Application of PagXTH9 gene in regulation and control of adventitious root regeneration of woody plant and gene editing method of PagXTH9 gene

Abstract

The invention discloses application of a PagXTH9 gene in regeneration of an adventitious root of a woody plant, and belongs to the technical field of genetic engineering and forest breeding. A PagXTH9 gene in Populus alba * Populus glabullosa is subjected to targeted knockout through a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR associated protein 9) system, and a mutant of which the adventitious root forming ability is remarkably reduced is obtained. Experiments prove that PagXTH9 plays an important role in regulating and controlling the adventitious root development process of populus plants. The invention also provides a gene editing method, a specific gRNA sequence, an editing vector and a mutant material, which are suitable for root development research of woody plants and breeding of forest varieties with specific rooting characters.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and molecular breeding technology of forest trees, specifically to the application of the PagXTH9 gene in the regulation of adventitious root regeneration in woody plants, especially poplars, and a genetic improvement method based on this gene. Background Technology

[0002] In modern forestry breeding and propagation systems, Populus spp., as typical fast-growing timber and ecological greening species, are widely used in ecological construction, industrial raw materials, and urban greening. In particular, the silver gland poplar (Populus alba × Populus glandulosa) is widely promoted in northern and central-eastern my country due to its rapid growth, strong adaptability, lack of fluff, and ease of propagation by cuttings.

[0003] However, despite poplar's remarkable ability to form adventitious roots, the efficiency of its cutting rooting is still influenced by various factors, including genetic background, environmental conditions, hormonal response, and cell wall remodeling ability. In actual production, even cuttings of the same variety can exhibit significant differences in rooting rate and root quantity, severely impacting the consistency and efficiency of seedling production. Therefore, exploring the regulatory factors closely related to adventitious root development, especially key genes that can be precisely regulated through molecular means, is one of the core challenges in current research and breeding engineering in forest tree rooting biology.

[0004] In the formation of adventitious roots in plants, cell wall relaxation and reconstruction are considered key events occurring in the early stages. XTH (xyglucan endoglucanase / hydrolase) family genes, as important members of cell wall remodeling enzymes, regulate the rearrangement and fragmentation of xyglucan in the cell wall, thereby participating in multiple biological processes such as cell elongation, organ development, and stress response. Among them, the XTH9 gene has been reported to affect root tip cell expansion and morphogenesis in herbaceous plants, but its function in regulating adventitious root formation in woody plants, especially in poplars, has not been systematically elucidated.

[0005] Currently, no publicly available literature clearly reveals the function and genetic regulatory role of the PagXTH9 gene in adventitious root regeneration of woody plants. Traditional molecular breeding methods mostly rely on hormone treatment or QTL mapping, while targeted editing techniques for functional genes still lack a practical basis. Therefore, there is an urgent need to establish a molecular intervention mechanism based on target genes to enhance the ability to regulate the development of adventitious roots in poplar, thereby promoting efficient seedling production and the selection and propagation of superior clonal varieties. Summary of the Invention

[0006] To overcome the lack of targeted modification methods for key regulatory genes in woody plant root development in existing technologies, and the unstable regeneration efficiency of adventitious roots in cutting propagation, this invention provides a technical solution for editing the PagXTH9 gene based on the CRISPR / Cas9 system. By constructing a specific editing vector and achieving gene knockout in *Populus alba*, a mutant with significantly altered root development capacity was obtained, verifying the positive regulatory role of this gene in adventitious root formation. This enriches the methods for studying the molecular mechanisms of root development and provides a new technical approach for precision breeding of forest tree varieties.

[0007] In one embodiment of the present invention, an application of the PagXTH9 gene or the protein encoded therein in regulating the regeneration of adventitious roots in woody plants is provided, wherein the nucleotide sequence of the PagXTH9 gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the application is to achieve an alteration of the adventitious root regeneration capacity by targeting and editing the PagXTH9 gene.

[0008] Furthermore, the woody plant is a poplar, preferably Populus alba × Populus glandulosa.

