Liver cancer methylation detection primer probe set, kit and application

Abstract

The invention discloses a liver cancer methylation detection primer probe set, a kit and application, the detection primer probe set adopts methylation level joint detection of RASSF1A, RUNX3, GNB4 and RNF135 genes, and by designing primers aiming at specific methylation sites, PCR can selectively amplify methylated DNA fragments, so that the detection of the gene methylation state is realized. Through multi-target combination, in liver cancer blood detection, the sensitivity of the kit is 96.3%, the specificity is 97.8%, and the cost and trauma burden caused to a patient can be greatly reduced.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of diagnostic kits, in particular to a liver cancer methylation detection primer probe set, a kit and application. BACKGROUND

[0002] Liver cancer is one of the common and serious malignant tumors that threaten human health worldwide. Liver cancer usually has a relatively insidious onset, and early symptoms are not obvious. Most patients are in the middle and late stages when diagnosed, missing the best treatment opportunity. Liver cancer has characteristics such as high malignancy, rapid progression, easy metastasis and recurrence. The incidence of liver cancer in men is significantly higher than that in women, and the male-to-female incidence ratio is about 2-3:1. The high-incidence age is concentrated in 40-60 years old. The occurrence and development of liver cancer is a complex process involving multiple steps and stages, and involves the interaction of multiple genetic and environmental factors.

[0003] At present, the examination methods for liver cancer mainly include serological examination, imaging examination and liver biopsy. In serological examination, alpha-fetoprotein (AFP) is a commonly used tumor marker for liver cancer in clinical practice. However, AFP detection has certain limitations, and about 30%-40% of liver cancer patients do not have elevated AFP levels, leading to missed diagnosis in some patients. Imaging examinations such as ultrasound, CT and MRI can detect liver space-occupying lesions, but there are certain difficulties in diagnosing some small liver cancers and atypical lesions. Liver biopsy is the "gold standard" for diagnosing liver cancer, but it is an invasive examination and has certain complication risks, limiting its widespread application in clinical practice.

[0004] In-depth study of the molecular mechanisms of liver cancer occurrence and development and the search for new tumor molecular biomarkers are of great significance for the early diagnosis, treatment and prognosis evaluation of liver cancer. In recent years, some studies have shown that the methylation status of circulating tumor DNA (ctDNA) and the expression level of microRNA (miRNA) can be used as promising markers for detecting or monitoring liver cancer. These new biomarkers are expected to provide more sensitive and specific methods for the early diagnosis of liver cancer, thereby improving the prognosis of patients.

[0005] The mature development of the polymerase chain reaction detection gene methylation method provides a new idea for multi-target joint detection. Gene methylation is an important epigenetic modification that plays a key role in the occurrence and development of tumors. There are a large number of abnormal gene methylation changes in hepatocellular carcinoma cells, which can be used as potential biomarkers for the diagnosis of hepatocellular carcinoma. Polymerase chain reaction (PCR) technology is a technology that can rapidly amplify specific DNA fragments in vitro, with high specificity and sensitivity. By designing primers specific to certain methylation sites, PCR can selectively amplify methylated DNA fragments, thereby detecting the methylation status of genes. Through multi-target joint detection, the detection sensitivity and accuracy are improved; combined with the many advantages of the latter, the cost and trauma burden on patients can be greatly reduced. SUMMARY

[0006] The present application provides a multi-gene combination for the auxiliary diagnosis of hepatocellular carcinoma. Through non-invasive detection of four gene targets, the detection sensitivity and specificity are improved, thereby improving the early detection rate of hepatocellular carcinoma and reducing the burden on patients.

[0007] Therefore, the scheme of the present application is as follows: The first aspect of the present application is to provide the use of a gene detection reagent in the preparation of a kit; the gene is RASSF1A, RUNX3, GNB4 and RNF135; the detection reagent includes a first primer probe group, a second primer probe group, a third primer probe group and a fourth primer probe group, which are respectively used to detect the target sequences shown in nucleotide sequences such as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, each of the primer probe groups comprises at least one pair of primers and one probe; the kit is used for at least one of the following purposes: a) detecting the methylation of genes RASSF1A, RUNX3, GNB4 and RNF135; b) auxiliary diagnosis of hepatocellular carcinoma; c) assessing the risk of hepatocellular carcinoma.

