Anti-pathogenic vibrio application of Schimannella sp. DY612-18-2

By using the fermentation broth of Schumannii DY612-18-2 to combat pathogens such as Vibrio harveyi, Vibrio mimicus, and Vibrio parahaemolyticus, the disease problems caused by Vibrio in aquaculture have been solved, achieving the replacement of traditional antibiotics and the effect of disease control.

CN121406480APending Publication Date: 2026-01-27THIRD INSTITUTE OF OCEANOGRAPHY STATE OCEANI C ADMINISTRATION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511495066.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-20
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

In existing technologies, diseases caused by Vibrio bacteria such as Vibrio harlequinae, Vibrio parahaemolyticus, and Vibrio mimicus are frequently occurring in Litopenaeus vannamei farming, resulting in serious economic losses, and there is a lack of effective solutions to combat pathogenic Vibrio bacteria.

Method used

Using the Schumannella sp. DY612-18-2 strain, the fermentation broth showed antibacterial activity against pathogens such as Vibrio harveyi, Vibrio mimicus, and Vibrio parahaemolyticus, which was superior to common antibiotics such as furazolidone, streptomycin, and oxytetracycline.

Benefits of technology

The fermentation broth of *Schumannii* DY612-18-2 has a significant inhibitory effect on pathogenic Vibrio, and can replace traditional antibiotics to a certain extent to control Vibrio diseases in aquaculture and reduce economic losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_6
    Figure SMS_6
  • Figure SMS_7
    Figure SMS_7
Patent Text Reader

Abstract

The invention discloses an application of Schimannella sp. DY612-18-2 for resisting pathogenic vibrio and a preparation method of the Schimannella sp. DY612-18-2. The vibrio is not limited to vibrio harveyi, vibrio mimicus and vibrio parahaemolyticus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more particularly to the use of Schumannella sp. DY612-18-2 against pathogenic Vibrio. Background Technology

[0002] Litopenaeus vannamei is one of the three most farmed shrimp species in the world. Artificial farming of Litopenaeus vannamei in my country began in the 1980s. However, with the expansion of intensive, high-density shrimp farming, shrimp diseases have frequently broken out, causing significant economic losses to farmers. Bacterial diseases in Litopenaeus vannamei are mostly caused by Vibrio bacteria, such as Vibrio harveyi and Vibrio parahemolyticus [Liu PC, 1996; Haldar S, 2007].

[0003] Vibrio harzianum CAIM 79 was isolated from the hatching pond of blue shrimp (Litopenaeus stylirostris). Vibrio parahaemolyticus CAIM 1807 was isolated from the hepatopancreas of diseased Litopenaeus vannamei and is pathogenic to late-stage Litopenaeus vannamei larvae [Wang LP, 2013]. Vibrio parahaemolyticus vp-HL-201910, vp-HL-202005, and vp-HL-202006 were isolated from diseased Litopenaeus vannamei larvae and can cause highly lethal vibrio disease (commonly known as glass seedling disease) in Litopenaeus vannamei [Yang F, 2022].

[0004] Some members of the Vibrio mimicus group can cause gastrointestinal diseases in humans [Chitov T, 2009]. In recent years, Vibrio mimicus has been found to be one of the most threatening pathogenic bacteria to Siluriformes fish, causing serious economic losses to their aquaculture [Feng Yang, 2023]. This group has been found in shellfish and aquatic environments, as well as in human fecal diarrhea and ear infections [Davis BR, 1981]. Vibrio mimicus ATCC 33653 was isolated from the ear of a human female patient. Its serotype is 106 [Davis BR, 1981]. This strain's genome contains genes for key virulence factors such as hemolysin (vmhA) and capsular polysaccharide biosynthetic proteins [Guardiola-Avila I, 2013].

[0005] *Schumannella* belongs to the genus *Microbacteriaceae*, order *Micrococcales*, class *Actinomycetes*. Established in 2009, this genus currently has two validly published species names. The type species is *Schumannella luteola*, the corresponding type strain isolated from a biosample (lichen). It has been reported that this genus is one of more than 20 indicator bacteria for mycotoxin contamination of corn residues [Nguyen TBH, 2025], and that the presence of *Schumannella* in the microbial community of genetically modified plants decreases after ensiling for feed [Ayemele AG, 2024]. Summary of the Invention

[0006] The purpose of this invention is to provide the use of Schumannella sp. DY612-18-2 in combating pathogenic Vibrio.