[0009] In one embodiment of the present invention, a method is provided for obtaining a poplar mutant with an altered phenotype and adventitious root regeneration ability, comprising targeting and editing the PagXTH9 gene shown in SEQ ID NO: 1 or SEQ ID NO: 2 using a CRISPR / Cas9 system, wherein the CRISPR / Cas9 system contains gRNA and its target sequence comprises a nucleotide sequence as shown in SEQ ID NO: 3 or its complementary sequence.

[0010] Furthermore, the method includes the following steps: (a) Construct a CRISPR / Cas9 gene editing vector containing a gRNA expression unit, wherein the gRNA is capable of specifically recognizing the target sequence of the PagXTH9 gene; (b) Introduce the vector into sterile explants of Populus species; (c) Transformed tissues were cultured, screened, and rooted to obtain mutant plants with PagXTH9 gene loss of function.

[0011] Preferably, in step (a), the primer pair used to amplify the PagXTH9 gene editing site is selected from one of the following combinations: (i) SEQ ID NO: 4 and SEQ ID NO: 5; (ii) SEQ ID NO: 6 and SEQ ID NO: 7.

[0012] In one embodiment of the present invention, a poplar mutant obtained by the above method is provided, wherein the PagXTH9 gene locus shown in SEQ ID NO: 1 and / or SEQ ID NO: 2 has a base insertion or deletion mutation, thereby causing the gene function to be partially or completely suppressed.

[0013] Furthermore, the mutant is a homozygous biallelic mutant of *Populus alba*, wherein a base T or A is inserted at SEQ ID NO: 1 and a base T is inserted at SEQ ID NO: 2.

[0014] Alternatively, the adventitious root regeneration ability of the mutant is significantly reduced compared to the wild type, making it suitable for studying the root development mechanism of Populus species and for targeted breeding.

[0015] In one embodiment of the present invention, a gRNA molecule for targeting and editing the PagXTH9 gene is also provided, the targeting sequence of which comprises the nucleotide sequence shown in SEQ ID NO: 3 or its complementary sequence, and the gRNA is suitable for CRISPR / Cas9 system to achieve specific cleavage of the PagXTH9 gene.

[0016] Furthermore, a CRISPR / Cas9 gene editing system or recombinant expression vector is provided, which contains the above-mentioned gRNA molecule for targeted editing of the PagXTH9 gene in woody plants.

[0017] In one embodiment of the present invention, the Populus mutant with PagXTH9 gene loss of function can be used to breed tree varieties with specific rooting characteristics and plant type regulation capabilities, thereby improving propagation uniformity and seedling efficiency.

[0018] Based on the above technical solution, the application of the PagXTH9 gene in the regulation of adventitious root regeneration in woody plants of the present invention was achieved by targeting and editing the gene sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 to construct a PagXTH9 gene-deficient poplar mutant. Experiments showed that the mutant exhibited a significantly reduced adventitious root regeneration rate and a reduced number of roots, indicating that PagXTH9 plays an important role in regulating the occurrence of adventitious roots in poplar plants.

[0019] This invention clarifies for the first time the function of the PagXTH9 gene in root development of Populus species, providing new evidence for understanding the molecular mechanisms of root organogenesis in woody plants. Precise knockout of this gene using the CRISPR / Cas9 system yielded a biallelic homozygous mutant with stable phenotype and well-defined genetic characteristics, possessing the potential to serve as a material for functional studies and a breeding vector.

[0020] The method of this invention is simple and efficient, and is suitable for laboratories and breeding enterprises to verify gene function and innovate germplasm resources of Populus species. Compared with traditional cutting propagation methods, the PagXTH9 functional mutant can artificially regulate the adventitious root formation process, improve the consistency of seedling quality, and solve the problems of unstable rooting and strong environmental dependence in the current large-scale propagation of Populus.

[0021] Furthermore, by publicly defining the target sequence and specific primers of PagXTH9, this invention also provides a gRNA design strategy, detection and identification method, and expression vector construction system, which has strong reproducibility and scalability, and can be used in other Populus species or woody plants, providing a new technical path for targeted breeding of forest trees and regulation of root development.

[0022] In summary, this invention not only reveals the biological function of the PagXTH9 gene in regulating adventitious root regeneration, but also establishes a stable and reproducible gene editing and identification system, providing important technical support and theoretical basis for constructing high-quality new tree varieties and improving the efficiency of cutting propagation. Attached Figure Description

[0023] Figure 1 The image shows the sequencing results of the PagXTH9 gene knockout lineage, indicating the mutation status at the target gene editing site, signifying successful knockout.

