RAA-CRISPR / AsCas12f1-based eel herpesvirus detection system, detection kit, detection method and application of RAA-CRISPR / AsCas12f1-based eel herpesvirus detection system, detection kit and detection method

Abstract

The invention relates to the technical field of molecular biology and virus detection, in particular to an eel herpesvirus detection system, a detection kit, a detection method and application thereof, and the system comprises an RAA amplification system and a CRISPR / AsCas12f1 detection system; the RAA amplification system is used for isothermal amplification of an eel herpesvirus ORF95 gene segment; and the CRISPR / AsCas12f1 detection system is used for identifying an RAA amplification product and generating a fluorescence signal. Through combination of RAA amplification and CRISPR / AsCas12f1 detection, rapid, sensitive and specific detection of AngHV is realized, and the kit is suitable for on-site rapid detection of eel farms and aquatic quarantine departments.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and virus detection technology, specifically to an eel herpesvirus detection system, detection kit, detection method, and its applications. Background Technology

[0002] Eel herpesvirus (AngHV) is a member of the Alloherpesviridae family. It is a double-stranded DNA virus with the typical envelope and capsid structure of herpesviruses, primarily infecting the skin, gills, and liver of eels (such as Japanese eels and European eels). This virus can infect eels at all growth stages, but is particularly pathogenic to juvenile and adult eels, causing herpesvirus hemorrhagic disease. Typical symptoms include surface bleeding, skin ulcers, gill tissue damage, and internal organ lesions. In severe cases, the mortality rate is extremely high, and secondary bacterial infections easily exacerbate the condition. AngHV is transmitted through contaminated water, direct contact with infected fish, and contact with damaged tissue. Outbreaks are highly likely in environments with high stocking densities or deteriorated water quality, causing significant economic losses to the eel farming industry.

[0003] Currently, AngHV detection mainly relies on PCR technology, virus isolation and culture, and pathological observation. However, these technologies have significant limitations: PCR technology requires specialized instruments (such as PCR machines) and skilled operators, and electrophoresis verification after amplification is necessary, which is time-consuming (usually ≥2 hours); virus isolation and culture have long cycles (requiring several days to weeks), are complex to operate, and their sensitivity is greatly affected by the sample condition; pathological observation relies on typical pathological features, making early diagnosis impossible and easily missing the optimal window for prevention and control. Therefore, establishing a rapid, sensitive, simple, and field-applicable AngHV detection method is urgently needed for early diagnosis and prevention and control of the virus.

[0004] The CRISPR-Cas system, a clustered regularly spaced short palindromic repeat system, is an acquired immune system of bacteria / archaea, composed of Cas proteins and guide RNA (gRNA). The gRNA guides the Cas proteins to specifically recognize and cleave exogenous nucleic acids (DNA / RNA), a property that has been widely applied in gene editing. With technological advancements, CRISPR / Cas12a has been found to possess "trans-cleavage activity"—when Cas12a binds to target double-stranded DNA (dsDNA) under gRNA guidance, it activates its cleavage activity against non-specific single-stranded DNA (ssDNA). This allows for the visual detection of target nucleic acids using fluorescently labeled ssDNA reporter molecules.

[0005] The newly discovered AsCas12f1 protein further optimizes the detection performance of the CRISPR system: its small molecular weight (facilitating in vitro expression and storage), high target recognition efficiency, and trans-cleavage activity; combined with isothermal amplification technology (such as RAA), it can significantly improve detection sensitivity—RAA technology can rapidly amplify target nucleic acids under isothermal conditions of 37-42℃ (amplification completed in 20-30 minutes), without the need for high-temperature denaturation steps, making it suitable for on-site detection scenarios. Furthermore, the AngHV ORF95 gene encodes a viral envelope structural protein with strong sequence conservation and can be detected early in viral infection, making it an ideal detection target.