[0007] To achieve the above objectives, the present invention provides the use of Schumannella sp. DY612-18-2 in combating pathogenic Vibrio.

[0008] Furthermore, the Vibrio species are not limited to Vibrio halys, Vibrio mimicus, and Vibrio parahaemolyticus.

[0009] Furthermore, the Vibrio harzianum refers to Vibrio harzianum CAIM 79; Vibrio mimicry refers to Vibrio mimicry ATCC33653; and Vibrio parahaemolyticus refers to Vibrio parahaemolyticus CAIM 1807, Vibrio parahaemolyticus vp-HL-201910, Vibrio parahaemolyticus vp-HL-202005, or Vibrio parahaemolyticus vp-HL-202006.

[0010] Examples of this invention verify the antibacterial effect of *Schumannella sp.* DY612-18-2. A 100 μL fermentation broth of *Schumannella sp.* DY612-18-2, consisting of soybean meal-dextrin, showed superior antibacterial activity against *Vibrio harveyi* CAIM 79 during a 10-hour growth period compared to 100 μg of furazolidone, 10 μg of streptomycin, 50 μg of oxytetracycline, and 10 μg of erythromycin. During a 10-hour growth period of *Vibrio mimicus* ATCC 33653, it showed superior antibacterial activity against *Vibrio parahaemolyticus* CAIM 1807 compared to 10 μg of streptomycin and 50 μg of oxytetracycline. During the 10-hour growth stage of Vibrio parahaemolyticus vp-HL-202005, its antibacterial activity was superior to that of 10 μg streptomycin and 50 μg oxytetracycline. During the 10-hour growth stage of Vibrio parahaemolyticus vp-HL-202006, its antibacterial activity was superior to that of 10 μg streptomycin, 50 μg oxytetracycline, 15 μg erythromycin, and 5 μg rifampin. Detailed Implementation

[0011] The embodiments of the present invention are described in detail below. These embodiments are intended to explain the present invention and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0012] Example 1: Isolation and identification of Schumannella sp. DY612-18-2 1. Separation technology: Samples were collected from bottom seawater in a hydrothermal vent area in the Northwest Indian Ocean in April 2017. They were collected using sterile sampling bags and stored at 4 °C. After being transported back to the laboratory, the samples were suspended in sterile seawater and spread onto 2216E agar plates using a serial dilution method. The plates were incubated at 28 °C for 2–15 days, during which time colony growth at each dilution gradient was continuously monitored. For dilution gradients that could form single colonies, more plates were spread as needed based on colony diversity. Single colonies were picked and purified by at least three streak tests to obtain pure cultures. The purified strains were then stored in 20% glycerol solution, thoroughly resuspended and mixed, and transferred to cryovials. Store in an 80 °C ultra-low temperature freezer for later use.

[0013] 2. Sequencing and Analysis of 16S rDNA The obtained bacterial strains were cultured in the appropriate liquid medium at 28 °C for 3 days, and the cells were collected by centrifugation at 160,000 r / min for 30 s. Bacterial genomic DNA was extracted using the Cypro silicone membrane bacterial genomic DNA extraction kit according to the manufacturer's instructions. PCR amplification was performed using 1 μL DNA template (~50 ng), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 25 μL Premix, and 22 μL deionized water. The forward primer was bacterial 16S rRNA amplification primer 27F (5′). AGAGTTTGATCCTGGCTCAG 3′, SEQ ID NO:1), reverse primer is 1492R (5′ ACGGCTACCTTGTTACGACT 3′ (SEQ ID NO:2). A 16S rDNA gene fragment was amplified from genomic DNA, and the PCR product was sequenced. After removing low-quality bases at the beginning and end of the sequence and splicing the sequences, the 16S rRNA gene sequence was obtained.

[0014] After removing strains with the same sequence, 14 strains with different sequences were obtained from this sample.

