Engineering bacterium for producing UK-2A and application thereof

Abstract

The invention relates to an engineering bacterium for producing UK-2A and application of the engineering bacterium. The UK-2A biosynthetic gene cluster is reconstructed by adding a promoter in front of a ukaA gene of the UK-2A biosynthetic gene cluster, adding a promoter rpsLp-cf in front of a ukaB gene and adding a promoter SP23 in front of a ukaC gene, an expression vector containing the reconstructed UK-2A gene cluster is constructed and introduced into streptomyces albus J1074, UK-2A is efficiently produced by using a better fermentation culture medium, and the UK-2A biosynthetic gene cluster has the advantages that the UK-2A biosynthetic gene cluster is high in yield; the shake-flask fermentation yield of the engineering bacteria reaches 1500 micrograms / mL or above, and compared with the engineering bacteria of the UK-2A gene cluster before reconstruction, the UK-2A yield is greatly improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to engineered bacteria used to produce UK-2A. Background Technology

[0002] The antifungal antibiotic UK-2A (CAS No: 167173-85-5) was developed in 1996 from a strain of Streptomyces (…). Streptomyces sp. The main components of the UK-2 compounds (UK-2A, B, C, D) with a nine-membered dilactone structure, isolated from the fermentation broth of 517-02, were obtained. Due to their structural instability, Dow AgroSciences modified their structure by introducing an acetoxymethyl group into the molecule, improving its stability. The modified compound, named Fenpicoxamid (trade name Inatreq), is mainly used to control fungal diseases of crops (especially cereals), such as leaf blight and leaf rust. Fenpicoxamid can be hydrolyzed in fungi to form active UK-2A, which exerts its fungicidal activity by inhibiting the Qi ubiquinone binding site in fungal mitochondrial complex III, thereby interrupting electron transport and respiration. This is a novel target site with no cross-resistance to existing cereal fungicides, showing broad application prospects.

[0003] Due to the commercial protection of the naturally occurring strain of UK-2A, large-scale fermentation production of UK-2A is currently not permitted in my country. Therefore, there is an urgent need to develop engineered strains for efficient UK-2A production to promote its industrialization and application in my country. Summary of the Invention

[0004] In view of the shortcomings of the existing technology, the present invention provides a strain of engineered bacteria for producing UK-2A, as well as its preparation method and application.

[0005] According to one aspect of the present invention, an isolated nucleic acid molecule is provided, said nucleic acid molecule comprising at least one selected from the following nucleic acids: ukaA Gene , ukaQ Gene , ukaP Gene , ukaK Gene , ukaH Gene , ukaF Gene , ukaL Gene , ukaR Gene , ukaO Gene , ukaM Gene , ukaB Gene , ukaD Gene , ukaC Gene , ukaG Gene , ukaI Gene 、 ukaJGene , ukaN Gene and ukaE Gene.

[0006] In some embodiments, the nucleic acid molecule comprises, in order from 5' to 3' end ukaA Gene , ukaQ Gene 、 ukaP Gene , ukaK Gene , ukaH Gene , ukaF Gene , ukaL Gene , ukaR Gene , ukaO Gene , ukaM Gene , ukaB Gene , ukaD Gene , ukaC Gene , ukaG Gene , ukaI Gene , ukaJ Gene , ukaN Gene and ukaE Gene.

[0007] In some embodiments, the ukaA Gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 19, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 19.

[0008] ukaA The nucleotide sequence of the Gene is as set forth in SEQ ID NO: 19: atgagttccttggcgacccccacccccactctcgagggcctcctcacgacaccggcggcgcagcacgccgaagcacaccccccgctccaccggccgggctcggccacggcctgcctcgaccggggcctggtcctccggcaggcggacgaggagttcttccgccggttcggcggctcggccccgcgcctcgtcggccggtccttcaccgagctggtgcaccccggctgccgggagcccctgctgcggcagttcgccgggctcaccgagggccggcgcgaccggttcggcaccgaggtcatcgcggtgggcccggacggcaccccgttccggaccgacctgacggcgctggcggtacgcggcggaacccccgacatctcggccgtctggctgacgctggcggcggccggcgagaccgcgcagcccgccgccgcgacgccccgcaagaagatcctcagcgagatcgacgcccgcatcctcgaaggcatcgcggccggtgtctccaccgtccccctggccgcacgcctgtatctgagccggcagggggtcgagtaccacgtgaagagcctgttccggcagctccgcgtgcccaaccgggccgcgctcgtctcccgcgcctactccatgggcctgctcaaggtggggacctggccgcccaaggtggcgccggacttcgtcaagtga In some embodiments, the gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 20, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 20. ukaQ In some embodiments, the gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 20, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 20.

[0009] ukaQ The nucleotide sequence of the gene is as set forth in SEQ ID NO: 20: In some embodiments, the ukaP The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 21, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 21.

[0010] ukaP The nucleotide sequence of the gene is as set forth in SEQ ID NO: 21: In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 22, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 22. ukaK In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 22, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 22.

[0011] ukaK The nucleotide sequence of the gene is as set forth in SEQ ID NO: 22: gtgcccctgatccaggtcagcctctacgaagaccgcctcacgcccgagacccgccgcgccctgatcggggagctcaccgaggcggcggtccgcgccctcggccccgagtgccgcgacgtgacgtgggtgacgctccagggcatcccccgcgaccagtggggcatcggcggaacgcccggctga In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 23, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 23. ukaH In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 22, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 22.

[0012] ukaH The nucleotide sequence of the gene is as set forth in SEQ ID NO: 23: In some embodiments, the ukaF The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 24, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 24.

