Application of ginsenoside CK in preparation of medicine for treating diseases by activating PPARgamma and / or CPT1A pathway

Abstract

The invention relates to application of ginsenoside CK in preparation of drugs for treating diseases by activating PPAR gamma and / or CPT1A pathways, and belongs to the technical field of medicines.The action mechanism of ginsenoside CK in prevention or treatment of metabolism-related fatty liver diseases (MAFLD) is obtained for the first time through research, and by establishing an MAFLD mouse model and an MAFLD cell model respectively, the action mechanism of ginsenoside CK in prevention or treatment of metabolism-related fatty liver diseases is obtained. Through PPAR gamma and CPT1A inhibition and ginsenoside CK intervention tests, the application of ginsenoside CK in remarkably reducing expression of ACC1 / FAS / SREBP1c, improving expression of CPT1 / CPT2, reducing serum TG / TC / FFA / LDL-C / ALT / AST level, increasing HDL-C, reducing hypoglycemia / insulin level and insulin resistance index, reducing ROS accumulation of hepatocytes, improving mitochondrial membrane potential, improving mitochondrial membrane potential, reducing liver cancer, reducing liver cancer, reducing liver cancer, reducing liver cancer, reducing liver cancer, reducing liver cancer and reducing liver cancer. The invention relates to a mechanism for preventing or treating MAFLD by inhibiting an NF-kappa B / JNK inflammation pathway and the like, and provides a new candidate component for research and development of MAFLD treatment drugs.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically, it relates to the application of ginsenoside CK in the preparation of drugs that treat diseases by activating the PPARγ and / or CPT1A pathways. Background Technology

[0002] Metabolic fatty liver disease (MAFLD) is one of the most common chronic liver diseases worldwide, characterized by excessive lipid accumulation in hepatocytes. It can progressively develop into non-alcoholic steatohepatitis (NASH), liver fibrosis, cirrhosis, and even hepatocellular carcinoma. It is also closely associated with metabolic syndrome-related complications such as type 2 diabetes, obesity, and cardiovascular disease. Compared to NAFLD, MAFLD has more clearly defined diagnostic criteria, directly linking to metabolic risk factors. NAFLD is characterized by hepatic steatosis without a history of excessive alcohol consumption or other liver diseases. MAFLD, in addition to hepatic steatosis, is accompanied by overweight / obesity, type 2 diabetes, or metabolic risks (such as increased waist circumference, hypertension, insulin resistance, hypertriglyceridemia, low high-density lipoprotein cholesterol, and hyperglycemia). Statistics show that the global incidence of MAFLD is extremely high, affecting approximately 25% to 30% of the global population. A cross-sectional study of 139,170 Chinese participants showed an overall prevalence of MAFLD of 26.1%. The prevalence was significantly higher in men (35.4%) than in women (14.1%), and in individuals under 65 years of age, the prevalence increased with age. These differences in gender and age distribution suggest that different populations may have different risk factors and susceptibility to the disease.

[0003] MAFLD is a complex disease caused by a combination of genetic, environmental, and lifestyle factors, and its pathogenesis is related to multiple pathophysiological abnormalities. Its pathological process involves the combined effects of multiple pathways, including systemic insulin resistance leading to abnormal lipid deposition, hepatocellular damage, and chronic inflammatory responses. In summary, MAFLD is a dynamic, multi-directional process associated with various metabolic disorders and lipid accumulation, and elucidating its specific pathogenic mechanisms is crucial for improving MAFLD. Given the complexity of the development and progression of MAFLD, scientists have proposed several hypotheses through experimental verification. Among them, the "multiple-hit" theory posits that MAFLD is caused by a series of parallel factors, including lipid metabolism disorders, lipotoxicity, oxidative stress, mitochondrial dysfunction, endoplasmic reticulum stress, intestinal endogenous endotoxins, abnormally secreted cytokines and adipokines, and genetic susceptibility. Currently, there are no approved drugs for the clinical treatment of MAFLD. Treatment primarily focuses on alleviating MAFLD through diet and exercise, but patient adherence is poor, resulting in limited effectiveness. While atorvastatin calcium tablets and fenofibrate can be used clinically to regulate blood lipids and reduce fat accumulation in the liver, the use of lipid-lowering drugs can also easily induce other adverse reactions such as rhabdomyolysis, liver damage, and gastrointestinal reactions, thus limiting their clinical application. Furthermore, although vitamin C supplementation and lifestyle modifications are effective in treating MAFLD, patient adherence is poor. Given the advantages of traditional Chinese medicine (TCM)—abundant resources, multiple targets, few toxic side effects, and no drug resistance—it has attracted considerable attention in the development of drugs for metabolic diseases. Therefore, there is an urgent need to find therapeutic drugs with high efficacy, few side effects, and targeted therapy for MAFLD.