[0008] The second aspect of the present application is to provide a primer probe combination comprising an A tube and a B tube, each comprising a primer pair and a probe group, wherein: The A tube comprises a primer pair shown in nucleotide sequences such as SEQ ID NO. 5-6, SEQ ID NO. 8-9, and a probe group shown in SEQ ID NO. 7, SEQ ID NO. 10; The B tube comprises a primer pair with nucleotide sequences as shown in SEQ ID NO. 11-12, SEQ ID NO. 14-15, and a probe set as shown in SEQ ID NO. 13, SEQ ID NO. 16.

[0009] Further, the A tube and the B tube each comprise the same primer pair for detecting the internal reference gene and the probe.

[0010] Preferably, the internal reference gene is ACTB.

[0011] Preferably, the primer pair for detecting the internal reference gene comprises nucleotide sequences as shown in SEQ ID NO. 17-18, and the probe for detecting the internal reference gene comprises a nucleotide sequence as shown in SEQ ID NO. 19.

[0012] Further, the probe set is labeled with a fluorescent group at the 5' end and a fluorescent quenching group at the 3' end, and the fluorescent groups labeled on different probes in the same tube are different.

[0013] The third aspect of the present application is to provide use of the primer-probe combination of the second aspect in the preparation of a kit for at least one of the following purposes: a) detecting methylation of genes RASSF1A, RUNX3, GNB4 and RNF135; b) auxiliary diagnosis of liver cancer; c) detecting the risk of liver cancer.

[0014] The fourth aspect of the present application is to provide a kit for detecting gene methylation, which comprises an A tube and a B tube; wherein: The A tube comprises primers and probes for detecting RASSF1A, RUNX3, ACTB, the nucleotide sequences of the primers being as shown in SEQ ID NO. 5-6, SEQ ID NO. 8-9, SEQ ID NO. 17-18, and the nucleotide sequences of the probes being as shown in SEQ ID NO. 7, SEQ ID NO. 10, SEQ ID NO. 19; The B tube comprises primers and probes for detecting GNB4, RNF135, ACTB, the nucleotide sequences of the primers being as shown in SEQ ID NO. 11-12, SEQ ID NO. 14-15, SEQ ID NO. 17-18, and the nucleotide sequences of the probes being as shown in SEQ ID NO. 13, SEQ ID NO. 16, SEQ ID NO. 19; The 5' end of any of the probes is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group, and the fluorescent groups labeled on different probes in the same tube are different.

[0015] Further, the kit further comprises one or more of nucleic acid extraction and purification reagent, bisulfite conversion reagent, PCR reaction mixture, fluorescent dye, purified water.

[0016] Further, the kit further comprises P value calculation formula and determination line, wherein the P value calculation formula is trained by the Ct value difference between the Ct values of RASSF1A, RUNX3, GNB4 and RNF135 and the Ct value of the internal standard gene and the sample determination result.

[0017] Preferably, the calculation formula is: P=14.239+(-0.674 △Ct RASSF1A )+(-0.679 △Ct RUNX3 )+(-0.185 △Ct GNB4 ) + (-0.173 △CtR NF135 ); wherein, △Ct RASSF1A , △Ct RUNX3 , △Ct GNB4 , △CtR NF135 respectively correspond to the Ct value difference between the Ct values of RASSF1A, RUNX3, GNB4 and RNF135 and the Ct value of the internal standard gene; and the determination line is: when the Ct value of ACTB gene is ≤37 and the P value is ≥0.484, the sample to be tested is determined as positive; when the Ct value of ACTB gene is ≤37 and the P value is <0.484, the sample to be tested is determined as negative; and when the Ct value of ACTB gene is >37, the sample is determined as invalid.

[0018] The determination result by the P value calculation formula and the determination line can determine the presence of methylation at any relevant detection site of RASSF1A, RUNX3, GNB4 and RNF135 in the sample to be tested, and thus can represent the methylation state of the sample and can be used as a basis for determining the positivity and negativity of the sample, thereby providing a basis for assisting clinical diagnosis.

