DNA hydrogel biosensing method and application thereof in mycotoxin detection

By integrating Au@Pt nanozymes and DNAzymes into a DNA hydrogel and combining them with the CHA reaction, a programmable composite DNA hydrogel was constructed. This solved the problems of degradation efficiency and signal load in existing DNA hydrogel systems, enabling highly sensitive detection of mycotoxins and making it suitable for rapid detection of OTA in food.

CN121406633APending Publication Date: 2026-01-27SHAANXI UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511523737.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-23
Publication Date
2026-01-27

Smart Images

  • Figure CN121406633A_ABST
    Figure CN121406633A_ABST
Patent Text Reader

Abstract

The invention provides a DNA hydrogel biosensing method and application thereof in mycotoxin detection, programmable composite DNA hydrogel comprises an acrylamide monomer solution and a three-dimensional network structure polymerization product formed by acrylic ester modified nucleic acid molecules and a nucleic acid chain C, the Au (at) Pt nano-enzyme modified by a Raman reporter is coated in the polymerization product with the three-dimensional network structure; and uniformly mixing the apt-cDNA compound, HP, HPn, a magnesium chloride solution and the programmable composite DNA hydrogel which are equal in volume, adding a mycotoxin solution to be detected, incubating, and determining a Raman signal of a reaction product at 1071 cm <-1 > under 785 nm and a colorimetric signal at 652 nm to obtain the content of mycotoxin. The method has the advantages of simplicity and convenience in operation, low cost, high detection speed, high sensitivity and the like, and is suitable for rapid on-site detection of mycotoxin in food.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of fungal toxin detection technology, specifically to a DNAzyme-mediated DNA hydrogel biosensing method and its application in fungal toxin detection. Background Technology

[0002] Ochratoxin A (OTA) is a fungal toxin classified as a Group 2B carcinogen by the International Agency for Research on Cancer (IARC), posing a significant threat to human health and causing substantial economic losses to the agricultural sector. Traditional detection methods, including chromatographic techniques and immunoassays, face considerable limitations in practical applications. Chromatographic methods require sophisticated instrumentation and specialized operational experience, while immunoassays such as ELISA are limited by antibody availability and cost-effectiveness. These challenges have prompted the exploration of alternative detection strategies to improve practicality and performance.

[0003] DNA hydrogel-based biosensing platforms have emerged as a promising alternative, leveraging the programmable nature of nucleic acids to create highly responsive mycotoxin detection systems. These three-dimensional networks effectively encapsulate functional nucleic acids, including aptamers and DNAzymes, while enhancing the interaction between analytes and their receptors. In recent years, various DNA hydrogel-based biosensing platforms have been developed for the detection of biomolecules, chemicals, and metal ions. However, existing DNA hydrogel systems often suffer from insufficient degradation efficiency, limited signal molecule loading capacity, and high signal background when responding to trace targets, leading to reduced sensitivity. DNAzymes, which catalyze DNA molecules, especially those with RNA-cutting activity, have attracted considerable attention in biosensing and therapeutic applications due to their programmability, stability, and efficient catalytic performance. Currently, introducing DNAzymes into DNA hydrogels has become an effective means of signal amplification in DNA hydrogel biosensing systems. However, biosensing systems relying solely on a single signal output mode are susceptible to inaccuracies caused by environmental interference, instrument variability, or non-standardized operating procedures. Meanwhile, nanozymes, or nanomaterials with enzyme-like activity, are widely used in sensing due to their excellent catalytic performance, as demonstrated in chemiluminescence and colorimetric systems. The unique plasmonic properties of noble metal nanoparticles (such as Au and Ag) have been widely applied in fluorescence enhancement, surface-enhanced Raman spectroscopy (SERS), and related fields. Recent advances have made it possible to combine plasmonic nanoparticles with catalytic metals (such as Pt and Pd), promoting the integration of SERS detection and catalytic functions into a single nanostructure. Based on the above research, when DNAzymes and nanozymes are simultaneously integrated into a DNA hydrogel biosensing platform, this synergistic combination allows for simultaneous target recognition, signal transduction, and amplification detection, potentially enabling accurate quantification of trace amounts of OTA in complex sample matrices. However, there are currently no research examples of simultaneously integrating DNAzymes and nanozymes into DNA hydrogel biosensing platforms, and research in this field is still in its early stages, mainly limited by the challenges of synergistic effects in the spatial arrangement and catalytic compatibility of nanozymes and DNAzymes. Furthermore, how to achieve efficient coupling of the two enzyme functions while maintaining the stability of the three-dimensional network structure of the hydrogel requires further exploration. Nevertheless, by rationally designing the interaction between nucleic acid sequences and nanomaterial interfaces, it is hoped that a multifunctional sensing system with both high sensitivity and specificity can be constructed, providing a new strategy for the detection of fungal toxins. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a DNA hydrogel biosensing method and its application in the detection of fungal toxins. It has the advantages of simple operation, low cost, fast detection speed, and high sensitivity, and is suitable for rapid on-site detection of OTA in food.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a programmable composite DNA hydrogel comprising an acrylamide monomer solution and a three-dimensional network structure polymer product formed by acrylate-modified nucleic acid molecules, wherein a Raman reporter-modified Au@Pt nanozyme is encapsulated in the three-dimensional network structure polymer product.