[0004] Panax notoginseng, a traditional and precious Chinese medicinal herb, has been shown to possess various pharmacological activities, including hepatoprotective effects, lipid metabolism regulation, and anti-inflammatory properties, primarily due to its main active ingredient, notoginsenoside (PNS). However, the oral bioavailability of PNS is low, requiring metabolism by intestinal flora to convert it into secondary active products before effective absorption. Among these, ginsenoside CK, ginsenoside Rh2, and protopanaxadiol (PPD) are the main metabolites that enter the bloodstream. Ginsenoside CK (20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol) is a rare, non-natural tetracyclic triterpenoid compound. As a rare saponin derived from PPD-type ginseng by intestinal bacteria, ginsenoside CK possesses diverse pharmacological activities. Existing studies have shown that ginsenoside CK exhibits good activity in anti-tumor, anti-diabetic, and anti-inflammatory activities, but its role and mechanism in the treatment of MAFLD remain unclear, and related applications have not been reported. Summary of the Invention

[0005] To overcome the problems existing in the background technology, this invention, through extensive research, has concluded that ginsenoside CK has an important effect on activating the PPARγ and / or CPT1A pathways, and can be used as a drug to treat diseases by activating PPARγ or CPT1A, while also having a significant effect on the treatment of metabolic-related fatty liver disease.

[0006] The first objective of this invention is to provide the use of ginsenoside CK in the preparation of medicaments for treating diseases by activating the PPARγ and / or CPT1A pathways.

[0007] Furthermore, the disease mentioned is metabolic-associated fatty liver disease (MAFLD).

[0008] A second objective of this invention is to provide a medicament for treating diseases by activating the PPARγ and / or CPT1A pathways, the medicament comprising ginsenoside CK.

[0009] Furthermore, the drug is any one of the following: injection, tablet, capsule, pill, granule, powder, ointment, or mixture.

[0010] This invention also provides the use of ginsenoside CK in the preparation of a drug for the prevention or treatment of metabolic-associated fatty liver disease (MAFLD).

[0011] Furthermore, the ginsenoside CK exerts its application in the preparation of drugs for the treatment or prevention of metabolic-associated fatty liver disease (MAFLD) through any of the following pathways: activating the PPARγ and / or CPT1A pathway, enhancing lipid metabolism in Huh7 cells, inhibiting FFA-induced hepatocyte damage and lipid accumulation, and improving insulin resistance in MAFLD rats.

[0012] The beneficial effects of this invention are: This invention is the first to demonstrate that ginsenoside CK regulates lipid metabolism by activating the PPARγ / CPT1A pathway, thereby exerting a preventive and therapeutic mechanism against metabolism-related fatty liver disease.

[0013] This invention demonstrates that ginsenoside CK significantly reduces the expression of ACC1, FAS, and SREBP1c while increasing the expression of CPT1 and CPT2 by activating the PPARγ / CPT1A pathway; improves metabolic indicators by reducing serum TG, TC, FFA, LDL-C, ALT, and AST levels and increasing HDL-C; alleviates insulin resistance by lowering blood glucose, insulin levels, and the insulin resistance index; and inhibits oxidative stress and liver damage by reducing ROS accumulation in hepatocytes, improving mitochondrial membrane potential, and inhibiting the NF-κB / JNK inflammatory pathway, thus exhibiting preventive and therapeutic effects on metabolic-related fatty liver disease. Attached Figure Description

[0014] Figure 1 This is a statistical graph of rat body weight curve in Example 1 of the present invention. * indicates P<0.05; ** indicates P<0.01. Figure 2 In the figures, Figure A shows the liver index statistics of rats in Example 1, and Figure B shows the fat index statistics of rats in Example 1. * indicates P<0.05; ** indicates P<0.01. Figure 3 This is a statistical chart showing the levels of TC (Figure A), TG (Figure B), LDL-C (Figure C), and HDL-C (Figure D) in rat serum in Example 1 of this invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 4 This is a statistical chart showing the levels of LDH (Figure A), ALT (Figure B), AST (Figure C), and NEFA (Figure D) in rat serum in Example 1 of this invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 5 Figure 1 shows the statistical results of glucose content (Figure L), insulin content (Figure M), and insulin resistance index (Figure N) in rat serum in Example 1 of this invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 6 From top to bottom, the images are: a representative image of rat liver tissue from Example 1 of the present invention, a representative image of rat liver tissue Oil Red O staining results (40×), and a representative image of rat liver tissue HE staining results (40×). Figure 7 This is a statistical chart of Oil Red O staining in Example 1 of the present invention; Figure 8 This is a statistical graph showing the expression of lipid metabolism genes and proteins in rat hepatocytes in Example 1 of the present invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 9 The images show a representative ROS immunofluorescence image (40×) and a statistical graph of rat liver tissue from Example 1 of this invention. * indicates P<0.05; ** indicates P<0.01. Figure 10 This is a schematic diagram (40×) and statistical graph of JNK immunofluorescence in mouse liver tissue of Example 1 of the present invention. * indicates P<0.05; ** indicates P<0.01. Figure 11 This is a schematic diagram (40×) and statistical graph of NF-κB immunofluorescence in rat liver tissue of Example 1 of the present invention. * indicates P<0.05; ** indicates P<0.01. Figure 12 This is a statistical chart of cell viability detected by CCK-8 in Example 2 of the present invention; Figure 13This is a statistical chart showing the content of TG (Figure A), TC (Figure B), and NEFA (Figure C) in 106 cells in Example 2 of the present invention. * indicates P<0.05; ** indicates P<0.01. Figure 14 This is a representative image (40×) of cells stained with Oil Red O in Example 2 of the present invention. Figure 15 This is the result of Oil Red O staining in Example 2 of the present invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 16 This is a representative diagram showing the expression of lipid metabolism genes and proteins in hepatocytes in Example 2 of the present invention; Figure 17 This is a statistical graph of lipid metabolism gene and protein expression in hepatocytes in Example 2 of the present invention. * indicates P<0.05; ** indicates P<0.01. Figure 18 This is a statistical chart showing the relative mRNA expression levels of the ACC1 gene (Figure A), FAS gene (Figure B), SREBP1c gene (Figure C), CPT2 gene (Figure D), and CPT1 gene (Figure E) in hepatocytes in Example 2 of the present invention. * indicates P < 0.05; ** indicates P < 0.01. Figure 19 The images show representative fluorescence diagrams and immunofluorescence statistics of ROS (A / B) and JC-1 (C / D) in hepatocytes in Example 2. * indicates P<0.05; ** indicates P<0.01; *** indicates P<0.001. Detailed Implementation