[0013] ukaF The nucleotide sequence of the gene is as set forth in SEQ ID NO: 24: In some embodiments, the ukaL The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 25, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 25.

[0014] ukaL The nucleotide sequence of the gene is as set forth in SEQ ID NO: 25: In some embodiments, the ukaR gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 26, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 26.

[0015] ukaR The nucleotide sequence of the gene is as set forth in SEQ ID NO: 26: atggccgacctgctcctccccggcgtcctcgaagcggccgaccgcccgttcgtcttctacggccactcgctcggcgcgcgcgtcgcctacgagacggcccaccgcctcgcggacaccggccggccgctgcccgccgcgctctgcgtctccggggcgcccgccccggccctcggcgtccacaccccgtgccacgaccagccccgcgcggaattcctccgcaccctgcgggcgatgggcggcgtcgccccggaggtgctcgccgacgaggagctgtgcgactacgtcctgccggtcatccgcgccgacatgcgggccgccgagacataccggccaccgcgccggaccccgctgcgcacaccgatcagggcgctcgccggacgggacgacccccgggtgccggtggagcacgtgcggcggtggtcggacgaggccggtggggagttccgctgcacggtcttcgagggaggccacttcttcttccgtgaccacccgtcggaggtcgccgcggtgttggacggcctgctgcgggaagtcgccgggggatag In some embodiments, the ukaO gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 27, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 27.

[0016] ukaO The nucleotide sequence of the gene is as set forth in SEQ ID NO: 27: atggacccggtgacccttcggaccgaccgcctggtgctgcgggccttcacgcctgccgacgtggatgcggtgtacgaggcctgccaggacgaggacatccagctctacaccccggtgccggtgccgtacctgcgtgcggacgcggagaagctcgtcggcgagaagctgcccgcccagtgggccgcggacgaggactacaccttcggcgcgttccgcgaggacaccggcgccctggccggctcgtactgcctgacccgcgtcagccgcggcgtctgggagctcggctactgggcggtcaaggagcagcgcggtcacgggtattcggtggaggccgcccgagccctgtgcgactggggatgggccacgctcgacgtgcaccgcatcgagtggtgggccatggtcgggaacgccggctcgcgtgccgtcgccgagagactcggcttcaccgtcgaggggacactgcgcaagcgcggcatcgccaacgacggcgtaccgcacgactggtgggtgggcggactgctgcggccctga In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 28, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 28. ukaM In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 28, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 28.

[0017] ukaM The nucleotide sequence of the gene is as set forth in SEQ ID NO: 28: atgtcagatccgaccgaccgcatcgccctggtgaccggggccggccgcggcatcggccgtgccgtcgccgtccgcctcgccgcggagggcgcgctggtcgccgtccactacggacgggacgacgaagccgcgcggtcgacggtgcgggagatccgcgaagccggcgggtcggccttccccgtccgcgcggagttcggcgagctcggcgccctcgacgagctgtggcgcggttacgacgagggcgtcgccgccgtccgcggcggctcgggtcccgcgccggtggacatcctcgtgaacaacgccgggatcaccgtcccgcgtggcgtacgggacctcgaagaggccgactgggaccggctgttcgcggtcaacgccaaggccccgttcttcctggtgcagggcgcgctgccgcggctgcgcgacgggggccggatcgtcaacgtcaccaccgccgcgacccgggtggcgatgccggtgatcgccgcgtacaccatgaccaaggcggcgctggagaccttcaccgtcgacctcgccctggagctggggccgcgcggcatcaccgtcaacgcggtcgccccggggtacaccgacaccgacatcaacccggacatgaaggtgcccgcccagcgcgaggccatggccgccaccaccgcactccaccgggtcggtacgcccggcgaggtcgccgacgtcgtcgcctacctggcgggaccgggcggccgctgggtcaccgggcagcgcatcgaggcgtcggggggcgtccggctcggactctag In some embodiments, the gene is encoded by a nucleotide sequence as set forth in SEQ ID NO: 29, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 29. ukaB The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 29, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 29.

[0018] ukaB The nucleotide sequence of the gene is as set forth in SEQ ID NO: 29: In some embodiments, the ukaD The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 30, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 30.

[0019] ukaD The nucleotide sequence of the gene is as set forth in SEQ ID NO: 30: In some embodiments, the ukaC The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 31, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 31.

[0020] ukaC The nucleotide sequence of the gene is as set forth in SEQ ID NO: 31: In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 32, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 32. ukaG In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 32, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 32.

[0021] ukaG The nucleotide sequence of the gene is as set forth in SEQ ID NO: 32: atgaagccccacaccatcgacgtccccgagacgttcgacgcgctgctgacgaccctgaccgcgacggccggcatggaggacgaggaactcctcccggacgacaacctgttcgagctcggtctcgactcggtgacgctcacccggctgatcgggcggtggcgcgcggccggggtgaccgcgcccctggccgacttcctcgaacggccgacccccgaggagtggtgggagatcgtgcgggactcgcggaccggagccgcggcggcgggctga In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 33, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 33. ukaI In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 32, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 32.

[0022] ukaI The nucleotide sequence of the gene is as set forth in SEQ ID NO: 33: In some embodiments, the ukaJ The gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 34, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 34.

[0023] ukaJ The nucleotide sequence of the gene is as set forth in SEQ ID NO: 34: In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 35, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 35. ukaN In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 35, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 35.