[0024] Figure 2 The graph shows the rooting rate of wild-type Populus aurea and PagXTH9 mutant, illustrating the differences in rooting initiation time and rate among different plants under the same conditions.

[0025] Figure 3 The graph shows the number of roots formed by wild-type *Populus silveraefolia* and the PagXTH9 mutant, comparing the number of adventitious roots formed by each mutant to characterize the changes in rooting ability.

[0026] Figure 4 These are rooting phenotype images of wild-type *Populus simonii* and the PagXTH9 mutant. Through direct morphological observation, the effect of gene knockout on adventitious root formation can be further verified. Detailed Implementation

[0027] To better understand the technical solution and implementation of the present invention, the application of the PagXTH9 gene in the regulation of adventitious root regeneration in woody plants and its gene editing method are described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the described embodiments are only for illustrating the technical principles of the present invention and do not constitute a limitation on the scope of protection of the present invention. Without departing from the essential content of the present invention, those skilled in the art can make appropriate modifications or substitutions, and these equivalent forms should also be covered within the scope of protection of the present invention.

[0028] I. Preparation of Materials and Methods 1. Experimental Materials The materials and reagents used in the implementation of this invention are as follows: Plant material: Aseptic tissue culture seedlings of Populus alba × Populus glandulosa (also known as 84K poplar) were obtained from 4-week-old tissue culture seedlings in good growth condition and were used as experimental materials for genetic transformation and phenotypic analysis.

[0029] Main reagents and tools: CRISPR / Cas9 editing vector system: pYLCRISPR / Cas9 (binary expression vector containing Cas9 nuclease and gRNA expression framework); Agrobacterium strain: Agrobacterium tumefaciens GV3101; Antibiotics: Kanamycin (50 mg / L), Rifampicin (50 mg / L), Hygromycin (3 mg / L), used for Agrobacterium screening and transformant selection; Culture medium: LB liquid and solid media: used for Agrobacterium proliferation; Co-culture medium, selection medium, differentiation medium, and rooting medium; MS basal medium: used for tissue culture of *Populus alba*, the formula is 1 / 2 MS base + 30 g / L sucrose + 8 g / L agar powder, pH adjusted to 5.8.

[0030] Experimental equipment: clean bench, autoclave, PCR amplifier, agarose gel electrophoresis system, enzyme digestion and ligation kit, temperature-controlled shaking incubator, etc.

[0031] All of the above materials are readily available to those skilled in the art, and their preparation and usage can be found in the General Molecular Biology Experiment Manual.

[0032] 2. PagXTH9 gene sequence acquisition To conduct gene editing research, the first step is to determine the target gene sequence.

[0033] This invention uses the AtXTH9 protein sequence in the model plant Arabidopsis thaliana as a reference and employs bioinformatics tools such as BLAST to perform sequence alignment analysis in the whole genome of 84K poplar (silver poplar) to screen for the two alleles with the highest homology.

[0034] The result is confirmed: The homologous gene from the paternal chromosome is Pag.A19G001358.1, and its nucleotide sequence number is SEQ ID NO: 1; The homologous gene from the maternal chromosome is Pag.B19G001494.1, and its nucleotide sequence number is SEQ ID NO: 2.

[0035] These two alleles are collectively referred to as the PagXTH9 gene, which is expressed on two different subgenomes in the diploid genome of *Populus alba*. Both encode xyloglucan endoglucanase / hydrolase (XTH) family proteins, and are presumed to be involved in cell wall remodeling and root growth.

[0036] The sequence has been used as basic information for editing targets, providing a basis for subsequent gRNA design and knockout vector construction.

[0037] II. Construction of CRISPR / Cas9 Editing Vector 1. gRNA target design After obtaining the nucleotide sequence of the PagXTH9 gene (SEQ ID NO: 1 and SEQ ID NO: 2), target prediction and screening were performed on the gene based on the CRISPR / Cas9 gene editing principle.