[0015] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are all within the scope of protection of this invention.

[0016] To illustrate the present invention more clearly, the following embodiments will be described in detail.

[0017] Example 1 The effect and mechanism of ginsenoside CK on MAFLD rat model 1. Laboratory animals and reagents 1.1 Experimental animals: 60 adult SPF-grade male SD rats, weighing 250±20 g, were purchased from the Experimental Animal Center of Kunming Medical University (Production License Number: SYXK (Yunnan) K2020-0006). Before the experiment, the purchased SD rats were adaptively fed for 1 week in an environment with a temperature of 22-25°C, a humidity of 55-60%, a light cycle of 12 / 12, and free access to water.

[0018] 1.2 High-fat diet and normal diet were purchased from Yunnan Kasmall Mall. High-fat diet formula: Table 1 Composition ratio of high-fat diet Element mass percentage Crude fat 4.0% crude protein 14.2% crude fiber 5.0% Coarse ash 1.0% Total phosphorus 0.4% calcium 0.48% Moisture 8.9% 1.3 Main reagents: Ginsenoside CK (purity >98%) was purchased from Beijing Solarbio Science & Technology Co., Ltd. Detection kits for cholesterol TC, triglyceride TG, high-density lipoprotein cholesterol HDL-C, low-density lipoprotein cholesterol LDL-C, non-free fatty acid NEFA, alanine aminotransferase ALT, aspartate aminotransferase AST, and lactate dehydrogenase LDH were purchased from Nanjing Jiancheng Bioengineering Institute; ROS and mitochondrial membrane potential kits were purchased from Shanghai Beyotime Biotechnology Co., Ltd. PPARγ antibody, CPT1A antibody, ACC1 antibody, FAS antibody, and SREBP1c antibody were purchased from Abcam; PPARγ inhibitor GW9662 was purchased from Sigma; CPT1A inhibitor was purchased from Tsingke Biological.

[0019] 2. Experimental methods 2.1 Establishment, grouping, and treatment of metabolic associated fatty liver disease model Sixty rats were randomly divided into a control group, a high-fat diet (HFD) model group, an HFD + atorvastatin (AC) group, an HFD + CK intervention group (CK), an HFD + PPARγ inhibitor group (CK + PPARγ inhibitor) group, and an HFD + CPT1A inhibitor group (CK + CPT1A inhibitor), with 10 rats in each group. The success rate of establishing the MAFLD rat model with the HFD diet was approximately 80%. After feeding 10 rats in each experimental group with a high-fat diet for 6 weeks to establish the MAFLD rat model, 6 successfully modeled MAFLD rats from each group were selected for subsequent experiments. Control group rats were fed a normal animal diet daily. Rats in the HFD model group, HFD+atorvastatin group, HFD+CK intervention group, HFD+PPARγ inhibitor group, and HFD+CPT1A inhibitor group were fed a high-fat diet daily. Starting from week 7, the normal control group and model group were treated with physiological saline at a dose of 10 mL / kg. The HFD+atorvastatin group received atorvastatin via gavage at a dose of 10 mg / kg. The HFD+CK intervention group, HFD+PPARγ inhibitor group, and HFD+CPT1A inhibitor group received CK via gavage at a dose of 10 mg / kg. The HFD+PPARγ inhibitor group received an intraperitoneal injection of a PPARγ inhibitor (GW9662) at a dose of 2 mg / kg in addition to CK. The HFD+CPT1A inhibitor group received an intraperitoneal injection of a CPT1A inhibitor (TDGA) at a dose of 60 mg / kg in addition to CK. All treatments were administered once daily for 6 weeks. The model construction and treatment intervention lasted for a total of 12 weeks. Throughout the process, weight was monitored and a weight gain curve was plotted (see...). Figure 1 The experimental results showed that, after treatment, the rats in the model group had significantly higher body weights compared to the control group (P<0.5); compared to the model group, the rats in the ginsenoside CK group had significantly lower body weights (P<0.05), indicating that ginsenoside CK reduced the weight gain of rats. The normal diet provided 10% of the energy, while the high-fat diet provided 60%.