[0024] ukaN The nucleotide sequence of the gene is as set forth in SEQ ID NO: 35: atgagcagcgaagtacccgagatcagggtcagcgacgagcgggtcaaccgcacgctcaccgcggtcaacgcccgggcggccgagcacgaccggtcgctattcgagcaggtgcgcgactcgctggcggtcgcggtgccgccggaggcgggcacgctgatgtaccagctcgtgcgcgccacccgggccgccaaggtggtggagctggggatgtcgctcggcgtctccacggtctacctcgccgccgccgtgcgcgacaacgggggcgaggggcgggtctacacgaccgagatcgacgaggcgaagatcaagcagggccgcgccaccctggccgacgccggcgtcgccgacctcgtcgaggtgctggagggcgacgcgctccagaccctggactcggtgcccgacggcgtccagttcgtcctgctcgacggctggaacgagagctacctgcgggtgatgaagatcctggagcccaagctcgcgccgggcgccctcgtgctcgccgacgacgtcaacctcttcggcgagggctgcgtggacttcctggagtacgtccgcgaccccgcgaacggctacctgtccgtcaacttcccgatgggcgagggcctggagctcagcatgcgcgtgggctga In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 36, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 36. ukaE In some embodiments, the gene can be encoded by a nucleotide sequence as set forth in SEQ ID NO: 36, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence as set forth in SEQ ID NO: 36.

[0025] ukaE The nucleotide sequence of the gene is set forth in SEQ ID NO: 36: In some embodiments, the nucleic acid molecule comprises a promoter inserted at the 5' end of the gene ukaA gene and ukaB the 5' end of the gene (also referred to as upstream of the gene) can be inserted into a strong promoter (e.g. , rpsLp-cf and the like), ukaC the 5' end of the gene (also referred to as upstream of the gene) can be inserted into a medium strength promoter (e.g. SP23 and the like).

[0026] In some embodiments, the nucleic acid molecule can comprise a promoter inserted at the 5' end of the gene ukaA gene and 。

[0027] In some embodiments, the nucleic acid molecule can comprise a promoter inserted at the 5' end of the gene ukaB gene and rpsLp-cf

[0028] In some embodiments, the nucleic acid molecule can comprise a promoter inserted at the 5' end of the gene . gene and ukaC

[0029] In some embodiments, the promoter can comprise a nucleotide sequence as set forth in SEQ ID NO: 1, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0030] In some embodiments, the promoter SP23 can comprise a nucleotide sequence as set forth in SEQ ID NO: 2, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0031] In some embodiments, the promoter . can comprise a nucleotide sequence as set forth in SEQ ID NO: 3, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto.

[0032] In some embodiments, the nucleic acid has a nucleotide sequence as set forth in SEQ ID NO: 4: According to another aspect of the present application, a vector comprising the nucleic acid molecule of the present application is provided.

[0033] The vector of the present disclosure can be used to induce UK-2A biosynthesis and to increase UK-2A productivity.

[0034] In some embodiments, the vector is a Streptomyces integrative plasmid, and in some embodiments, an E. coli-Streptomyces shuttle vector.

[0035] In some embodiments, the vector can be selected from, but not limited to, pSET152, pSET156, pIJ8600, pIJ8660, pIJ10500, and preferably pSET156.

[0036] In some embodiments, the vector is amplified using bacteria without restriction modification, and more preferably using E. coli ET12567 / pUZ8002 strain.

[0037] According to another aspect of the present application, an engineered bacterium comprising a nucleotide sequence identical or complementary to the nucleic acid molecule of the present application is provided.

[0038] In some embodiments, the engineered bacterium can have increased UK-2A productivity.

[0039] In some embodiments, the engineered bacterium induces UK-2A biosynthesis and increases UK-2A productivity by introducing the vector of the present application.

[0040] In some embodiments, the vector is introduced into the engineered bacterium by conjugative transfer and integrated into the chromosome.

[0041] In some embodiments, the engineered bacterium induces UK-2A biosynthesis and increases UK-2A productivity, comprising the base sequence of the nucleic acid of the present application in each genome.

[0042] In some embodiments, the engineered bacterium is Streptomyces sp. rpsLp-cf ).

[0043] In some embodiments, the engineered bacterium is Streptomyces albus SP23 ).

[0044] In some embodiments, the engineered bacterium is Streptomyces albus Streptomyces sp. ) J1074.

[0045] In some embodiments, the engineered bacteria strain of the present application was deposited with China General Microbiological Culture Collection Center on October 22, 2025, at the address of No. 1, Yikhin West Road, Chaoyang District, Beijing, China, at the Institute of Microbiology of Chinese Academy of Sciences, and the deposit number is CGMCC No. 36295.

[0046] According to another aspect of the present application, a method for preparing the engineered bacteria of the present application is provided.

[0047] In some embodiments, the CRISPR / Cas9 in vitro editing system is used to edit the UK-2A biosynthetic gene cluster in the engineered bacteria of the present application. Streptomyces albus Inserting a constitutive strong promoter at the 5' end of the gene Streptomyces albus In some embodiments, the constitutive strong promoter is inserted at the 5' end of the gene ukaB Inserting a medium strength promoter at the 5' end of the gene rpsLp-cf .

[0048] In some embodiments, the sgRNA used by the CRISPR / Cas9 has one or more of the following sequences: GTTGTGCTCCTCGGGTCGTT (SEQ ID NO: 6); ATGCACCTTCCACGTCGTTG (SEQ ID NO: 7).

[0049] In some embodiments, the sgRNA as shown in SEQ ID NO: 6 is the sgRNA sequence targeting ukaC the upstream of the gene.

[0050] In some embodiments, the sgRNA as shown in SEQ ID NO: 7 is the sgRNA sequence targeting SP23 the upstream of the gene.