[0015] The 16S rRNA gene sequences of the 14 different strains were compared using BLAST in the Korean EzBiocloud database (https: / / www.ezbiocloud.net / ). Analysis showed that these 14 strains belonged to 11 genera. Only one strain from each of the nine genera, including *Schumannella*, was identified. Subsequent antagonistic experiments showed that *Schumannella* sp. DY612-18-2 exhibited good resistance to aquatic pathogens, and this strain showed 97.01% similarity to the type strain *Schumannella soli* 10F1D-1. The strain was identified as *Schumannella* sp. DY612-18-2, and its sequence is shown in SEQ ID NO:3. Detailed information about the strain is as follows: Strain name: Schumannella sp. DY612-18-2; China Center for Type Culture Collection: China Center for Type Culture Collection

[0016] Depository: China Center for Type Culture Collection, Wuhan University, Wuhan, China.

[0017] Preservation date: August 14, 2025.

[0018] Accession number: CCTCC NO: M 20251826.

[0019] The 16S rRNA gene sequence (1337 bp) of Schumannii DY612-18-2 is as follows:

[0020] 3. Strain morphology Schumannii DY612-18-2 was grown on 2216E medium at 25 °C for 3 days. The colonies were round, yellow and translucent, with a smooth and slightly moist surface, regular edges, no halo, and a raised center, with a diameter of 0.5-1 mm.

[0021] 4. Whole genome analysis of the strain According to genome annotation results, the genome of *Schumannii* DY612-18-2 contains three biosynthetic gene clusters (BGCs), namely two polyketide and one terpene natural product. Among them, there are two potential new gene clusters: (1) Region 7.1, which has only 7% similarity to the biosynthetic cluster gene of the polyketide microansamycin; and (2) Region 6.1, which has only 50% similarity to the biosynthetic cluster gene of the terpene carotenoid (see Table 1 for details).

[0022] Table 1. Similarity of biosynthetic gene clusters in *Schumannii* DY612-18-2

[0023] Example 2: Resistance Test The antagonistic test against pathogens uses the perforation method.

[0024] (1) After activating the test strain Schumannii DY612-18-2, scrape the bacterial block from the plate and activate it in 5 mL of 2216E liquid medium for 4 days as seed culture. Inoculate the seed culture into a 250 mL Erlenmeyer flask containing 50 mL of soybean meal-dextrin liquid medium (taking 1L soybean meal-dextrin liquid medium as an example: containing 30.0 g glucose, 9.0 g yeast extract, 5.0 g peptone, 15.0 g soybean meal, 12.0 g dextrin, 1.0 L distilled water or (RO water), pH 7.0) and culture at 25 °C and 150 r / min for 21 days until it reaches the late logarithmic growth phase. This culture is then used as the test bacterial culture for antagonistic experiments.

[0025] (2) The tested pathogenic strain, Vibrio harveyi CAIM 79, was cultured on 2216E agar plates at 28 °C. Fresh cells activated for about one day were scraped and transferred to the corresponding liquid culture medium, and the OD was adjusted. 600 The value is around 0.4 to 0.5 (concentration is approximately 1×10). 8 ~ 4×10 8 cfu / mL), adjust OD 600The bacterial suspension of the test bacteria was diluted 1000 times, and 100 μL was evenly spread on the corresponding plate culture medium.

[0026] (3) Use a 1 mL sterile pipette tip to make a hole (about 8 mm in diameter) in the plate culture medium, and then add 100 μL of the bacterial solution to be tested into the culture medium well.

[0027] (4) Antibiotic controls were tested using the paper disc method, with a paper disc diameter of 6 mm. The dosages of each antibiotic were chloramphenicol 30 μg / tablet, neomycin 30 μg / tablet, ciprofloxacin 5 μg / tablet, furazolidone 100 μg / tablet, streptomycin 10 μg / tablet, oxytetracycline 50 μg / tablet, erythromycin 15 μg / tablet, and rifampin 5 μg / tablet.

[0028] (5) After incubation at 28 °C for 10 h, the test bacterial solution covered the entire plate. The inhibition zone was observed and its diameter was measured. The results of the antagonistic effect are shown in Table 2.