[0020] 2.2 Sample Collection At the end of the experiment, rats were anesthetized with isoflurane, and blood was drawn from the abdominal aorta after opening the abdominal cavity. After blood collection, rats in each group were sacrificed, and liver, subcutaneous tissue, and abdominal adipose tissue were collected. The tissues were washed with physiological saline, blotted dry with filter paper, photographed, and weighed. The weight of the liver and fat was recorded for subsequent calculation of the rat liver index and fat index. Results ( Figure 2The results showed that the liver index of the model group rats was 0.042 and the fat index was 0.057. Compared with the model group, the liver index of rats treated with atorvastatin was 0.030, a decrease of 27.2%, and the fat index was 0.035, a decrease of 38.6%. After treatment with ginsenoside CK, the liver index of rats was 0.03, a significant decrease of 28.9% (P<0.05), and the fat index of rats treated with ginsenoside CK was 0.033, a decrease of 42.5% (P<0.05), with a significantly greater reducing effect than atorvastatin. After recording, three portions of left liver lobe tissue were taken from each rat. Two portions were frozen in liquid nitrogen in cryovials, and one portion was fixed in 4% paraformaldehyde solution.

[0021] 2.3 Detection of biochemical indicators of fatty liver According to the kit instructions, the rat blood lipids (cholesterol TC, triglycerides TG, high-density lipoprotein cholesterol HDL-C, low-density lipoprotein cholesterol LDL-C, free fatty acids NEFA) and serum enzyme indicators (alanine aminotransferase ALT, aspartate aminotransferase AST, lactate dehydrogenase LDH) were measured.

[0022] result( Figure 3 Figure 4 The results showed that HFD treatment significantly increased the expression levels of TG, TC, NEFA, LDL-C, ALT, AST, and LDH in rat serum, while decreasing HDL-C expression. After treatment with ginsenoside CK, the levels of TG, TC, NEFA, LDL-C, ALT, AST, and LDH in rat serum significantly decreased, while HDL-C expression significantly increased with good improvement. Inhibition of PPARγ or CPT1A expression significantly increased the levels of TG, TC, NEFA, LDL-C, ALT, AST, and LDH in rat serum, while decreasing HDL-C. Furthermore, Oil Red O staining of the liver (part 2.6) showed the same results. HFD led to significant lipid accumulation and increased adipocyte volume in the liver tissue of the model group rats, while ginsenoside CK treatment significantly reduced lipid accumulation in the liver tissue. Figure 6 Figure 7 The inhibition of PPARγ or CPT1A significantly improved the increase in adipocyte volume. However, after inhibiting PPARγ or CPT1A, lipid accumulation in hepatocytes increased significantly. Figure 6 Figure 7 This indicates that CK exerts its inhibitory effect on lipid accumulation in hepatocytes through PPARγ and CPT1A. In conclusion, HFD leads to abnormal lipid metabolism and lipid accumulation in the liver of model rats. Ginsenoside CK has a good effect on improving lipid metabolism and lipid accumulation in MAFLD rats, and it exerts its effect through PPARγ and CPT1A.

[0023] 2.4 Detection of fasting blood glucose, fasting insulin levels, and insulin resistance index in rats Rat blood was coagulated at room temperature for 10-20 min, centrifuged at 2000-3000 rpm / min for 20 min, and the supernatant was used. A equilibrated strip was taken, and 50 μL of the corresponding solution and biotinylated antibody were added. The strip was incubated at 37℃ for 1 h and washed 3 times. 100 μL of enzyme conjugate was added, and the strip was incubated at 37℃ for 30 min and washed 5 times. The substrate was added and incubated in the dark for 15 min. The stop solution was added, and the OD value at 450 nm was measured. Insulin resistance index = fasting blood glucose (mIU / L) × serum insulin (mmol / L) / 22.5.

[0024] result( Figure 5 This indicates that obesity is always accompanied by insulin resistance. Compared with the control group rats, the model group rats showed significantly increased blood glucose and insulin levels, as well as a significantly increased insulin resistance index, after being fed a high-fat diet. However, after CK treatment, blood glucose and insulin levels and the insulin resistance index were significantly reduced. But in rats where PPARγ and CPT1A expression was inhibited, the ability of CK to reduce blood glucose and insulin levels was significantly reduced. This suggests that ginsenoside CK treatment can significantly improve insulin resistance in MAFLD rats, and the inhibition of insulin resistance in rats is dependent on PPARγ and CPT1A.