[0038] Specifically, online tools such as CRISPR-P 2.0 were used to analyze the coding region of the PagXTH9 gene. Factors such as target cleavage efficiency, GC content, off-target risk, and distribution within the gene structure were comprehensively considered to screen for highly efficient target sequences suitable for simultaneously editing two alleles. The final determined gRNA target sequence is shown in SEQ ID NO: 3. This target is located within the functional region of the PagXTH9 gene and can effectively disrupt its normal coding framework.

[0039] To facilitate subsequent molecular identification of mutants, primer pairs for PCR amplification were designed around the target region, including the first primer pair XTH9T1F and XTH9T1R, and the second primer pair XTH9T2F and XTH9T2R, whose corresponding nucleotide sequences are shown in SEQ ID NO: 4 to SEQ ID NO: 7, respectively.

[0040] 2. Construction of CRISPR / Cas9 editing vectors Using pYLCRISPR / Cas9 as the backbone vector, which contains both a plant codon-optimized Cas9 nuclease expression framework and a gRNA expression module, it is suitable for targeted editing of plant genomes.

[0041] The designed gRNA targeting sequence was annealed and ligated according to the vector instructions, and then inserted into the gRNA expression framework to construct a CRISPR / Cas9 editing vector targeting the PagXTH9 gene. The constructed vector was verified by restriction endonuclease digestion analysis and sequencing, confirming that the gRNA sequence was correctly inserted and oriented.

[0042] 3. Transformation of Agrobacterium with recombinant vectors The validated CRISPR / Cas9-PagXTH9 editing vector was introduced into *Agrobacterium tumefaciens* GV3101 competent cells using a heat shock method. The transformed *Agrobacterium* were plated on LB agar containing kanamycin and rifampin and cultured at 28°C for 2–3 days. Positive *Agrobacterium* single clones were then selected.

[0043] After verification by colony PCR or plasmid extraction, it was confirmed that the Agrobacterium successfully carried a CRISPR / Cas9 editing vector targeting the PagXTH9 gene, which will be used for subsequent genetic transformation experiments on Populus alopecuroides explants.

[0044] III. Genetic Transformation and Regeneration Process of *Populus silageensis* 1. Pre-culture and preparation of Agrobacterium tumefaciens culture Single clones of recombinant Agrobacterium GV3101 carrying the PagXTH9 gene CRISPR / Cas9 editing vector were selected and inoculated into 5 mL of LB liquid medium containing antibiotics (50 mg / L kanamycin and 50 mg / L rifampin). The medium was then incubated in a 28°C shaking incubator in the dark for 12–16 hours until the bacterial culture reached OD. 600 The value reached approximately 0.8.

[0045] Take 1 mL of overnight bacterial culture and inoculate it into 100 mL of fresh LB liquid medium (with the same antibiotic concentration), and continue culturing until OD.600 When the value reaches 0.4–0.5, this bacterial solution is the activated bacterial solution used to infect explants of *Populus simonii*. Before use, place the bacterial solution on ice to stand to avoid a decrease in activity.

[0046] 2. Pretreatment of *Populus alba* explants and *Agrobacterium* infection Select healthy, aseptic tissue culture seedlings of *Populus simonii* that have been cultured for approximately 4 weeks, and use unfolded leaves as explant material. The procedure is as follows: Use a sterile scalpel to make a horizontal cut along the leaf veins and trim the leaf edges; Cut the leaves into small pieces of approximately 0.5 cm × 0.5 cm; Immerse the treated leaves in the prepared Agrobacterium solution for 12 minutes, gently shaking them during the process to ensure that the solution comes into full contact with the wound. Remove the leaf and use sterile filter paper to absorb any excess bacterial liquid from the surface.

[0047] 3. Co-cultivation The infected leaf explants were spread flat on the co-culture medium, the culture dish was sealed, and the culture was incubated statically at 25°C in the dark for 2-3 days to allow Agrobacterium to complete the T-DNA transfer and integration process.

[0048] The basic formula for the co-culture medium is MS basic salt + appropriate sugar source + plant growth regulator, which can be adjusted according to the responsiveness of poplar plants.