[0051] According to another aspect of the present application, a method for producing UK-2A is provided, the method comprising: fermenting the engineered bacteria of the present application, and collecting UK-2A from the culture of the engineered bacteria.

[0052] According to another aspect of the present application, the nucleic acid molecule, vector or engineered bacteria of the present application is provided for use in the production of the antifungal antibiotic UK-2A.

[0053] In the present application, by adding a promoter in front of the UK-2A biosynthetic gene cluster ukaB the gene In some embodiments, the medium strength promoter is inserted at the 5' end of the gene ukaC the gene ukaA In some embodiments, the medium strength promoter is inserted at the 5' end of the gene ukaB the gene rpsLp-cfThe UK-2A biosynthetic gene cluster is restructured in a manner, and is connected to the integrated plasmid vector pSET156 to construct an expression vector containing the restructured UK-2A gene cluster, the expression vector is introduced into Streptomyces albus J1074, and UK-2A is produced in a high yield by using a preferred fermentation medium, so that the shake flask fermentation yield of UK-2A can reach more than 1500 μg / mL, which is greatly improved compared with the engineered bacteria containing the UK-2A gene cluster before restructuring (the yield is about 400 μg / mL), so that it can be practically used for the fermentation production of UK-2A. BRIEF DESCRIPTION OF DRAWINGS

[0054] ukaC The assembly strategy of the UK-2A biosynthetic gene cluster in Example 1 is shown; SP23 The schematic diagram of the restructured UK-2A biosynthetic gene cluster in Example 1 is shown; Figure 1 The UK-2A shake flask fermentation units of Streptomyces albus engineered bacteria J1074 / uk-2A and in Example 3 are shown. DETAILED DESCRIPTION

[0055] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with the drawings and examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present application. Such structures and technologies are also described in many publications.

[0056] Figure 2 Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The following definitions are applied to the descriptions and claims herein and, unless otherwise specified, terms used in the specification and claims include both singular and plural data. As used herein, the following terms have the following meanings.

[0057] Unless the context clearly indicates otherwise, as used herein, the construction “a,” “an” and “one” includes plural references unless the context clearly indicates otherwise. For example, a reference to “a cell” includes a plurality of such cells, as well as equivalents thereof known to those skilled in the art, and so forth.

[0058] As used herein, the term “about” means a range of ±20% of the value that follows. In some embodiments, the term “about” means a range of ±10% of the value that follows. In some embodiments, the term “about” means a range of ±5% of the value that follows.

[0059] The term "vector" as used herein refers to a nucleic acid sequence capable of transporting another nucleic acid to which it is linked to a cell. The term "expression vector" includes any vector that contains a gene construct in a form suitable for expression by a cell (e.g., linked to transcriptional regulatory elements) such as a plasmid, cosmid, phage, bacterial artificial chromosome, yeast artificial chromosome, P1 -derived artificial chromosome. The "vector" can be a plasmid or a viral vector, such as a retroviral vector and a lentiviral vector. Furthermore, the present application is intended to include other vectors which can perform the same function.

[0060] The term "streptomyces" as used herein refers to a group of high G+C content gram-positive bacteria, commonly found in soil, also present in water, sludge, air, food, and on and in the bodies of plants and animals. Streptomyces have developed complex mechanisms of morphological differentiation and physiological metabolic pathways during evolution, and are capable of producing a wide variety of antibiotics.

[0061] The term "plasmid" as used herein refers to a replicable DNA construct. Typically, a plasmid vector contains a selectable marker gene, which allows for the identification and / or selection of host cells carrying the plasmid as positive or negative in the presence of a compound corresponding to the selectable marker. A variety of positive and negative selectable marker genes are known in the art. By way of illustration, an antibiotic resistance gene can be used as a positive selectable marker gene for selecting host cells in the presence of the corresponding antibiotic.

[0062] The term "host cell" as used herein is intended to mean a cell comprising a gene according to the present application. Preferably, the expression of the gene according to the present application is enhanced in the host cell. Preferably, the host cell is capable of synthesizing UK-2A (CAS number 167173-85-5). The host cell can consist of a single type of cell or a group of different types of cells. The host cell can also be a hybrid cell, that is to say, a cell resulting from the fusion of at least two different types of cells. The host cell can belong to a cultured cell line, a primary cell, a stem cell or a proliferating cell.

[0063] The term "nucleic acid" as used herein refers to a polymer comprised of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants and synthetic non-naturally occurring analogs thereof) linked by phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.

[0064] The term "protein / polypeptide" as used herein refers to a protein encoded by a nucleic acid molecule, including polypeptide fragments, mutants and homologues. The protein or polypeptide according to the present application is produced by expression of a recombinant nucleic acid molecule.

[0065] As used herein, the term "recombinant protein" refers to a polypeptide prepared using recombinant DNA technology. Examples of such technologies include inserting DNA encoding the expressed protein into a suitable expression vector, which is then used to transform host cells to produce the protein or polypeptide encoded by the DNA.

[0066] The term "UK-2A" as used in this article refers to a macrolide antibiotic with the chemical formula C. 26 H 30 N₂O₉, CAS number 167173-85-5, has a relative molecular mass of 514. In 1996, Ueki et al. obtained... Figure 3 Four nine-membered dilactone compounds, namely UK-2A, B, C, and D, were isolated from the fermentation broth of sp. 517-02, with UK-2A being the main component. The UK-2A biosynthetic gene cluster is a set of genes involved in the biosynthesis of the antifungal antibiotic UK-2A. Its core function is to form dilactone compounds with antifungal activity through a hybrid nonribosomal peptide synthase (NRPS) / polyketide synthase (PKS) pathway.