[0019] The fifth aspect of the present application provides a method for detecting gene methylation, which is not for diagnostic purposes, and the steps comprise: extracting genomic DNA in the sample to be tested and performing bisulfite conversion; using the converted DNA as a template, performing fluorescent quantitative PCR reaction by using the probe primer set of the second aspect or the kit of the fourth aspect; judging the methylation state of the sample to be tested according to the fluorescent quantitative PCR detection result.

[0020] Further, the sample to be tested is a blood sample.

[0021] Further, the process of judging the methylation state of the sample to be tested is that the Ct value of RASSF1A, RUNX3, GNB4 and RNF135 genes and the Ct value of the internal standard ACTB gene are combined with a P value calculation formula and a determination line to judge whether the sample to be tested is negative, positive or invalid sample; the P value calculation formula and the determination line, the calculation formula is: P = 14.239 + (-0.674 △Ct RASSF1A )+(-0.679 △Ct RUNX3 )+(-0.185 △Ct GNB4 ) + (-0.173 △CtR NF135 ); wherein, △Ct RASSF1A , △Ct RUNX3 , △Ct GNB4 , △CtR NF135 respectively correspond to the difference between the Ct value of RASSF1A, RUNX3, GNB4 and RNF135 and the Ct value of the internal standard ACTB gene; The determination line is: When the Ct value of ACTB gene is ≤37, and the P value is ≥0.484, the sample to be tested is judged to be positive; when the Ct value of ACTB gene is ≤37, and the P value is <0.484, the sample to be tested is judged to be negative; when the Ct value of ACTB gene is >37, the sample is judged to be invalid.

[0022] Compared with the prior art, the present application has the following beneficial effects: The detection primer probe set of the present application adopts the methylation level of RASSF1A, RUNX3, GNB4 and RNF135 genes for combined detection, and by designing primers for specific methylation sites, PCR can selectively amplify the methylated DNA fragments, thereby realizing the detection of the methylation state of the gene. Through multi-target combined detection, the detection sensitivity and accuracy are improved.

[0023] The detection kit provided by the present application can be used for the auxiliary diagnosis of liver cancer, and the sensitivity of the kit is 96.3% and the specificity is 97.8% according to the blood test results of liver cancer, the method is simple and easy to operate, and can greatly reduce the cost and trauma burden caused to patients. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 The ROC curve graph in Example 3 of the present application. DETAILED DESCRIPTION

[0025] The technical solutions of the present application will be described clearly and completely below in connection with preferred embodiments. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0026] Example 1 Selection of methylation target genes and design of primer probe sets

[0027] The inventors of the present application screened the target highly related to liver cancer for methylation analysis by adopting bioinformatics analysis, literature and patent content retrieval, and finally screened the following target genes: RASSF1A gene, RUNX3 gene, GNB4 gene and RNF135 gene. The described CpG site is located between the transcription start site +1000 / -500 bases (1.5 kb) of the gene. The methylation state analysis of the above genes in the clinical blood samples can improve the detection sensitivity and accuracy, and provide accurate basis for the auxiliary diagnosis of liver cancer.

[0028] The target regions of the above genes are as follows, respectively: RASSF1A target sequence (SEQ ID NO. 1): CGGGGTTCGTTTTGTGGTTTCGTTCGGTTCGCGTTTGTTAGCGTTTAAAGTTAGCGAAGTACGGGTTTAATCGGGTTATG RUNX3 target sequence (SEQ ID NO. 2): TTAGAGCGGGGTATGGTATCGAATAGTATTTTCGATTTTTTTTCGATTTATTCGTCGATTTTTATTCGCGGTGAGTAATAATAGTTTAGGGTT GNB4 target region (SEQ ID NO. 3): TTTGTATTTTTAGTAGAGACGGGGTTTTATTATGTTAGTTAGGATGGTTTCGATCGTTTGATTTTATGATTTATTTGTTTTAGTTTTTTAAAGTGTTGGGATTACGGGTGTGAGTTATTGCGTTTG RNF135 target region (SEQ ID NO. 4): GTGAAAGATAAAGTAGTTAATGGTCGGGCGTAGTGAGATTGCGTTATTGTATTTTAGTTTGGGTGATAGAGCGAGATTTCGTATTAGAAAG The primer probe sequences used for detecting each gene as the target region are shown in Table 1.