[0006] In summary, to address the aforementioned issues, we propose a detection system, reagent kit, detection method, and its applications for an eel herpesvirus. Summary of the Invention

[0007] The purpose of this invention is to provide an eel herpesvirus detection system, detection kit, detection method, and their applications to solve the problems mentioned in the background art.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] The eel herpesvirus detection system includes:

[0010] RAA amplification system and CRISPR / AsCas12f1 detection system;

[0011] The RAA amplification system was used for isothermal amplification of the eel herpesvirus ORF95 gene fragment;

[0012] The CRISPR / AsCas12f1 detection system is used to identify RAA amplification products and generate fluorescence signals.

[0013] Preferably, the RAA amplification system contains a specific primer pair targeting the eel herpesvirus ORF95 gene;

[0014] The primer pair is upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2;

[0015] The upstream primer is SEQ ID NO.1: GTTAAAGAGTCTGGCCCACACGCGTTTCAC;

[0016] The downstream primer SEQ ID NO.2: GGACATAACCATCCTCCTCGACAACGAACCC.

[0017] Preferably, the CRISPR / AsCas12f1 detection system comprises AsCas12f1 protein, specific sgRNA, and ssDNA-FQ fluorescent reporter molecule;

[0018] The sequence of the sgRNA is SEQ ID NO.3:

[0019] GGGAUUCGUCGGUUCAGCGACGAUAAGCCGAGAAGUGCCAAUAAAACUGUUAAGUGGUUUG;

[0020] The structure of the ssDNA-FQ fluorescent reporter molecule is 5'-6-FAM-TTTATTT-BHQ1-3'.

[0021] An eel herpesvirus detection kit, which includes the eel herpesvirus detection system described above, as well as RAA amplification reaction solution corresponding to the RAA amplification system, CRISPR / AsCas12f1 detection reaction solution corresponding to the CRISPR / AsCas12f1 detection system, a positive control, a negative control, and an instruction manual;

[0022] The positive control was a plasmid containing the ORF95 gene fragment of the eel herpesvirus;

[0023] The negative control was a template-free and enzyme-free aqueous solution.

[0024] The method for detecting eel herpesvirus includes the following steps:

[0025] (1) Sample processing: DNA was extracted from the tissue of the eel to be tested;

[0026] (2) RAA amplification: Add the DNA template to the RAA amplification system described above and incubate at 37-42℃ for 20-30 min;

[0027] (3) CRISPR / AsCas12f1 detection: The RAA amplification product was added to the CRISPR / AsCas12f1 detection system described above and incubated at 37-45℃ for 15-60 min.

[0028] (4) Result determination: If a fluorescent signal is detected, it is determined to be positive for eel herpesvirus; if no fluorescent signal is detected, it is determined to be negative for eel herpesvirus.

[0029] Preferably, the above-described eel herpesvirus detection system, the above-described eel herpesvirus detection kit, or the above-described eel herpesvirus detection method are used for rapid detection and early diagnosis of eel herpesvirus in eel farms or aquatic product quarantine departments.

[0030] Compared with the prior art, the beneficial effects of the present invention are:

[0031] This invention designs and screens a composition for detecting an eel herpesvirus (AngHV). The composition consists of specific RAA primers, specific crRNA, and ssDNA-FQ reporter probes. The primers used can specifically amplify and be recognized by the specific crRNA to target the target sequence, thus having the specificity for AngHV detection.

[0032] This invention designs an ssDNA-FQ reporter probe that utilizes the trans-cleavage activity of AsCas12f1 to cleave ssDNA-FQ and generate a fluorescent signal, which can visualize the detection results.

[0033] This invention combines RAA and CRISPR / AsCas12f1 to construct a method for detecting AngHV, improving detection sensitivity to 1 copy / μL. Furthermore, RAA-CRISPR / AsCas12f1 demonstrates accuracy and practicality for detecting clinical samples.

[0034] The detection system, kit, and method of this invention can be used for rapid detection and early diagnosis of AngHV in grouper farms, aquatic product quarantine departments, etc., which helps to take timely prevention and control measures and reduce economic losses. Attached Figure Description

[0035] Figure 1 This is a fluorescence detection diagram of gRNA in the AngHV detection system based on RAA-CRISPR / AsCas12f1 described in Example 1 of the present invention;

[0036] (A) Real-time fluorescence numerical graph detected by a real-time fluorescence PCR instrument;

[0037] (B) Endpoint fluorescence intensity map observed by gel imaging;

[0038] (C) Agarose gel electrophoresis analysis of the reaction products.