[0067] For nucleic acid or amino acid sequences, the term "sequence identity" as used herein refers to the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to a known amino acid or nucleic acid sequence after aligning the sequence to the maximum percentage of identity and introducing gaps where necessary to achieve the maximum percentage of homology. For amino acid sequences, N-terminal or C-terminal insertions or deletions should not be interpreted as affecting homology, and internal deletions and / or insertions of fewer than about 65, 60, 50, 40, 30, 20, or 10 amino acid residues should not be interpreted as affecting the homology of the compared amino acid (protein) sequences. For nucleic acid sequences, insertions or deletions at the 5′ or 3′ ends should not be interpreted as affecting homology, and internal deletions and / or insertions of less than approximately 200, 180, 150, 120, 100, 90, 80, 70, 60, 50, 40, or 30 nucleotides should not be interpreted as affecting the homology of the compared nucleic acid sequences. Homology or identity at the nucleotide or amino acid sequence level can be determined by BLAST analysis using algorithms customized for sequence similarity searches using blastp, blastn, blastx, tblastn, and tblastx programs.

[0068] The basic principle of CRISPR / Cas9 gene editing technology is to use artificially designed sgRNA (single guide RNA) to recognize the target gene sequence and guide the Cas9 protease to effectively cut the DNA double strand, forming a double-strand break. Repair after damage can result in gene knockout or knock-in, ultimately achieving the goal of modifying the genomic DNA. CRISPR / Cas9 gene editing technology has two main applications: ① Gene knockout: A double-strand break (DSB) is introduced into the target gene using CRISPR / Cas9. The cell repairs the break through the non-homologous end joining (NHEJ) repair mechanism. This process may introduce insertion or deletion mutations, leading to the loss of function of the target gene. ② Gene insertion or replacement (Knockin): Utilizing the homologous recombination (HDR) mechanism, specific mutations or foreign sequences are introduced into the target gene.

[0069] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions and methods, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer.

[0070] Example Example 1: Construction of an expression vector containing the reconstructed UK-2A biosynthetic gene cluster 1. Assembly of the UK-2A biosynthetic gene cluster Because the UK-2A biosynthetic gene cluster includes Definitions Streptomyces The full-length fragment was quite long (~31 kb), so it was sent to the company to be divided into 7 fragments for separate synthesis (named fragments 1-7). Each fragment was 4-5 kb long, and adjacent fragments contained approximately 35 bp homologous arms. During synthesis, the first gene... ukaA, ukaQ, ukaP, ukaK, ukaH, ukaF, ukaL, ukaR, (Presumably a pathway-specific positive regulatory gene) Add a constitutive strong promoter from Streptomyces. (tgttcacattcgaaccgtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaatacgacagtctaagtaaggagtgtccat, SEQ ID NO: 1), with a total length of 31416 bp.

[0071] The fragments 1, 2, 3, fragments 4, 5, fragments 6, 7 were connected with plasmid pSET156 respectively by the first round of Gibson assembly, to obtain fragments 1-3, fragments 4-5, fragments 6-7. Then the second round of Gibson assembly was carried out, and the obtained three fragments were connected with plasmid pSET156 to obtain plasmid pSET156-uk-2A containing the UK-2A biosynthetic gene cluster with promoter The assembly strategy of the UK-2A biosynthetic gene cluster with promoter is shown in ukaO, ukaM, ukaB, ukaD, ukaC, ukaG, ukaI, ukaJ, ukaN, ukaE, . Among them, plasmid pSET156 was constructed according to the method described in the literature (see Li Xingwang et al. Metabolic engineering of Streptomyces roseosporus for improving the production of important clinical antibiotic daptomycin. Journal of Microbial & Bio-technol, 2024, 17(11): e70038).

[0072] 2. Reconfiguration of UK-2A biosynthetic gene cluster 1) Using the CRISPy-web website (https: / / crispy.secondarymetabolites.org), the appropriate target cutting sgRNA sequence was designed in front of the ukaA and Figure 1 genes in the above synthesized UK-2A biosynthetic gene cluster, and the PCR primers were designed according to the requirements of HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA), as shown in Table 1: Table 1

[0073] 2) Overlapping PCR was performed using primers ZYF1A / ZYF1B / ZYF1D to obtain the primary sgRNA-B-DNA sequence as follows (the underlined part is the sgRNA sequence targeting the 5' end of the ukaB gene SEQ ID NO: 6): AGCTAATACGACTCACTATAGG ukaC GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO: 13); Overlapping PCR was performed using primers ZYF1A / ZYF1C / ZYF1D to obtain the primary sgRNA-C-DNA sequence as follows (the underlined part is the sgRNA sequence targeting the 5' end of the ukaB gene SEQ ID NO: 7): AGCTAATACGACTCACTATAGG GTTGTGCTCCTCGGGTCGTT GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO: 14).

[0074] PCR reaction conditions: 95°C, 3 min; (95°C, 15 s; 56°C, 15 s; 72°C, 15 s) for 15 cycles; 72°C, 5 min; 25°C, 1 min.

[0075] 3) The above-obtained primary sgRNA-B-DNA (SEQ ID NO: 13) and sgRNA-C-DNA (SEQ ID NO: 14) were used as templates, respectively, and primer pair ZYF1E (SEQ ID NO: 11) / ZYF1F (SEQ ID NO: 12) was used for amplification to obtain 122 bp sgRNA-B-DNA transcription template and 122 bp sgRNA-C-DNA transcription template.