[0049] 4. Resistance screening and callus induction After co-culture, the explants were transferred to a primary screening medium containing hygromycin (3 mg / L) and an antibacterial agent to begin resistance screening: Incubate in the dark for about one week, then remove contaminated or necrotic tissue. Explants with visible callus tissue were selected and then subcultured in the selection medium. When the callus tissue grows to about 0.5 cm, it enters the next stage for differentiation induction.

[0050] 5. Bud differentiation and rooting culture Bud differentiation: The callus tissue was transferred to the bud differentiation medium and cultured under 16 h light / 8 h dark conditions at a temperature of 23–25℃. Adventitious buds will appear after about 10 to 15 days; When the buds grow to about 1 cm, cut them off for subsequent rooting culture.

[0051] Rooting induction: Transfer the buds to 1 / 2 MS rooting medium and continue to culture under the same temperature and light conditions. Once the root system is fully developed, complete transformed plants can be obtained.

[0052] The rooting medium formula is: MS basal salt 2.215 g / L, sucrose 30 g / L, agar powder 8 g / L, pH adjusted to 5.8–6.0. ​​If necessary, a low concentration of auxin (such as NAA) can be added to promote root induction.

[0053] 6. Propagation of transformed plants through subgeneration Transgenic plants with intact root systems were subcultured under the same conditions and propagated for subsequent molecular detection and phenotypic analysis. Multiple samples were replicated for each treatment to ensure data stability and representativeness.

[0054] IV. Mutant Identification and Verification To verify whether the CRISPR / Cas9 system successfully knocked out the PagXTH9 gene in the genome of *Populus alba*, this invention performed molecular-level identification on the obtained transformed plants, mainly including genomic DNA extraction, PCR amplification, agarose gel electrophoresis, and Sanger sequencing analysis.

[0055] 1. Genomic DNA extraction Leaf tissues were taken from the transformed plants and wild-type *Populus simonii* obtained through screening. High-quality total DNA was obtained by using a plant genomic DNA rapid extraction kit according to the instructions. The concentration and purity were tested by a UV spectrophotometer and found to be qualified before being used for subsequent PCR amplification.

[0056] 2. PCR primer design and amplification system To assess the editing efficiency of the PagXTH9 gene, genomic fragment amplification was performed using target-specific primers flanking the target site. The primers used are as follows: XTH9T1F: CTACCCGCTAAATGTCTCC (SEQ ID NO: 4) XTH9T1R:GACGCATGCAGTGATTCA (SEQ ID NO: 5) XTH9T2F:CCCGCTAATTTTATTTCTCCTGAA (SEQ ID NO: 6) XTH9T2R: CTGATGCATGCAGTGATGC (SEQ ID NO: 7) The PCR reaction system (20 μL) was prepared as follows: Element Volume (μL) DNA template 1 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 2× Phanta Max Mix 10 ddH2O 7 The PCR amplification procedure is as follows: stage temperature time Cycle number Pre-variation 94℃ 30 s 1 time transsexual 98℃ 10 s 30 times annealing 55℃ 30 s 30 times extend 72℃ 50 s 30 times Final extension 72℃ 2 min 1 time Insulation 4℃ unlimited 3. Electrophoresis analysis and sequencing verification Take 10 μL of the PCR product and perform 1% agarose gel electrophoresis to check whether the amplified bands meet the expected size and determine whether the target region has been successfully amplified.

[0057] The amplified products were sent to Sanger sequencing, and the sequencing results were compared with those of the wild type to detect whether there were mutations such as base insertions, deletions, or substitutions at the target sites.

[0058] 4. Mutant identification results ( Figure 1 illustrate) Sequencing results showed that the two selected positive transgenic plants (numbered Pagxth9#1 and Pagxth9#2) had the expected mutations at both alleles of the PagXTH9 gene: Pagxth9#1 strain Insert a single base “T” at the site of Pag.A19G001358.1 (SEQ ID NO: 1); Insert one base "T" at the site of Pag.B19G001494.1 (SEQ ID NO: 2); It constitutes a bis-allelic homozygous mutant.

[0059] Pagxth9#2 strain: Insert the base "A" into Pag.A19G001358.1; Insert a base "T" into Pag.B19G001494.1; It is also a bis-allelic homozygous mutant.

[0060] The mutation caused a frameshift in the coding sequence, which in turn disrupted the normal expression of the PagXTH9 gene, achieving a functional knockout effect.