[0029] Table 2. Determination of inhibition zone diameter of *Schumannii* DY612-18-2 fermentation broth against the tested bacteria (unit: mm)

[0030] Note: C, Chloramphenicol; NV, Neomycin; CIP, Ciprofloxacin; FZ, Furazolidone; S, Streptomycin; OT, Oxytetracycline; E, Erythromycin; RA, Rifampin; T1, Vibrio harveyi CAIM 79; T2, Vibrio mimicus ATCC 33653; T3, Vibrio parahaemolyticus CAIM1807; T4, Vibrio parahaemolyticus vp-HL-202005; T5, Vibrio parahaemolyticus vp-HL-202006.

[0031] – No inhibition zone observed.

[0032] § A small number of test bacteria grew within the inhibition zone (the density of test bacteria within the inhibition zone was approximately 30 to 50% of the density of test bacteria outside the inhibition zone).

[0033] The antimicrobial index was calculated using the following formula to assess the resistance of fermentation broth and antibiotics to pathogens.

[0034] Inhibition index = (inhibition zone diameter - agar well diameter) / agar well diameter × 100% or (inhibition zone diameter - test strip diameter) / test strip diameter × 100%.

[0035] The following two situations indicate that the antibacterial ability of the fermentation broth is superior to that of antibiotics, or that the two have equivalent effects: (1) When a certain amount of test bacteria grow in the inhibition zone, the antibacterial index of the fermentation broth is higher than that of antibiotics; (2) No test bacteria grew in the inhibition zone of the antibiotic, while a certain number of test bacteria grew in the inhibition zone of the fermentation broth. The inhibition index of the fermentation broth was more than twice that of the antibiotic.

[0036] The soybean meal-dextrin fermentation broth of *Schumannii* DY612-18-2 exhibited certain resistance activity against the five pathogenic strains mentioned above, showing superior or comparable inhibitory effects against some pathogens compared to antibiotics. Although it was less effective than antibiotics in some cases, future efforts could potentially increase its potency by improving yield or through genetic modification, making it a potential alternative to antibiotics. This strain has application value in controlling Vibrio diseases in aquaculture. The inhibitory effects of the fermentation broth on each tested strain are as follows: (1) Against Vibrio harveyi CAIM 79, it can produce an inhibition zone with a diameter of 12.0 mm and an inhibition index of 50%. A certain amount of test bacteria grows in the inhibition zone, indicating that it can play a certain role in the early stage of pathogen growth. The antibacterial performance of the positive controls is as follows: chloramphenicol has an antibacterial rate of 373%, with a small amount of test bacteria growing in the inhibition zone; neomycin has an inhibition index of 98%; ciprofloxacin has an inhibition index of 52%; furazolidone, streptomycin, and oxytetracycline all have an inhibition index of 0%; erythromycin has an inhibition index of 38%, with a small amount of test bacteria growing in the inhibition zone; and rifampin has an inhibition index of 168%. In comparison, 100 μL of soybean meal-dextrin fermentation broth of Schumannella sp. DY612-18-2 showed better antibacterial activity against Vibrio harveyi CAIM 79 at the 10-hour growth stage than 100 μg of furazolidone, 10 μg of streptomycin, 50 μg of oxytetracycline, and 10 μg of erythromycin.

[0037] (2) Against Vibrio mimicus ATCC 33653, it can produce an inhibition zone with a diameter of 10.0 mm and an inhibition index of 25%. A certain amount of test bacteria grows in the inhibition zone, indicating that it can play a certain role in the early stage of pathogen growth. The antibacterial performance of the positive controls is as follows: chloramphenicol has an antibacterial rate of 383%, with a small amount of test bacteria growing in the inhibition zone; neomycin has an inhibition index of 183%, with a small amount of test bacteria growing in the inhibition zone; ciprofloxacin has an inhibition index of 317%, with a small amount of test bacteria growing in the inhibition zone; furazolidone has an inhibition index of 333%; streptomycin has an inhibition index of 0%; oxytetracycline has an inhibition index of 83%, with a small amount of test bacteria growing in the inhibition zone; erythromycin has an inhibition index of 150%; and rifampin has an inhibition index of 133%. In comparison, 100 μL of soybean meal-dextrin fermentation broth of Schumannii DY612-18-2 showed better antibacterial activity against Vibrio mimicus ATCC 33653 during the 10-hour growth stage than streptomycin at a dose of 10 μg.