[0076] PCR reaction conditions: 95°C, 3 min; (95°C, 15 s; 56°C, 15 s; 72°C, 15 s) for 29 cycles; 72°C, 5 min; 25°C, 1 min. The PCR products were detected by electrophoresis, and specific amplification bands were observed at the corresponding size, and sequencing was correct.

[0077] 4) The sgRNA-B-DNA and sgRNA-C-DNA were transcribed in vitro using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA) to obtain sgRNA-B and sgRNA-C RNA products, and purified using RNAclean RNA Kit (Biomed, China).

[0078] Amplification of promoter ukaC SEQ ID NO: 2) and ATGCACCTTCCACGTCGTTG The PCR primers required for the fragments of (SEQ ID NO: 3) are shown in Table 2: Table 2

[0079] Promoter rpsLp-cfThe nucleotide sequence of the promoter fragment (SEQ ID NO: 2) is shown as follows: cccgccgcgg gcgctggagg ctcgggcggg cccgggcccg gaggcggccg cgaccacgac gcccgcggga cggtgacgag cggcacgact cgacgactcc gggctccttt gacgctgtc cgtcgcgccc gggtgcgtcg ggacaccgt gcccgccgtc gggccctcgc gcgtgcactc ggtcgaccgc tccctgccgg agtgggtgcg ggtgcacggg gtggctcccc acctcctctc ggatcggtcc tcgcggactg ccgccgtgcg gaggaccggg gcgacacgcc cgggcgcggg ggtcggtgcg ggactccaga cctccggggt agtcgtgcga cgggcgacga tccgggccga gccggccgtc ctgggtgacg ggtgccggtc agaccagaga a.

[0080] Promoter SP23 The nucleotide sequence of the promoter fragment (SEQ ID NO: 2) is shown as follows: tgttcacattcgaaccgtctctgctttgacaacatgctgtgcggtgttgtaaagtcctgctaa.

[0081] The 399 bp SP2 promoter fragment (SEQ ID NO: 2) was amplified from the plasmid containing the promoter fragment synthesized by Beijing Qianke Biotechnology Co., Ltd. using primer pair ZYF2A (SEQ ID NO: 15) / ZYF2B (SEQ ID NO: 16). rpsLp-cf The 63 bp SP23 promoter fragment (SEQ ID NO: 3) was amplified from the plasmid containing the promoter fragment synthesized by Beijing Qianke Biotechnology Co., Ltd. using primer pair ZYF3A (SEQ ID NO: 17) / ZYF3B (SEQ ID NO: 18).

[0082] 5) Targeted cleavage of pSET156-uk-2A plasmid with Cas9 protein, cleavage system contains: 10 μL buffer (20 mM HEPES, 150 mM KCl, 10 mM MgCl2, 0.1 mM EDTA (pH 7.5)), 5 μL 10 mM DTT, 8 μg sgRNA-B (RNA), 1 μg Cas9 protein, 5 μg pSET156-uk-2A plasmid and DEPC H2O (diethyl pyrocarbonate treated water) (up to 100 μL), reaction at 37°C for 5 h. Gibson assembly was used to connect the promoter fragments to the Cas9 cleaved plasmid pSET156-uk-2A, to obtain the reconstructed UK-2A gene cluster on the expression vector prpsLp-A-uk-2A. SP23 Promoter fragments were connected to the Cas9 cleaved plasmid pSET156-uk-2A, to obtain the reconstructed UK-2A gene cluster on the expression vector prpsLp-A-uk-2A. rpsLp-cf The expression vector prpsLp-B-uk-2A with the promoter of the first gene of the UK-2A gene cluster.

[0083] Targeted cleavage of prpsLp-B-uk-2A plasmid with Cas9, cleavage system contains: 10 μL buffer, 5 μL 10 mM DTT, 8 μg sgRNA-C (RNA), 1 μg Cas9 protein, 5 μg prpsLp-B-uk-2A plasmid and DEPC H2O (up to 100 μL), reaction at 37°C for 5 h. Gibson assembly was used to connect the promoter fragments to the Cas9 cleaved plasmid prpsLp-B-uk-2A, to obtain the reconstructed UK-2A gene cluster on the expression vector prpsLp-B-uk-2A. rpsLp-cf Promoter fragments were connected to the Cas9 cleaved plasmid prpsLp-B-uk-2A, to obtain the reconstructed UK-2A gene cluster on the expression vector prpsLp-B-uk-2A. ukaB and SP23 The expression vector prpsLp-B-uk-2A with the promoter of the first gene of the UK-2A gene cluster. Since the promoter of the first gene ukaB was added when synthesizing the UK-2A gene cluster, the expression vector contains the promoter of the first gene of the UK-2A gene cluster, the promoters of the second gene ukaC , ukaA and ukaA of the UK-2A gene cluster were reconstructed, and the schematic diagram of the reconstructed UK-2A biosynthetic gene cluster is shown in ukaB .

[0084] Example 2 Conjugative transfer of UK-2A biosynthetic gene cluster expression vector The expression vector pSET156-uk-2A containing the UK-2A biosynthetic gene cluster and the expression vector containing the reconstructed UK-2A biosynthetic gene cluster were constructed by Example 1.