[0039] Figure 2 This is a fluorescence detection diagram of the RAA primers in the RAA-CRISPR / AsCas12f1-based AngHV detection system described in Example 1 of this invention;

[0040] (A) Agarose gel electrophoresis analysis of RAA amplification products;

[0041] (B) Graph of endpoint fluorescence values ​​detected by real-time PCR instrument;

[0042] (C) Endpoint fluorescence intensity map observed by gel imaging.

[0043] Figure 3This is a graph showing the pathogen-specific assay of the RAA-CRISPR / AsCas12f1 detection method.

[0044] (A) Graph of endpoint fluorescence values ​​detected by real-time PCR instrument;

[0045] (B) Endpoint fluorescence intensity map observed by gel imaging.

[0046] Figure 4 The sensitivity measurement graph for the RAA-CRISPR / AsCas12f1 detection method is shown.

[0047] (A) Graph of endpoint fluorescence values ​​detected by real-time PCR instrument;

[0048] (B) Endpoint fluorescence intensity map observed by gel imaging.

[0049] (C) Nucleic acid electrophoresis results for PCR sensitivity detection. Detailed Implementation

[0050] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0051] like Figures 1-4 As shown, the eel herpesvirus detection system includes:

[0052] RAA amplification system and CRISPR / AsCas12f1 detection system;

[0053] The RAA amplification system was used for isothermal amplification of the eel herpesvirus ORF95 gene fragment;

[0054] The CRISPR / AsCas12f1 detection system is used to identify RAA amplification products and generate fluorescence signals.

[0055] The RAA amplification system contains a specific primer pair targeting the eel herpesvirus ORF95 gene (GenBank Gene ID: 8683527), which showed no cross-reactivity as verified by BLAST. The sequence is as follows:

[0056] The primer pair is upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2;

[0057] The upstream primer is SEQ ID NO.1: GTTAAAGAGTCTGGCCCACACGCGTTTCAC;

[0058] The downstream primer SEQ ID NO.2: GGACATAACCATCCTCCTCGACAACGAACCC.

[0059] RAA amplification system (total volume 50 μL, preferred formulation):

[0060]

[0061]

[0062] Reaction conditions: Incubate at 37-42℃ for 20-30 min, preferably at 39℃ for 30 min (highest amplification efficiency and lowest nonspecificity).

[0063] The CRISPR / AsCas12f1 detection system specifically recognizes RAA amplification products and generates fluorescence signals through the trans-cleavage activity of AsCas12f1, thus enabling visualization of the detection results.

[0064] The CRISPR / AsCas12f1 detection system contains AsCas12f1 protein, specific sgRNA, and ssDNA-FQ fluorescent reporter molecule;

[0065] The sequence of the sgRNA is SEQ ID NO.3:

[0066] GGGAUUCGUCGGUUCAGCGACGAUAAGCCGAGAAGUGCCAAUAAAACUGUUAAGUGGUUUG;

[0067] The structure of the ssDNA-FQ fluorescent reporter molecule is 5'-6-FAM-TTTATTT-BHQ1-3'.

[0068] CRISPR / AsCas12f1 detection system (total volume 10 μL, preferred formulation):

[0069]

[0070]

[0071] sgRNA (SEQ ID NO.3): It is formed by the fusion of tracrRNA and crRNA. The crRNA part is complementary to the ORF95 specific fragment of the RAA amplification product, and the tracrRNA part binds to the AsCas12f1 protein.

[0072] The sequence is:

[0073] GGGAUUCGUCGGUUCAGCGACGAUAAGCCGAGAAGUGCCAAUAAAACUGUUAAGUGGUUUGG.

[0074] ssDNA-FQ fluorescent reporter molecule: structure is 5'-6-FAM-TTTATTT-BHQ1-3'.