[0061] Figure 1 The sequencing alignment diagram shows the base insertion at the mutation site, which is highly consistent with the designed target location, verifying the effectiveness and accuracy of the CRISPR / Cas9 system constructed in this invention in editing *Populus alba*.

[0062] V. Rooting Phenotypic Analysis of Mutants 1. Experimental Design To evaluate the effect of PagXTH9 gene knockout on the adventitious root formation of Populus aurea, this invention conducted parallel culture of plants identified as biallelic mutants (Pagxth9#1, Pagxth9#2) and wild-type Populus aurea, and systematically observed and statistically analyzed their rooting process.

[0063] The specific steps are as follows: Wild-type plants with consistent growth status and similar bud size, as well as mutant plants Pagxth9#1 and Pagxth9#2, were selected. The terminal buds were cut off and vertically inserted into 1 / 2 MS rooting medium. Each group has three biological replicates, with each replicate containing 8 plants, for a total of 24 plants per group; All treatment groups were placed in a climate incubation chamber with a light cycle of 16 h light / 8 h dark and a temperature of 23–25℃. Starting from day 4 after insertion into the culture medium, continuous observation and recording were conducted: The time when adventitious roots first appear (initial rooting time); Calculate the cumulative rooting rate by counting the number of newly rooted plants per day. When all plants have finished rooting, the average number of roots per plant is counted. Observe and photograph the root system morphology for morphological comparison.

[0064] 2. Results Statistics and Analysis The following results were obtained through three independent replicate experiments: Figure 2 The rooting rate curves of wild-type *Populus amurensis* and the PagXTH9 mutant are shown. The results indicate that the wild-type group started rooting earlier than the mutant group, and the overall rooting rate was significantly higher than that of the mutant group, exhibiting characteristics such as earlier and more concentrated rooting.

[0065] Figure 3 This is a statistical chart showing the number of adventitious roots in each group of plants at the end of the culture period. The average number of roots in the wild type was significantly higher than that in the two mutants. There was no significant difference between the two mutant groups, Pagxth9#1 and Pagxth9#2, both showing a decrease in the number of roots.

[0066] Figure 4 The images show the root development morphology of typical plants. Wild-type *Populus silvereris* has a uniformly distributed and numerous root system, while mutant plants have fewer roots and shorter roots, with some plants forming only 1-2 adventitious roots.

[0067] All experimental data were analyzed statistically (t-test), and the significance level was set at P<0.05, indicating that the phenotypic differences were statistically significant.

[0068] 3. Experimental Conclusions Through a systematic comparison of the rooting ability of the PagXTH9 gene mutant and wild-type *Populus simonii*, this invention found that: Knocking out the PagXTH9 gene significantly delays the occurrence of adventitious roots; The total number of roots in the mutant was significantly lower than that in the wild type; The morphology and structure of the root system change, resulting in phenotypes such as sparse root system and restricted development.

[0069] The above results indicate that the PagXTH9 gene plays an active regulatory role in the adventitious root regeneration process of *Populus aurea*, and its normal expression may contribute to cell wall remodeling and root induction. This gene can serve as a functional site for root development regulation, providing an important molecular target for improving root traits in forest tree varieties.

[0070] The nucleotide sequences involved in this invention and their corresponding functions are as follows: Sequence List Number sequence name type Function or Usage Description SEQ ID NO: 1 PagXTH9.19a gene sequence DNA The PagXTH9 allele sequence from the paternal subgenome of *Populus alba* was used to design gRNA target sites and perform gene editing. SEQ ID NO: 2 PagXTH9.19b gene sequence DNA The PagXTH9 allele sequence from the maternal subgenome of *Populus alba* was used for mutation verification and functional analysis. SEQ ID NO: 3 CRISPR gRNA targeting sequence DNA gRNA target sequences designed for the PagXTH9 coding region are used for CRISPR / Cas9-mediated knockout. SEQ ID NO: 4 XTH9T1F primer sequence DNA Forward primers for PCR amplification located upstream of the PagXTH9 target site. SEQ ID NO: 5 XTH9T1R primer sequence DNA A reverse primer paired with SEQ ID NO: 4 for PCR amplification and mutation detection. SEQ ID NO: 6 XTH9T2F primer sequence DNA Another set of PCR forward primers located in the target region are used for dual-target detection. SEQ ID NO:7 XTH9T2R primer sequence DNA The reverse primer paired with SEQ ID NO: 6 is used for PCR amplification and sequencing verification. illustrate: The above sequences are referenced in the claims and specification, providing molecular support for the functional regions involved in the technical solutions of this invention and forming an important basis for realizing the embodiments of this invention. All listed sequences are written in the 5'→3' direction and are expressed using the internationally accepted IUPAC nucleotide symbol standard.