[0085] In this embodiment, *Streptomyces albopictus* J1074 was selected as the starting strain for conjugation transfer. J1074 was inoculated onto DA1 solid medium for activation and cultured at 28°C for 7 days. The strain containing the expression vector pSET156-uk-2A or... After activation by LB agar plate culture, *Escherichia coli* ET12567 / pUZ8002 was inoculated into 5 mL of LB liquid medium containing 100 μg / mL apramycin and cultured overnight at 37°C with shaking at 220 rpm. 50 μL of the cultured bacterial suspension was then inoculated into 5 mL of LB liquid medium containing 100 μg / mL apramycin and cultured at 37°C with shaking at 220 rpm until the OD600 reached 0.5. 1 mL of the bacterial suspension was transferred to a sterile 1.5 mL centrifuge tube and centrifuged at 12000 rpm for 2 minutes to collect the bacterial cells, discarding the supernatant. The bacterial cells were resuspended in 1 mL of pre-chilled LB liquid medium and centrifuged at 12000 rpm for 2 minutes to collect the bacterial cells, discarding the supernatant (this step was repeated once). Fresh spores of *Streptomyces albopictus* J1074 grown on DA1 solid medium were collected into 1 mL 20% glycerol tubes. 200 μL of the spore suspension was heat-shocked in a 50°C water bath for 10 minutes. 800 μL of 2×YT liquid medium was added, and the mixture was incubated at 37°C with shaking at 220 rpm for 2 hours and 45 minutes. 400 μL of the cultured spore suspension was used to resuspend the collected *E. coli* cells. The mixture was placed on ice for 30 minutes and then allowed to stand at room temperature for 10 minutes. 200 μL of the mixture was spread onto M2CY solid medium and incubated upside down at 28°C for 14 hours. 1 mL of sterile water containing 1 mg of nalidixic acid and 2 mg of apramycin was added, and the mixture was spread evenly. The mixture was then incubated upside down at 28°C for another 6-7 days. Single colonies were identified by colony PCR. After successful PCR verification, the engineered *Streptomyces albopictus* strain J1074 / uk-2A containing the corresponding expression vector was obtained. .

[0086] In this embodiment, the compositions of LB medium, DA1 solid medium, 2×YT medium, and M2CY solid medium are as follows: ①LB medium: NaCl 10 g / L, yeast extract 5 g / L, tryptone 10 g / L, adjust pH to 7.0, and add 16 g / L agar powder to the solid medium.

[0087] ②DA1 solid culture medium: yeast extract 4 g / L, malt extract 10 g / L, glucose 4 g / L, CaCO3 2 g / L, agar powder 16 g / L, adjust pH to 7.0.

[0088] ③ 2×YT medium: tryptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, adjust pH to 7.0.

[0089] (4) M2CY solid medium: soluble starch 10 g / L, tryptone 2 g / L, NaCl 1 g / L, (NH4)2SO4 2 g / L, K2HPO4 1 g / L, CaCO3 2 g / L, trace elements 1 mL, agar powder 16 g / L, pH adjusted to 7.2. After sterilization, the following sterilized solutions were added to each 100 mL of medium: MgCl2-6H2O (2.5 M) 2.4 mL, CaCl2 (2.5 M) 2.4 mL.

[0090] The trace elements include: FeSO4-7H2O 0.01 g, MgCl2-6H2O 0.01 g, ZnSO4-7H2O 0.01 g dissolved in deionized water, and then diluted to 10 mL.

[0091] Example 3 Fermentation of engineered S. albus to produce UK-2A 1. Flask fermentation of engineered S. albus Seed medium: soluble starch 30 g / L, soybean peptone 3 g / L, malt extract 2 g / L, NaCl 1 g / L, CaCO3 2 g / L, pH adjusted to 7.0-7.2.

[0092] Fermentation medium: corn starch 50 g / L, soybean meal 12 g / L, K2HPO4-3H2O 0.5 g / L, MgSO4-7H2O 0.5 g / L, CoCl2-6H2O 5 mg / L, CaCO3 2 g / L, KCl 4 g / L, pH adjusted to 7.0-7.2.

[0093] 2. HPLC analysis of UK-2A in fermentation product (1) Sample treatment: 1.0 mL of fermentation broth was taken and 4.0 mL of acetone was added. The mixture was soaked for more than 30 minutes, and shaken every 10 minutes. The mixture was centrifuged at 12,000 rpm for 10 minutes, and the supernatant was taken for analysis.

[0094] (2) HPLC analysis conditions: C18 reversed-phase column, column length 250 mm, column inner diameter 4.6 mm, mobile phase acetonitrile: water (60:40, v / v), flow rate 1.0 mL / min, sample volume 20 μL, wavelength 300 nm.

[0095] 3. Fermentation results of engineered S. albus Engineered S. albus J1074 / uk-2A and After the spores were grown abundantly on the DA1 medium, they were inoculated into the seed culture medium (40 mL / 500 mL flask) and cultured at 28°C for 48 hours (rotation speed 230 rpm, eccentricity 1.8 cm). The fermentation medium (40 mL / 250 mL flask) was inoculated at a 5% v / v inoculation amount, and cultured at 28°C for 10 days (rotation speed 250 rpm, eccentricity 2.5 cm). After the flask was opened and extracted with acetone, the fermentation units of UK-2A were determined by HPLC, and the results are shown in Table 1. ukaC

[0096] The flask fermentation results show that, compared with the engineering bacteria J1074 / uk-2A containing the UK-2A biosynthetic gene cluster before reconstitution, the engineering bacteria containing the reconstituted gene cluster have a significantly increased UK-2A yield (1516 μg / mL), which is 2.63 times higher than the yield of the starting strain (418 μg / mL). Figure 2 Figure 3 Figure 3 This indicates that the reconstitution of the UK-2A biosynthetic gene cluster significantly promotes the synthesis of UK-2A. The obtained engineering bacteria were preserved in the China General Microbiological Culture Collection Center on October 22, 2025, at the address of No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology of the Chinese Academy of Sciences, with the preservation number of CGMCC No. 36295.