[0025] 2.5 HE staining observation of rat liver, fat and other tissue pathology Rat liver and abdominal fat tissues were prepared into paraffin sections; dewaxed with xylene, hydrated with graded ethanol, stained with hematoxylin for 10 min, differentiated with hydrochloric acid and ethanol for 10 s; stained with eosin for 5 min, dehydrated with graded ethanol, cleared with xylene, mounted with resin, and observed and photographed under a microscope for histopathological examination of rat liver, fat, and other tissues. Figure 6 ).

[0026] The effect of ginsenoside CK on liver and abdominal fatty lesions in MAFLD rats was detected by HE staining. HE results ( Figure 6 We observed that compared to the control group, a high-fat diet led to increased liver cell volume, disordered hepatocyte arrangement, and significant inflammatory cell infiltration in the liver. These pathological changes were alleviated to some extent after treatment with ginsenoside CK, with a significant reduction in inflammatory cell infiltration and a more orderly arrangement of hepatocytes after CK treatment. In adipose tissue, CK treatment significantly reduced adipocyte volume. However, the improvement achieved by CK was significantly inhibited in rats with suppressed PPARγ and CPT1A expression. This indicates that CK can inhibit hepatic steatosis in rats with metabolic-associated fatty liver disease in a manner dependent on PPARγ and CPT1A.

[0027] 2.6 Oil Red O staining to observe lipid accumulation in the liver Rat liver was prepared into frozen sections, thawed at room temperature, washed with distilled water, dried, and immersed in 60% isopropanol for 2 min; Oil Red O stock solution was added, and working solution was added for 2-5 min, followed by rinsing off the remaining stain with 60% isopropanol, and counterstaining with hematoxylin for 1 min. The sections were then observed and photographed under a microscope to observe the lipid accumulation in the liver. Figure 6 and Figure 7 The results showed that the livers of the control group had uniform color and normal texture, while the livers of the model group were enlarged and oily on the surface. Compared with the control group, the liver condition of the model group was significantly improved after treatment with ginsenoside CK, and the color and texture were close to those of the control group. However, the improvement effect of CK on the above conditions was significantly inhibited in rats in the PPARγ and CPT1A expression inhibition groups. Secondly, the statistical area of ​​oil droplets in the liver of the control group was small, while a large number of large and dense red oil droplets could be seen in the high-fat model group, indicating significant lipid accumulation in the liver of rats in the model group. After treatment with ginsenoside CK, the number of lipid droplets decreased significantly, the area decreased significantly, and the lipid accumulation level decreased significantly. However, after inhibiting PPARγ or CPT1A, lipid accumulation in hepatocytes increased significantly again, indicating that CK exerts its inhibitory effect on lipid accumulation in hepatocytes through PPARγ and CPT1A.

[0028] 2.7 ROS test to assess liver oxidative stress damage The accumulation of lipid levels can easily lead to mitochondrial dysfunction in cells, resulting in the accumulation of ROS and triggering oxidative stress, which in turn aggravates hepatocyte damage. Therefore, we used immunofluorescence experiments to detect the accumulation of ROS in liver tissue in order to evaluate the inhibitory effect of ginsenoside CK on oxidative stress.

[0029] Rat liver sections were prepared, rinsed with 0.01 mol / L PBS for 3 × 10 min; permeabilized with 3 mol / L Triton X-100 for 15 min, and blocked with normal sheep serum for 30 min; 10 μM DHE primary antibody fluorescent probe incubation solution was added, incubated at 37℃ for 30 min, rinsed with PBS for 3 × 10 min to remove primary antibody; fluorescent secondary antibody was added, incubated at 37℃ for 1 h in the dark, rinsed with PBS for 1 h (3 × 20 min), mounted with glycerol, and fluorescence was detected and counted under a fluorescence microscope.

[0030] result( Figure 9 The study showed that in rats on a high-fat diet, ROS accumulated significantly in hepatocytes, indicating hepatocyte damage. Compared with the model group, ROS accumulation in hepatocytes of MAFLD rats was significantly reduced after treatment with ginsenoside CK, with the most significant ROS inhibition observed after CK treatment. These results indicate that ginsenoside CK can inhibit FFA-induced hepatocyte damage and lipid accumulation, further suggesting that ginsenoside CK has a good ameliorative effect on MAFLD.

[0031] 2.8 Immunofluorescence detection of liver damage Inflammation is a key marker of MAFLD and a significant factor contributing to liver damage in MAFLD. NF-κB and JNK activation are essential conditions for inflammation. Therefore, I used immunofluorescence to detect the expression levels of NF-κB and JNK in MAFLD to evaluate the ameliorative effect of ginsenoside CK on MAFLD.