[0075] 6-FAM is a fluorescent group (excitation wavelength 495nm, emission wavelength 520nm), and BHQ1 is a quenching group; when not cleaved, the fluorescence is quenched (no signal); after AsCas12f1 is activated, it cleaves the reporter molecule, the fluorescent group and the quenching group are separated, and a detectable fluorescent signal is generated.

[0076] Reaction conditions: Incubate at 37-45℃ for 15-60 min, preferably at 45℃ for 15-30 min (to balance signal intensity and reaction rate).

[0077] An eel herpesvirus detection kit, which includes the eel herpesvirus detection system described above, as well as RAA amplification reaction solution corresponding to the RAA amplification system, CRISPR / AsCas12f1 detection reaction solution corresponding to the CRISPR / AsCas12f1 detection system, a positive control, a negative control, and an instruction manual;

[0078] The positive control was a plasmid containing the ORF95 gene fragment of the eel herpesvirus;

[0079] The negative control was a template-free and enzyme-free aqueous solution.

[0080] RAA amplification reaction solution: containing A Buffer, 10 μmol / L upstream primer (SEQ ID NO.1), 10 μmol / L downstream primer (SEQ ID NO.2), and recombinase dry powder components (individually packaged to avoid inactivation);

[0081] CRISPR / AsCas12f1 detection reaction solution: containing 10×Reaction Buffer, 20 μmol / L AsCas12f1 protein, 20 μmol / L sgRNA (SEQ ID NO.3), and 10 μmol / L ssDNA-FQ fluorescent reporter molecule;

[0082] Positive control: pUC19 plasmid containing the AngHV ORF95 gene fragment (concentration 10). 3 (copy / μL) is used to verify the effectiveness of the detection system;

[0083] Negative control: template-free, enzyme-free aqueous solution, used to exclude environmental contamination;

[0084] Instruction manual: Provides detailed instructions on sample preparation, reaction procedures, result determination, and precautions.

[0085] Kit storage conditions: Store at -20℃ protected from light, and avoid repeated freeze-thaw cycles (recombinant enzyme dry powder components can be stored at 4℃ for short periods of ≤7 days).

[0086] The method for detecting eel herpesvirus includes the following steps:

[0087] (1) Sample processing: DNA was extracted from the tissue of the eel to be tested;

[0088] Sampling: Take 50-100 mg of sample from the gills, skin, or liver tissue of the eel to be tested (if it is a live eel, gill filament tissue can be taken; if it is a dead fish, diseased tissue should be taken first).

[0089] Lysis: Samples are lysed using commercial animal tissue DNA extraction kits (such as column extraction) to remove impurities such as proteins and RNA;

[0090] Elution: Elute the DNA with enzyme-free water to obtain the template to be tested (DNA concentration recommended 10-100 ng / μL, purity A260 / A280 = 1.8-2.0).

[0091] (2) RAA amplification: Add the DNA template to the RAA amplification system described above and incubate at 37-42℃ for 20-30 min;

[0092] System preparation: Add A Buffer (25 μL), upstream primer (2 μL), downstream primer (2 μL), and enzyme-free water (13.5 μL) to a sterile centrifuge tube in sequence, mix well, then add the recombinant enzyme dry powder component and gently shake until the dry powder is dissolved.

[0093] Sample loading: Add the DNA template to be tested (5 μL), and then add B Buffer (2.5 μL) to the inside of the centrifuge tube cap (to avoid mixing with the system in advance, which may cause enzyme inactivation);

[0094] Reaction: Cap the tube, gently invert the centrifuge tube 5-6 times to mix, centrifuge at low speed for 10 seconds (to ensure that B Buffer is completely incorporated into the system), and incubate in a 39°C metal bath for 30 minutes to complete the amplification.

[0095] (3) CRISPR / AsCas12f1 detection: The RAA amplification product was added to the CRISPR / AsCas12f1 detection system described above and incubated at 37-45℃ for 15-60 min.

[0096] System preparation: Add 10×Reaction Buffer (1μL), AsCas12f1 protein (1μL), sgRNA (1μL), ssDNA-FQ reporter molecule (1μL), and enzyme-free water (4μL) to a sterile centrifuge tube in sequence, and mix gently.