[0097] As can be seen from the above examples, the present application provides an engineering bacteria for efficiently producing UK-2A and a preparation method thereof. The engineering bacteria is obtained by introducing an expression vector containing a reconstituted UK-2A biosynthetic gene cluster into a host bacteria Streptomyces albus J1074, thereby significantly improving the UK-2A yield. The engineering bacteria strain provided by the present application can be used in the fermentation production of UK-2A in practice, improve the fermentation yield of UK-2A, and reduce the production cost.

[0098] The technical solutions of the present application are not limited to the above specific examples, and any technical variations made according to the technical solutions of the present application fall within the protection scope of the present application.​​

Claims

1. An isolated nucleic acid molecule, said nucleic acid molecule comprising at least one selected from the following nucleic acids: ukaA Gene ukaQ Gene ukaP Gene ukaK Gene ,ukaH Gene ,ukaF Gene ,ukaL Gene ukaR Gene 、 ukaO Gene ukaM Gene ukaB Gene ,ukaD Gene ,ukaC Gene ukaG Gene ,ukaI Gene ,ukaJ Gene ukaN Gene or ukaE Gene.

2. The nucleic acid molecule according to claim 1, characterized in that, The nucleic acid includes, from the 5' end to the 3' end, the following sequentially: ukaA Gene ukaQ Gene ukaP Gene ukaK Gene ,ukaH Gene ,ukaF Gene ,ukaL Gene ukaR Gene ,ukaO Gene 、 ukaM Gene ukaB Gene ,ukaD Gene ,ukaC Gene ukaG Gene ,ukaI Gene ,ukaJ Gene ukaN Genes and ukaE Gene; Preferably, the ukaA The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 19, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

19. Preferably, the ukaQ The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 20, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

20. Preferably, the ukaP The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 21, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

21. Preferably, the ukaK The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 22, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

22. Preferably, the ukaH The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 23, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

23. Preferably, the ukaF The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 24, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

24. Preferably, the ukaL The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 25, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

25. Preferably, the ukaR The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 26, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

26. Preferably, the ukaO The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 27, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

27. Preferably, the ukaM The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 28, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

28. Preferably, the ukaB The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 29, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

29. Preferably, the ukaD The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 30, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

30. Preferably, the ukaC The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 31, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

31. Preferably, the ukaG The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 32, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

32. Preferably, the ukaI The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 33, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

33. Preferably, the ukaJ The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 34, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

34. Preferably, the ukaN The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 35, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

35. Preferably, the ukaE The gene is encoded by a nucleotide sequence as shown in SEQ ID NO: 36, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:

36.

3. The nucleic acid molecule according to claim 1 or 2, characterized in that, In the nucleic acid molecule, ukaA Genes and ukaB A strong promoter is inserted at the 5' end of the gene. ukaC A moderate-strength promoter is inserted at the 5' end of the gene; Preferably, the nucleic acid molecule includes ukaA Insert a promoter at the 5' end of the gene ; Preferably, the promoter It may include a nucleotide sequence as shown in SEQ ID NO: 1, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; Preferably, the nucleic acid molecule includes ukaB Insert a promoter at the 5' end of the gene rpsLp-cf ; Preferably, the promoter rpsLp-cf It may include a nucleotide sequence as shown in SEQ ID NO: 2, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; Preferably, the nucleic acid molecule includes ukaC Insert a promoter at the 5' end of the gene SP23 ; Preferably, the promoter SP23 It may include a nucleotide sequence as shown in SEQ ID NO: 3, or a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it; Preferably, the nucleic acid has a nucleotide sequence as shown in SEQ ID NO:

4.

4. A vector comprising the nucleic acid molecule according to any one of claims 1-3.

5. The carrier according to claim 4, characterized in that, The vector is used to induce UK-2A biosynthesis and improve UK-2A productivity; Preferably, the vector is a Streptomyces integrative plasmid, and more preferably an Escherichia coli-Streptomyces shuttle vector; Preferably, the carrier can be selected from, but is not limited to, pSET152, pSET156, pIJ8600, pIJ8660, and pIJ10500, with pSET156 being the most preferred.

6. An engineered bacterium whose nucleic acid comprises the same base sequence as the nucleic acid molecule of any one of claims 1-3 or a base nucleotide sequence complementary to said sequence.

7. The engineered bacteria according to claim 6, characterized in that, The engineered bacteria can improve UK-2A productivity; Preferably, the engineered bacteria is a Streptomyces genus ( Streptomyces sp. ); Preferably, the engineered bacteria is *Streptomyces albopictus* (…). Streptomyces albus ); Preferably, the engineered bacteria is *Streptomyces albopictus* (…). Streptomyces albus J1074; Preferably, the engineered bacterial strain was deposited on October 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36295.

8. A method for preparing the engineered bacteria according to claim 6 or 7.

9. The method according to claim 8, characterized in that, The method utilizes CRISPR / Cas9 in vitro editing... ukaB A constitutive strong promoter is inserted at the 5' end of the gene. rpsLp-cf ,exist ukaC A moderate-strength promoter is inserted at the 5' end of the gene. SP23 ; Preferably, the sgRNA used by the CRISPR / Cas9 has one or more of the sequences shown in SEQ ID NO: 6 and SEQ ID NO: 7: Preferably, the sgRNA shown in SEQ ID NO: 6 is the target RNA. ukaB The sgRNA sequence preceding the gene; Preferably, the sgRNA shown in SEQ ID NO: 7 is the target RNA. ukaC The sgRNA sequence preceding the gene.

10. The use of the carrier of claim 4 or 5 or the engineered bacteria of claim 6 or 7 in the production of the antifungal antibiotic UK-2A.

Images