[0032] Prepare tissue sections. Wash liver sections with PBS for 3×10 min; permeabilize with Triton X-100 for 15 min; block with normal sheep serum for 30 min; add JNK / NF-κB primary antibody (1:50), incubate at 37℃ for 1 h or at room temperature overnight, wash with PBS for 3×10 min; add FITC fluorescent secondary antibody (1:50), incubate at 37℃ in the dark for 1 h, wash with PBS 3 times; air-dry the slides, mount with glycerol, scan with a Leica TCS-SP5 laser confocal microscope (488nm green fluorescence, 561nm red fluorescence), acquire data by computer, and perform digital imaging.

[0033] result( Figure 10 and 11 The results showed that, compared with the control group, NF-κB and JNK were significantly activated in the model group rats, indicating liver inflammation and liver damage. However, after treatment with ginsenoside CK, the activation of NF-κB and JNK was significantly inhibited. Furthermore, in the hepatocytes of rats in the PPARγ and CPT1A inhibition group, the inhibitory effect of CK treatment on the NF-κB and JNK pathways in hepatocytes was significantly reduced, further suggesting that ginsenoside CK has a good ameliorative effect on HFD-induced MAFLD liver damage in rats and is dependent on PPARγ and CPT1A.

[0034] 2.9 Western Blot (WB) Detection of Cellular Protein Expression We used Western blotting (WB) to detect the expression of lipid metabolism-related factors in rat hepatocytes: total cellular protein was extracted using a protein extraction kit, and the concentration was measured using the BCA method; after spotting 50 μg / well, the sample was subjected to 10% SDS-PAGE electrophoresis for 1 h and transferred to a PVDF membrane, then blocked with 5% skim milk PBS for 1 h. Primary antibodies against target SREBP1c, FAS, ACC1, and CPT1, as well as the internal control GAPDH antibody, were added, and the membrane was incubated overnight at 4°C; the membrane was washed three times with PBST, and then incubated with secondary antibody at 37°C for 2 h, followed by three more washes with PBST. The membrane was developed using ECL substrate, imaged using a protein gel imaging system, and the grayscale values ​​were analyzed using ImageJ.

[0035] WB results (e.g.) Figure 8The results showed that after treatment with ginsenoside CK, the relative protein expression levels of lipid synthesis factors ACC1, FAS, and SREBP1c were significantly downregulated, while the expression levels of ANGPTL4, CPT1A, and PPPARγ were significantly increased. However, the inhibitory effect of CK on lipid synthesis factors was significantly weakened after inhibiting the expression of PPARγ or CPT1A, indicating that ginsenoside CK treatment of MAFLD rats works through PPARγ and CPT1A.

[0036] 2.10 Statistical Analysis Analysis was performed using GraphPad Prism 9, and results are expressed as mean ± SEM. Western blot grayscale values ​​were statistically analyzed using Image J. Student's t-test was used for comparisons between two groups, and one-way / multi-way ANOVA was used for comparisons between multiple groups. P < 0.05 was considered statistically significant.

[0037] Example 2: Effect of Ginsenoside CK on MAFLD Cell Model and Mechanism Verification 1. Laboratory animals and reagents 1.1 Cell line: Human immortalized hepatocyte cell line Huh7 (purchased from Pronosei Biotechnology Co., Ltd.) 1.2 Main reagents: Drugs and reagents: Oleic acid (OA) and palmitic acid (PA) were purchased from Beijing Solarbio Science & Technology Co., Ltd.; DMEM culture medium and fetal bovine serum were purchased from Gibco; CCK-8 kit was purchased from Beyotime; TG, TC, NEFA detection kits and JC-1 mitochondrial membrane potential detection kits were purchased from Nanjing Jiancheng Biotechnology Institute; PPARγ antibody, CPT1A antibody, ACC1 antibody, FAS antibody, and SREBP1c antibody were purchased from Abcam; PPARγ inhibitor GW9662 was purchased from Sigma; CPT1A knockdown siRNA and negative control kits were purchased from Qingke Biotechnology.

[0038] 2. Experimental Methods 2.1 Cell Experiments and Processing Methods Huh7 hepatocytes were cultured in DMEM / RPMI-1640 medium and treated with a 1.5 mmol / L free fatty acid (FFA) mixture (PA:OA = 1:2) for 48 h to establish an in vitro fatty liver cell model. After successful modeling, corresponding drug treatments were administered according to the groups. The experimental groups were as follows: control group; model group; atorvastatin intervention group; model + CK intervention group (CK); model + CK + PPARγ inhibitor group (CK + PPARγ Inhibitor); model + CK + CPT1A knockdown group (CK + CPT1A KD); and model + CK + PPARγ inhibitor + CPT1A overexpression group (CK + PPARγ Inhibitor + CPT1A OV). Control group cells were cultured in DMEM / RPMI-164; model group, atorvastatin group, model + CK intervention group, model + CK + PPARγ inhibitor group, model + CK + CPT1A knockdown group, and model + CK + PPARγ inhibitor + CPT1A overexpression group cells were cultured in MEM / RPMI-1640 containing 1.5 mmol / mL FFA, and co-incubated with 25 μmol / mL CK, while the model + CK + PPARγ inhibitor group was incubated with 50 μmol / mL GW9662 in addition to the above. The model + CK + PPARγ inhibitor + CPT1A overexpression group overexpressed CPT1A during GW9662 incubation. After 48 hours of treatment, cells were collected for relevant detection.