[0097] Add sample: Add RAA amplification product (2 μL), mix well and centrifuge at low speed for 10 seconds;

[0098] Reaction: Incubate in a 45℃ constant temperature metal bath for 30 minutes to complete signal generation.

[0099] (4) Result determination: If a fluorescent signal is detected, it is determined to be positive for eel herpesvirus; if no fluorescent signal is detected, it is determined to be negative for eel herpesvirus.

[0100] The results can be determined in two ways to adapt to different field conditions:

[0101] Method 1 (Fluorescence Detector): Place the reaction tube into the fluorescence detector (excitation wavelength 495nm, emission wavelength 520nm). If a fluorescence value is detected (and is more than 3 times higher than the negative control), it is determined to be AngHV positive; if the fluorescence value is no different from the negative control, it is determined to be AngHV negative.

[0102] Method 2 (UV / Blue Light): Irradiate the reaction tube with a 365nm UV lamp or a 488nm blue light in a dark room. If the liquid in the tube emits obvious green fluorescence, it is determined to be AngHV positive; if there is no fluorescence, it is determined to be AngHV negative.

[0103] Verification requirements: Each test must include both a positive control and a negative control. The positive control should show a positive signal, and the negative control should show no signal; otherwise, the test results are invalid.

[0104] The above-described eel herpesvirus detection system, eel herpesvirus detection kit, or eel herpesvirus detection method are applied in the rapid detection and early diagnosis of eel herpesvirus in eel farms or aquatic product quarantine departments.

[0105] Example 1: Design and synthesis of RAA primers and crRNA

[0106] (1) RAA primer design and synthesis: Based on the ORF95 gene sequence of eel herpesvirus published in GenBank (Gene ID: 8683527), specific primers were designed using Primer Premier 5.0 software according to the RAA primer design principle and synthesized by Shanghai Qingke Biotechnology Co., Ltd.

[0107] Forward primer: GTTAAAGAGTCTGGCCCACACGCGTTTCAC

[0108] Reverse primer: GGACATAACCATCCTCCTCGACAACGAACCC

[0109] (2) gRNA primer design: Using the sequence amplified by MCP-207F / R in the RPA reaction as the target sequence, and based on the PAM sequence of AsCas12f1 being 5'-NTTR-3' (where R is A or G), a PAM sequence was searched within the target sequence. The 20-23 nucleotides following the PAM sequence were selected, and the sequence should not overlap with the RPA primer sequence. Sequence specificity was analyzed using NCBI online BLAST comparison to confirm whether the sequence exists only in an eel herpesvirus. An AsCas12f1-fixed hairpin structure was added before the 5' end of the 20 nucleotides.

[0110] The gRNA template sequence is:

[0111] GGGATTCGTCGGTTCAGCGACGATAAGCCGAGAAGTGCCAATAAAACTGTTAAGTGGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX;

[0112] gRNA template forward primer:

[0113] TCTAATACGACTCACTATAGGGATTCGTCGG;

[0114] gRNA template reverse primer:

[0115] CTGGTACGGCCAATCCGAAAGTTCAGTGGTCTTGCCCGAAGG;

[0116] (3) gRNA synthesis:

[0117] Synthesize gRNA template: pUC19-gRNA_scaffold (AsCas12f1), use forward and reverse primers to specifically amplify gRNA template and then recover and purify it.

[0118] In vitro transcription system: 1 μg gRNA template DNA, 1 μL each of ATP / CTP / UTP / GTP, 2 μL 5×TranscriptAidReaction Buffer, 1 μL Transcript Enzyme Mix, and RNase-free H2O to a final volume of 10 μL. Purification was performed after incubation at 37°C for 4 h.

[0119] Example 2: RAA Amplification Reaction

[0120] (1) Preparation system: 25 μL of A Buffer, 2 μL each of upstream primer and downstream primer (10 μmol / L), 13.5 μL of water, mix well and then add the dry reaction powder;

[0121] (2) Add 5 μL of DNA sample (1.5 μL of eel herpesvirus sample 10 ng / μL);

[0122] (3) Add 2.5 μL of B Buffer to the tube cap, put the tube cap back on, invert and shake gently to mix 5 to 6 times, and centrifuge at low speed for 10 seconds.