[0029] Table 1: Primer and probe sequences used for detecting each gene

[0030] The primer probe sequences used for detecting ACTB as the internal reference gene are shown in Table 2.

[0031] Table 2: Primers and probes for internal reference detection

[0032] Example 2 Detection reagent kit and detection method

[0033] 1. Extraction of blood samples

[0034] The DNA in the blood sample was extracted by using a kit, and the extraction kit for human DNA was a commercial kit: Qiagen DNA extraction kit for whole blood, item number: 51106. The blood sample was a blood sample of a liver cancer or other cancer patient determined by clinical puncture detection and case screening. The specific process can be carried out according to the instructions of the commercial kit.

[0035] According to the standard operation process of the Qiagen DNA extraction kit for whole blood: (1) Take 200 μL of whole blood and place it in a 1.5 EP tube for standby; (2) Add 20 μL of proteinase K, mix gently, then add 200 μL of buffer AL and mix for 15 s, and place in a 54℃ metal bath for 10 min (during which mix up and down 2-3 times); (2) After the incubation is completed, add 200 μL of anhydrous ethanol (96%-100%) to the mixture, which may produce a white flocculent precipitate, and mix and vortex for 15 s; (3) Add the mixture from step (2) to the centrifugal column, centrifuge at 8000 rpm for 1 min, and discard the waste liquid; (4) Add 500 μL of AW1 buffer, centrifuge at 8000 rpm for 1 min, and discard the waste liquid; (5) Add 500 μL of AW2 buffer, centrifuge at 13000 rpm for 3 min, and discard the waste liquid; (6) 12000 rpm centrifuge for 1 min; (7) Place the spin column in a new clean 1.5 ml centrifuge tube, and add 50-100 μL buffer AE to the center of the adsorption membrane, and let it stand at room temperature for 2 min, and centrifuge at 13000 rpm for 1 min to collect the DNA solution; (8) Add the liquid after centrifugation of the spin column to the center of the adsorption membrane, and let it stand at room temperature for 1 min, and centrifuge at 13000 rpm for 1 min to collect the DNA solution; this sample can be directly used for downstream experiments, and if long-term storage is required, it needs to be placed in a -20°C refrigerator.

[0036] 2. Bisulfite conversion

[0037] The DNA of the obtained blood sample is subjected to methylation treatment.

[0038] The DNA methylation treatment uses a commercial kit, EZ DNA Methylation-Lightning™ Kit, item number: D5030. During the methylation treatment process, bisulfite can convert all unmethylated cytosines to uracils, while methylated cytosines remain unchanged. Specifically, after treatment, the unmethylated C in the XX gene sequence becomes U, and during the subsequent fluorescence quantitative PCR reaction, the primer probe specifically captures and binds to the methylated C site to emit fluorescence, while the XX gene that has not been methylated cannot bind to the primer probe and does not emit fluorescence.

[0039] Among them, the treatment process using the methylation kit is as follows: EZ DNA Methylation-Lightning™ Kit conversion process: (1) Add the reaction liquid and DNA sample in the proportion shown in the table to a 200ul PCR tube;

[0040] (2) Mix the reaction liquid at room temperature; (3) Perform the reaction on a general PCR instrument, which takes about 1.15h; (if the maximum allowed volume of the PCR instrument cannot reach 140μL, set it to the maximum reaction volume, such as 100μL), the program is as follows:

[0041] (4) Place the PCR tube in the instrument to start the reaction, and pay attention to use a PCR instrument with a hot lid; (5) After the conversion is completed, centrifuge briefly; (6) Prepare the corresponding number of centrifugal columns and collection tubes and assemble, add 600 μL of M-Binding Buffer to the centrifugal column; (7) Transfer the mixture in step (6) to the centrifugal column, mix slowly by blowing; (8) Centrifuge at the maximum speed of the centrifuge for 1 min, remove the waste liquid after the centrifugal column is assembled back to the collection tube; (9) Add 100 μL of M-Wash Buffer to each tube, continue to centrifuge at the maximum speed for 1 min, remove the waste liquid; (10) Add another 200 μL of L-Desulphonation Buffer, incubate at room temperature for 15 min; (If there is white precipitate in Buffer BD, avoid transferring it to the mixture; seal immediately after taking out Buffer BD to prevent oxidation); (11) Centrifuge at the maximum speed for 1 min, remove the waste liquid after the centrifugal column is assembled back to the collection tube; (12) Add 200 μL of M-Wash Buffer, centrifuge at the maximum speed for 1 min, then remove the waste liquid; (13) Repeat step 12; (14) Transfer the column to a new 1.5 ml centrifuge tube, centrifuge at the maximum speed for 3 min, remove the waste liquid; (15) Recommended: Place the open centrifugal column in a clean 1.5 ml centrifuge tube, incubate at room temperature for 5 min; (16) Add 20 μL of M-Elution Buffer to the above centrifugal column and place it in the center of the filter membrane, centrifuge at 15000g or 12000 rpm for 1 min; To increase the yield of purified DNA, the liquid after centrifugation can be added to the column for centrifugation again, which can improve the recovery rate. Obtain DNA nucleic acid template. The product can be directly used for downstream experiments, if you want to save, then placed in -20℃ refrigerator.

[0042] 3. Fluorescent quantitative PCR detection

[0043] The DNA after bisulfite conversion is subjected to fluorescent quantitative PCR (qPCR), and the system of qPCR is shown in Tables 3-1 and 3-2.

[0044] Table 3-1: RRA reaction system

[0045] Table 3-2: GRA reaction system

[0046] The PCR program is as follows:

[0047] Example 3 Target performance verification and combination screening and determination

[0048] 100 samples (50 positive blood samples of liver cancer and 50 blood samples of healthy people) were selected for verification detection, and the results of the detection were statistically analyzed to select the optimal positive judgment value algorithm, the optimal cutoff value and the optimal combination.

[0049] 1) Target genes to be selected: target RASSF1A, RUNX3, GNB4, RNF135, LDHB, HOXA1. Among them, the target sequences of RASSF1A, RUNX3, GNB4 and RNF135 are the nucleotide sequences of SEQ ID NO. 1~4 described above, and the related primer probe groups are shown in the nucleotide sequences of SEQ ID NO. 5~19 in Example 1.

[0050] The primer probe sequence used for LDHB gene detection is as follows: LDHB-F: GTAGGAGAATGTCGTGAGTTCG; LDHB-R: AACGAAATCTCACTCTATCGCC; LDHB-P: FAM-AGGCGGAGTTTGTAGTGAGTCG-MGB.

[0051] The primer probe sequence used for HOXA1 gene detection is as follows: HOXA1-F: AGGGAAAGTTGGAGAGTACGG; HOXA1-R: ATAAAACCTTCTCCAATTCCG; HOXA1-P: FAM-GGGTTAATTTAACGCGGTGCG-MGB.

[0052] 2) Fluorescence quantitative PCR detection

[0053] The DNA after bisulfite conversion was subjected to fluorescence quantitative PCR (qPCR), and the system and procedure of qPCR were as shown in the following table, respectively:

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060] The verification detection was performed on 100 samples (50 liver cancer positive blood samples and 50 healthy person blood samples), and the qRCR detection data were as shown in Table 4.

[0061] Table 4:

[0062] In this experiment, 100 effective samples were enrolled, the ACt values (target gene Ct value-internal standard gene (ACTB) Ct value) of each target were calculated, and the obtained data were subjected to ROC curve analysis, and the following results were obtained:

[0063] Conclusion: The analysis results show that among the 6 selected targets, the RASSF1A, RUNX3, GNB4 and RNF135 target single detection results are relatively better, and the RASSF1A, RUNX3, GNB4 and RNF135 genes will be selected as the combined detection target performance analysis in the future. The analysis results are as follows:

[0064] Conclusion: In this experiment, the total number of effective samples (training set and verification set) was 100, and the sample data were subjected to statistical analysis by multiple methods, including two gene fitting formula, three gene fitting formula, four gene fitting formula, etc. The detection sensitivity, specificity, total coincidence rate of different analysis methods were compared, and it was determined that the four gene fitting P value formula method had the highest detection accuracy.