[0071] In summary, this invention, through targeted editing of the PagXTH9 gene in *Populus aurea*, constructed a mutant that significantly altered adventitious root regeneration ability, verifying the regulatory function of this gene in the root development process of woody plants. The proposed gene editing method possesses advantages such as high stability, good reproducibility, and a clear operational pathway, making it applicable to multiple fields including forest tree breeding, rooting mechanism research, and functional gene screening, and showing promising prospects for widespread application.

[0072] The embodiments disclosed in this invention are preferred embodiments proposed to illustrate the technical concept and core principles of this invention, and the content described does not limit the scope of protection of this invention. Any equivalent modifications or substitutions made to the technical solutions of this invention without departing from the spirit and essence of this invention should be covered within the scope of protection defined by the claims of this invention.

Claims

1. The application of a PagXTH9 gene or its encoded protein in regulating adventitious root regeneration in woody plants, characterized in that, The nucleotide sequence of the PagXTH9 gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the application includes altering the regeneration capacity of adventitious roots by targeted editing of the gene.

2. The application according to claim 1, characterized in that, The woody plant is a poplar, preferably Populus alba × Populus glandulosa.

3. A method for obtaining poplar mutants with altered phenotypes and adventitious root regeneration capabilities, characterized in that, This includes targeted editing of the PagXTH9 gene shown in SEQ ID NO: 1 or SEQ ID NO: 2 using a CRISPR / Cas9 system containing gRNA, the target sequence of which contains a nucleotide sequence as shown in SEQ ID NO: 3 or its complementary sequence.

4. The method according to claim 3, characterized in that, Includes the following steps: (a) Construct a CRISPR / Cas9 gene editing vector containing a gRNA expression unit, wherein the gRNA is capable of specifically recognizing the target sequence of the PagXTH9 gene; (b) Introduce the vector into sterile explants of Populus species; (c) Transformed tissues were cultured, screened, and rooted to obtain mutant plants with PagXTH9 gene loss of function.

5. The method according to claim 4, characterized in that, The primer pair used in step (a) to amplify the PagXTH9 gene editing site is selected from one of the following combinations: (i) SEQ ID NO: 4 and SEQ ID NO: 5; (ii) SEQ ID NO: 6 and SEQ ID NO:

7.

6. A poplar mutant obtained by the method according to any one of claims 3 to 5, characterized in that, The PagXTH9 gene loci shown in SEQ ID NO: 1 and / or SEQ ID NO: 2 in its genome contain base insertion or deletion mutations, which result in partial or complete suppression of the function of the gene.

7. The poplar mutant according to claim 6, characterized in that, The mutant is a homozygous biallelic mutant of *Populus alba*, wherein a base T or A is inserted at SEQ ID NO: 1 and a base T is inserted at SEQ ID NO:

2.

8. A gRNA molecule for targeted editing of the PagXTH9 gene, characterized in that, Its target sequence contains the nucleotide sequence shown in SEQ ID NO:3 or its complementary sequence, and the gRNA is suitable for CRISPR / Cas9 system to achieve specific cleavage of the PagXTH9 gene.

9. A CRISPR / Cas9 gene editing system or recombinant expression vector, characterized in that, The system or vector comprises the gRNA molecule as described in claim 8, for targeted editing of the PagXTH9 gene in woody plants.

10. The application of the mutant of claim 6 or 7 in the breeding of forest tree varieties with specific rooting characteristics, wherein the application includes using the adventitious root regeneration ability of the mutant to reduce the phenotype and achieve regulation of plant type or reproductive characteristics.

Images