[0123] (4) Incubate in a constant temperature metal bath at 39℃ for 30 minutes.

[0124] Example 3: CRISPR / AsCas12f1 detection

[0125] (1) Detection system preparation: 1 μL AsCas12f1 (20 μmol / L), 1 μL gRNA (20 μmol / L), 1 μL RAA amplification product, 1 μL 10×Reaction Buffer, 1 μL single-stranded reporter molecule (10 μmol / L), and enzyme-free water to 10 μL;

[0126] (2) Reaction conditions: Incubate at 45℃ for 30 min;

[0127] (3) Results showed that when the fluorescence signal was observed using a fluorescence detector, the positive sample produced obvious fluorescence signal, while the negative sample had no fluorescence signal.

[0128] Example 4: Application of CRISPR / AsCas12f1 in detecting eel herpesvirus

[0129] Fish tissue samples suspected of being infected with eel herpesvirus were collected from eel farms and tested using the kit of this invention. The results showed that some samples were positive for eel herpesvirus, consistent with PCR test results, thus verifying the accuracy and reliability of the kit of this invention.

[0130] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. An eel herpesvirus detection system, including: RAA amplification system and CRISPR / AsCas12f1 detection system; The RAA amplification system was used for isothermal amplification of the eel herpesvirus ORF95 gene fragment; The CRISPR / AsCas12f1 detection system is used to identify RAA amplification products and generate fluorescence signals.

2. The eel herpesvirus detection system according to claim 1, characterized in that, The RAA amplification system contains a specific primer pair targeting the eel herpesvirus ORF95 gene; The primer pair is upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2; The upstream primer is SEQ ID NO.1: GTTAAAGAGTCTGGCCCACACGCGTTTCAC; The downstream primer SEQ ID NO.2: GGACATAACCATCCTCCTCGACAACGAACCC.

3. The eel herpesvirus detection system according to claim 1, characterized in that, The CRISPR / AsCas12f1 detection system contains AsCas12f1 protein, specific sgRNA, and ssDNA-FQ fluorescent reporter molecule; The sequence of the sgRNA is SEQ ID NO.3: GGGAUUCGUCGGUUCAGCGACGAUAAGCCGAGAAGUGCCAAUAAAACUGUUAAGUGGUUUG; The structure of the ssDNA-FQ fluorescent reporter molecule is 5'-6-FAM-TTTATTT-BHQ1-3'.

4. An eel herpesvirus detection kit, characterized in that, The kit contains the eel herpesvirus detection system as described in any one of claims 1 to 3, and also contains the RAA amplification reaction solution corresponding to the RAA amplification system, the CRISPR / AsCas12f1 detection reaction solution corresponding to the CRISPR / AsCas12f1 detection system, a positive control, a negative control, and an instruction manual; The positive control was a plasmid containing the ORF95 gene fragment of the eel herpesvirus; The negative control was a template-free and enzyme-free aqueous solution.

5. A method for detecting eel herpesvirus, characterized in that, Includes the following steps: (1) Sample processing: DNA was extracted from the tissue of the eel to be tested; (2) RAA amplification: Add the DNA template to the RAA amplification system according to any one of claims 1 to 3 and incubate at 37-42℃ for 20-30 min; (3) CRISPR / AsCas12f1 detection: Add the RAA amplification product to the CRISPR / AsCas12f1 detection system according to any one of claims 1 to 3, and incubate at 37-45℃ for 15-60 min; (4) Result determination: If a fluorescent signal is detected, it is determined to be positive for eel herpesvirus; if no fluorescent signal is detected, it is determined to be negative for eel herpesvirus.

6. The application of the eel herpesvirus detection system according to any one of claims 1 to 5, the eel herpesvirus detection kit according to claim 4, or the eel herpesvirus detection method according to claim 5 in the rapid detection and early diagnosis of eel herpesvirus in eel farms or aquatic product quarantine departments.

Images