[0065] The test set samples were used to verify the four gene fitting formula and other positive judgment value methods again, and the effective samples of the test set were 30. The results showed that the specificity of the four gene fitting P value formula method was 100.0%, the sensitivity was 96.0%, and the total coincidence rate was 100.0%. The results showed that when the four gene fitting P value formula method was used as the positive judgment value method, the kit detection performance was optimal.

[0066] The obtained four target combination system P value formula is as follows: P = 14.239 + (-0.674 △Ct RASSF1A )+(-0.679 △Ct RUNX3 )+(-0.185 △Ct GNB4) + (-0.173 △Ct RNF135 Where: △Ct RASSF1A , △Ct RUNX3 , △Ct GNB4 , △CtR NF135 The Ct values ​​for RASSF1A, RUNX3, GNB4, and RNF135 are the differences between the Ct values ​​of the internal standard gene and the Ct values ​​of the internal standard gene, respectively. The P value is the sample risk value.

[0067] Example 4 Sample expansion verification

[0068] To verify the accuracy of the results obtained by the above method, we expanded the sample size to verify the analysis results obtained by the algorithm, as detailed below.

[0069] The sample size was expanded to 302 cases (samples from liver cancer patients and other inflammatory patients came from a hospital in Wuhan or Chongqing, and samples from healthy individuals came from volunteer blood samples; a total of 302 samples, including 296 valid samples and 6 invalid samples). The methods in steps 1-3 of Example 2 were used for detection. The measured CT values ​​of the target genes in the samples and the corresponding pathological results are shown in Table 5.

[0070] Table 5: Comparison of pathological results of 302 samples with the results of target gene CT value and P value determination based on two-tube detection.

[0071] The ΔCt value (the difference between the Ct value of the target gene and the Ct value of the internal control gene) of the above samples was substituted into the p-value calculation formula for analysis, and the following results were obtained:

[0072] The P-value is the sample risk value, and then the Cutoff value corresponding to the optimal sensitivity and specificity is determined by the statistical Youden index (the difference between the true and false positive rates).

[0073] The results of the ROC analysis are as follows: Figure 1The results are shown in Table 5. It can be seen from the table that the accuracy is optimal when the Cutoff value is 0.484, and the sample can be judged according to the Cutoff value as follows: ① When the Ct value of ACTB gene (internal reference gene) is ≤37 and the P value is ≥0.484, the sample to be tested is judged to be positive; ② When the Ct value of ACTB gene (internal reference gene) is ≤37 and the P value is <0.484, the sample to be tested is judged to be negative; ③ When the Ct value of ACTB gene (internal reference gene) is >37, the sample is judged to be invalid.

[0074] According to the above determination standard, the P value of the target gene in each sample is calculated, and then the determination result of each sample is obtained, and the result is shown in Table 5.

[0075] From the determination result in the table, among the 142 positive samples (4 invalid samples), the sensitivity is 97.18%; among the 60 non-liver cancer samples (2 invalid samples), 4 samples are detected to be positive, and the specificity is 93.1%; among the 100 healthy person samples, all the samples are detected to be negative, and the specificity is 100%; the total specificity is 97.5%.

[0076] In summary, the application detects the methylation levels of RASSF1A gene, RUNX3 gene, FNB4 gene and RNF135 gene to assist in the diagnosis of liver cancer, has high specificity and sensitivity, and therefore has good application prospect in early screening of liver cancer.

[0077] Although the embodiments of the application have been shown and described, it can be understood by those skilled in the art that various changes, modifications, replacements and variations can be made to the embodiments without departing from the principles and spirits of the application, and the scope of the application is defined by the appended claims and their equivalents.

Claims

1. Use of a genetic methylation detection reagent in the preparation of a kit, characterized in that, The genes are RASSF1A, RUNX3, GNB4 and RNF135; the detection reagent comprises a first primer probe set, a second primer probe set, a third primer probe set, a fourth primer probe set, which are respectively used for detecting the target sequences shown in nucleotide sequences such as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, each of the primer probe sets comprises at least one pair of primers and one probe; the kit is used for at least one of the following purposes: a) detecting the methylation of genes RASSF1A, RUNX3, GNB4 and RNF135; b) auxiliary diagnosis of liver cancer; c) evaluating the risk of liver cancer.