[0039] 2.2 CCK8 assay for cell proliferation activity Logarithmically growing Huh7 cells were seeded into 96-well plates and incubated at 37°C with 5% CO2 for 0, 24, 48, and 72 hours. At each time point, 10 μL of CCK-8 reagent was added, and after 2 hours of incubation, the absorbance at 450 nm was measured using a microplate reader to detect cell proliferation activity. Results ( Figure 12 The results showed that, compared with the control group, the cell viability of the model group was significantly reduced. However, after CPT1A overexpression / knockdown and PPARγ inhibition, there was no significant difference in hepatocyte viability between the model group and the CK group. This indicates that PPARγ inhibition and CPT1A overexpression / knockdown will not affect subsequent experimental studies by interfering with hepatocyte viability.

[0040] 2.3 Oil Red O staining was used to detect the lipid droplet content in cells of each group. The lipid accumulation in cells was verified using Oil Red O staining: cell culture plates were taken, the culture medium was aspirated, and the plates were rinsed with 60% isopropanol for 2 min; then stained with Oil Red O staining solution for 2-5 min, and rinsed twice with 60% isopropanol to remove residual stain; hematoxylin was added for counterstaining for 1 min, and finally observed and photographed under a microscope.

[0041] Oil Red O staining results ( Figure 14 and Figure 15 Consistent with the ELISA results (section 2.4), lipid accumulation in Huh7 cells significantly increased 48 hours after FFA induction, while lipid content significantly decreased after CK treatment. This indicates that CK significantly enhances lipid metabolism in Huh7 cells, inhibiting the accumulation of NEFA, TG, and TC in hepatocytes. Simultaneously, we measured the levels of TG, TC, and free fatty acids in MAFLD cells with PPARγ inhibition and CPT1A knockdown. Inhibition of PPARγ and CPT1A knockdown during CK treatment significantly reduced the therapeutic effect of CK. However, compared to the PPARγ inhibition group, overexpression of CPT1A during PPARγ inhibition significantly improved the therapeutic effect of CK. This suggests that CK can inhibit the accumulation of NEFA, TG, and TC in hepatocytes by activating PPARγ and CPT1A.

[0042] 2.4 Detection of TG, TC, and NEFA levels in hepatocytes We measured the levels of TG, TC, and free fatty acids in FFA-induced Huh7 cells to assess the effect of CK treatment on lipid accumulation in Huh7 cells.

[0043] Hepatocytes from each group were collected, centrifuged at 1000 rpm for 20 min at 4℃, and the supernatant was collected for testing. The levels of TC, TG, and NEFA in the cells were measured according to the instructions of the TG, TC, and NEFA kits.

[0044] ELISA results ( Figure 13 The results showed that after 48 h of FFA induction, the contents of TG, TC and free fatty acids in Huh7 cells increased significantly, while the expression levels of TG, TC and free fatty acids in cells decreased significantly after CK treatment.

[0045] 2.5 Detection of ROS Levels Using DCFH-DA Fluorescent Probe Method We used immunofluorescence to assess hepatocyte damage: cells from each group were collected, old culture medium was discarded, and cells were washed twice with pre-cooled PBS; PBS was discarded, and DCFH-DA probe diluted with DMEM was added and incubated at 37°C for 20 min. The probe was then discarded, and cells were washed twice more with pre-cooled PBS. Images were observed and recorded using an inverted fluorescence microscope, and the average ROS fluorescence intensity was calculated using ImageJ.

[0046] 2.6 JC-1 kit for detecting mitochondrial membrane potential Collect cells from each group, discard the old culture medium, and wash twice with pre-cooled PBS; discard the PBS, add JC-1 staining working solution, incubate at 37℃ for 1 h, wash twice with pre-cooled PBS, and finally detect with a fluorescence spectrophotometer or a fluorescence microplate reader. The excitation light of JC-1 monomer is set to 490 nm and the emission light is set to 530 nm.

[0047] result( Figure 19 The results showed that in the model group cells, ROS expression levels were significantly increased and mitochondrial membrane potential was significantly decreased. After CK treatment, ROS expression levels in hepatocytes decreased and mitochondrial membrane potential was significantly upregulated. Similarly, CPT1A knockdown or PPARγ inhibition significantly reduced the protective effect of CK on hepatocytes, while PPARγ inhibition and overexpression of CPT1A significantly reduced ROS accumulation and increased mitochondrial membrane potential. This indicates that the protective effect of CK on hepatocytes depends on the activation of PPARγ and CPT1A.