[0038] (3) Against Vibrio parahaemolyticus CAIM 1807, it produced an inhibition zone with a diameter of 15.0 mm and an inhibition index of 88%. A certain amount of test bacteria grew within the inhibition zone, indicating that it could play a certain role in the early stage of pathogen growth. The antibacterial performance of the positive controls was as follows: chloramphenicol had an antibacterial rate of 358%, with a small amount of test bacteria growing within the inhibition zone; neomycin had an inhibition index of 172%; ciprofloxacin had an inhibition index of 48%; furazolidone had an inhibition index of 142%; streptomycin had an inhibition index of 17%; oxytetracycline had an inhibition index of 0%; erythromycin had an inhibition index of 93%, with a small amount of test bacteria growing within the inhibition zone; and rifampin had an inhibition index of 200%. In comparison, 100 μL of soybean meal-dextrin fermentation broth of Schumannii DY612-18-2 showed better antibacterial activity against Vibrio parahaemolyticus CAIM 1807 during the 10-hour growth stage than streptomycin at a dose of 10 μg and oxytetracycline at a dose of 50 μg.

[0039] (4) Vibrio parahaemolyticus vp-HL-202005 produced an inhibition zone with a diameter of 14.2 mm and an inhibition index of 78%. A certain amount of test bacteria grew within the inhibition zone, indicating that it could play a certain role in the early stage of pathogen growth. The antibacterial performance of the positive controls was as follows: chloramphenicol had an antibacterial rate of 393%, with a small amount of test bacteria growing within the inhibition zone; neomycin had an inhibition index of 173%; ciprofloxacin had an inhibition index of 87%; furazolidone had an inhibition index of 115%; streptomycin had an inhibition index of 25%, with a small amount of test bacteria growing within the inhibition zone; oxytetracycline had an inhibition index of 0%; erythromycin had an inhibition index of 103%, with a small amount of test bacteria growing within the inhibition zone; and rifampin had an inhibition index of 212%, with a small amount of test bacteria growing within the inhibition zone. In comparison, 100 μL of soybean meal-dextrin fermentation broth of Schumannii DY612-18-2 showed better antibacterial activity against Vibrio parahaemolyticus vp-HL-202005 during the 10-hour growth stage than streptomycin at a dose of 10 μg and oxytetracycline at a dose of 50 μg.

[0040] (5) Vibrio parahaemolyticus vp-HL-202006 produced an inhibition zone with a diameter of 17.0 mm and an inhibition index of 113%. A certain amount of test bacteria grew within the inhibition zone, indicating that it could play a certain role in the early stage of pathogen growth. The antibacterial performance of the positive controls was as follows: chloramphenicol had an antibacterial rate of 240%; neomycin had an inhibition index of 210%; ciprofloxacin had an inhibition index of 118%; furazolidone had an inhibition index of 183%; streptomycin and oxytetracycline both had inhibition indices of 0%; erythromycin had an inhibition index of 77%, with a small amount of test bacteria growing within the inhibition zone; and rifampin had an inhibition index of 45%, with a small amount of test bacteria growing within the inhibition zone. In comparison, 100 μL of soybean meal-dextrin fermentation broth of Schumannii DY612-18-2 showed better antibacterial activity against Vibrio parahaemolyticus vp-HL-202006 during the 10-hour growth stage than streptomycin (10 μg), oxytetracycline (50 μg), erythromycin (15 μg), and rifampin (5 μg).

[0041] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention without departing from the principles and spirit of the present invention.

Claims

1. Schumannella sp. DY612-18-2 has the use of anti-pathogenic Vibrio.

2. The use as described in claim 1, characterized in that, The Vibrio species mentioned are not limited to Vibrio halys, Vibrio mimicus, and Vibrio parahaemolyticus.

3. The use as described in claim 1, characterized in that, The Vibrio harzianum refers to Vibrio harzianum CAIM 79; Vibrio mimicry refers to Vibrio mimicry ATCC 33653; Vibrio parahaemolyticus refers to Vibrio parahaemolyticus CAIM 1807, Vibrio parahaemolyticus vp-HL-201910, Vibrio parahaemolyticus vp-HL-202005, or Vibrio parahaemolyticus vp-HL-202006.