2. A primer probe composition characterized in that, It comprises an A tube and a B tube, each of which comprises a primer pair and a probe set, wherein: The A tube comprises a primer pair shown in nucleotide sequences such as SEQ ID NO. 5-6, SEQ ID NO. 8-9, and a probe set shown in SEQ ID NO. 7, SEQ ID NO. 10; The B tube comprises a primer pair shown in nucleotide sequences such as SEQ ID NO. 11-12, SEQ ID NO. 14-15, and a probe set shown in SEQ ID NO. 13, SEQ ID NO.

16.

3. The primer probe composition of claim 2, wherein Each of the A tube and the B tube comprises the same primer pair and probe for detecting the internal reference gene.

4. The primer probe composition of claim 3, wherein, The primer pair for detecting the internal reference gene comprises nucleotide sequences shown in SEQ ID NO. 17-18, and the probe for detecting the internal reference gene comprises a nucleotide sequence shown in SEQ ID NO.

19.

5. The primer probe composition of claim 2, wherein The probe set is labeled with a fluorescent group at the 5' end and a fluorescent quenching group at the 3' end.

6. Use of the primer probe composition according to any one of claims 2 to 5 for the manufacture of a kit, characterized in that, The kit is used for at least one of the following purposes: a) detecting the methylation of genes RASSF1A, RUNX3, GNB4 and RNF135; b) auxiliary diagnosis of liver cancer; c) evaluating the risk of liver cancer.

7. A kit for detecting methylation of a gene, characterized by It comprises an A tube and a B tube; wherein: The A tube comprises primers and probes for detecting RASSF1A, RUNX3, ACTB, the nucleotide sequences of the primers are shown in SEQ ID NO. 5-6, SEQ ID NO. 8-9, SEQ ID NO. 17-18, and the nucleotide sequences of the probes are shown in SEQ ID NO. 7, SEQ ID NO. 10, SEQ ID NO. 19; The B tube comprises primers and probes for detecting GNB4, RNF135, ACTB, the nucleotide sequences of the primers are shown in SEQ ID NO. 11-12, SEQ ID NO. 14-15, SEQ ID NO. 17-18, and the nucleotide sequences of the probes are shown in SEQ ID NO. 13, SEQ ID NO. 16, SEQ ID NO. 19; The 5' end of any of the probes is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group, and the fluorescent groups of the probes in the same tube are different.

8. The kit of claim 7, wherein The kit further comprises one or more of nucleic acid extraction and purification reagents, bisulfite conversion reagents, PCR reaction mix, fluorescent dye, purified water.

9. The kit of claim 7, wherein The kit also includes a formula for calculating the P-value and a decision threshold. The formula is: P = 14.239 + (-0.674) / 2. △Ct RASSF1A )+(-0.679 △Ct RUNX3 )+(-0.185 △Ct GNB4 ) +(-0.173 △CtR NF135 ), △Ct RASSF1A , △Ct RUNX3 , △Ct GNB4 , △CtR NF135 The differences between the Ct values ​​of RASSF1A, RUNX3, GNB4, and RNF135 and the Ct value of the internal standard ACTB gene, respectively; The determination line is: When the Ct value of the ACTB gene is ≤37 and the P value is ≥0.484, the sample to be tested is determined to be positive; when the Ct value of the ACTB gene is ≤37 and the P value is <0.484, the sample to be tested is determined to be negative; when the Ct value of the ACTB gene is >37, the sample is determined to be invalid.

10. A method for detecting methylation of a gene, for non-diagnostic purposes, characterized in that, It comprises: Extracting genomic DNA in the sample to be tested and performing bisulfite conversion; Using the converted DNA as a template, performing fluorescent quantitative PCR reaction using the detection kit according to any one of claims 7-9; According to the fluorescent quantitative PCR detection result, the methylation state of the gene in the sample to be tested is determined.

Images