[0048] 2.7 Western Blot (WB) Detection of Cellular Protein Expression Total cellular protein was extracted using a protein extraction kit, and the concentration was determined by the BCA method. After spotting 50 μg / well, the sample was subjected to 10% SDS-PAGE electrophoresis for 1 hour and transferred to a PVDF membrane. The membrane was then blocked with 5% skim milk PBS for 1 hour. Primary antibodies against target SREBP1c, FAS, ACC1, and CPT1, as well as the internal control GAPDH antibody, were added, and the membrane was incubated overnight at 4°C. The membrane was washed three times with PBST (5 min each time), and then incubated with secondary antibody at 37°C for 2 hours, followed by three more washes with PBST. The membrane was developed using ECL substrate, imaged using a protein gel imaging system, and the grayscale values ​​were analyzed using ImageJ.

[0049] WB results ( Figure 16 .17) showed that the protein expression levels of lipid synthesis-related factors ACC1, FAS, ANGPTL4, and SREBP1c were significantly increased in the model group cells. After CK treatment, the protein expression levels of lipid synthesis-related factors were significantly decreased, while after PPARγ inhibition and CPT1A knockdown, the protein expression levels of ACC1, FAS, and SREBP1c in cells were significantly increased again. In addition, overexpression of CPT1A on the basis of PPARγ inhibition also reduced the protein expression levels of ACC1, FAS, ANGPTL4, and SREBP1c in cells. The RT-qPCR results (part 2.8) were consistent with the Western blot results. Inhibition of PPARγ or knockdown of CPT1A reversed the inhibitory effect of CK on lipid synthesis factors. Compared with the PPARγ inhibition group, overexpression of CPT1A after PPARγ inhibition increased the expression of lipid metabolism factors and inhibited the expression of lipid synthesis factors. These results indicate that CK can inhibit the expression of lipid synthesis-related factors in hepatocytes by activating PPARγ and CPT1A.

[0050] 2.8 Real-time fluorescence PCR (RT-qPCR) detection of gene expression levels in cells Total RNA was extracted from liver tissues and cells using an RNA extraction and separation kit, and first-strand mRNA cDNA was synthesized using the same kit. Double-stranded DNA was amplified using a qPCR kit, with GAPDH used as an internal control for ΔΔCT analysis. All primers were synthesized by Qingdao Biotechnology Co., Ltd. (see Supplementary Table 2 for details). The expression levels of SREBP1c, FAS, ACC1, CPT1, and CPT2 genes in tissues and cells were detected by RT-qPCR (results are shown in...). Figure 18 ).

[0051] Table 2 Primer names and sequences Primer Forward(5'-3') Reverse(5'-3') CPT1 CCTACCACGGCTGGATGTTT TACAACATGGGCTTCCGACC CPT2 AAGAAGCAGCGATGGGTAAGG GTGGAGAAACTCTCGGGCAT SREBP1c CAGGAAACTGAGCCATGCAG TCCATTGCTGGTACCGTGAG FAS GCAGCAGCATGATGTAGCAC AGTTGCACACCACAAGGTCA ACC1 GAAAAGCGATTCCCATCCGC CATTCCATGCAGTGGTCCCT GAPDH CAGCCTCAAGATCATCAGCA ATGATGTTCTGGAGAGCCCC In summary, this invention demonstrates that ginsenoside CK can activate the PPARγ / CPT1A signaling pathway, effectively regulating lipid metabolism, inhibiting hepatic lipid accumulation and steatosis, reducing insulin resistance, inhibiting oxidative stress, and improving liver damage, thereby effectively treating metabolic-related fatty liver disease. This provides a new drug option for the treatment of metabolic-related fatty liver disease. The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. Application of ginsenoside CK in the preparation of drugs that treat diseases by activating the PPARγ and / or CPT1A pathways.

2. The application according to claim 1, characterized in that, The disease in question is metabolic-associated fatty liver disease (MAFLD).

3. A drug for treating diseases by activating the PPARγ and / or CPT1A pathway, characterized in that, Including ginsenoside CK.

4. The drug as described in claim 3, characterized in that, The drug is any one of the following: injection, tablet, capsule, pill, granule, powder, ointment, or mixture.

5. Application of ginsenoside CK in the preparation of drugs for the prevention or treatment of metabolic-associated fatty liver disease (MAFLD).

6. The application as described in claim 5, characterized in that, The ginsenoside CK exerts its application in the preparation of drugs for the treatment or prevention of metabolic-associated fatty liver disease (MAFLD) through any of the following pathways: activating the PPARγ and / or CPT1A pathway, enhancing lipid metabolism in Huh7 cells, inhibiting FFA-induced hepatocyte damage and lipid accumulation, and improving insulin resistance in MAFLD rats.

Images