage form.

4. Use of the composition according to any one of claims 1 to 3 in the preparation of a medicament for the prevention and / or treatment of colorectal cancer liver metastases.

5. The application according to claim 4, characterized in that, The colorectal cancer mentioned includes colon cancer and rectal cancer.