[0006] Furthermore, the acrylamide monomer solution and the acrylate-modified nucleic acid molecules are mixed in equal volumes and then crosslinked under the action of an initiator and an accelerator to form a three-dimensional network structure polymer product. The concentration of the acrylamide monomer solution is 25%-40%, and the acrylate-modified nucleic acid molecules include nucleic acid chains A and B. The sequence of nucleic acid chain A is Acrydite-TTTGTGGGCCTAGCGA; the sequence of nucleic acid chain B is Acrydite-TTTACACGTGCCCAAC. The three-dimensional network structure polymerization products include three-dimensional network structure polymerization products formed by acrylamide monomer and acrylate-modified nucleic acid chain A, and three-dimensional network structure polymerization products formed by acrylamide monomer and acrylate-modified nucleic acid chain B.

[0007] Furthermore, the three-dimensional network structure polymerization product was combined with 25 μM-35 μM nucleic acid chain C and 1 mg·mL -1 The Au@Pt nanozyme modified with Raman reporter was mixed and hydrothermally reacted and cooled to obtain a programmable composite DNA hydrogel. An equal volume of acrylamide monomer solution and acrylate-modified nucleic acid molecules were mixed. Nucleic acid chain C and the Au@Pt nanozyme modified with Raman reporter were added in equal volume to the mixture of acrylamide monomer solution and acrylate-modified nucleic acid molecules. The sequence of nucleic acid chain C is: ATGTGCACGGGTTG / rA / TCGCTAGGCCCACA.

[0008] Furthermore, the amount of Raman reporter-modified Au@Pt nanozyme used was 10 μL.

[0009] Furthermore, in the Raman reporter-modified Au@Pt nanozyme, the Raman reporter is 4-mercaptobenzonitrile.

[0010] This invention also provides an application of a programmable composite DNA hydrogel in the rapid detection of mycotoxins, characterized in that equal volumes of apt-cDNA complex, HP, HPn, and magnesium chloride solution are mixed evenly and added to the programmable composite DNA hydrogel, followed by the addition of mycotoxin test solution. After incubation, the reaction product is measured at 785 nm and 1071 cm⁻¹. -1 The content of mycotoxins was obtained by analyzing the Raman signal at 652 nm and the colorimetric signal at 652 nm.

[0011] Furthermore, in the apt-cDNA complex, the apt:cDNA hybridization ratio is 1-3:1; HPn includes HP1, HP2, and HP3 in a ratio of 1:1:1, and the stoichiometric ratio of HP:HPn is 0.5-2.5:1. Furthermore, the incubation conditions were as follows: reaction at 32℃-42℃ for 80-120 minutes.

[0012] Furthermore, the fungal toxin is ochratoxin A.

[0013] Furthermore, in the apt-cDNA complex, apt is OTA-apt, and the nucleic acid sequence of OTA-apt is GATGGGTGGGTGGCGTAAAGGGAGCATCGGACAG; the nucleic acid sequence of cDNA is TGTCCGATGTTTTTTTACACCCGA; the nucleic acid sequence of HP is CATCGGGTGTAAAGCGT / rA / GCTTATGCTTTTTGACTCCGAGCCGGACGAACGCAACATCGGACA; HPn includes HP1, HP2, and HP3, where the nucleic acid sequence of H1 is TGATTGATTGTACCCACACGCTTTACACCCGATGTACCTGCTCCATCCCATCGGGTGTAA; the nucleic acid sequence of H2 is TTACACCCGATGGGATGGAGCAGGTACATCGGGTGTAAAGCGTTGTACCTGCTCCATCCCATCG; and the nucleic acid sequence of H3 is GTACCTGCTCCGATGGGATGGAGCAGGTACATAGCGACTTCTCTAC.

[0014] Compared with the prior art, the present invention has at least the following beneficial effects: This invention provides a programmable composite DNA hydrogel comprising a three-dimensional network structure polymer product formed by an acrylamide monomer solution and acrylate-modified nucleic acid molecules. Structurally, the acrylamide monomer forms stable polymer chains during polymerization, which intertwine to construct a porous and flexible three-dimensional framework. The acrylate-modified nucleic acid molecules are cleverly integrated into this framework. The acrylate groups and acrylamide monomers are chemically bonded, allowing the nucleic acid molecules to be stably fixed within the three-dimensional network structure, ensuring relative spatial conformation stability. Nucleic acid chain C is precisely linked to nucleic acid A and nucleic acid B portions through base complementarity pairing. This unique three-dimensional network structure provides an extremely stable carrier for encapsulating Raman reporter-modified Au@Pt nanozymes. For the Raman reporter-modified Au@Pt nanozymes, the porosity of the three-dimensional network structure allows for uniform dispersion and stable encapsulation. In this stable environment, the nanozymes retain their surface properties and catalytic activity. Au@Pt nanozymes themselves possess excellent catalytic performance and can participate in key reactions such as signal amplification in detection systems. A stable carrier environment prevents nanozymes from aggregating or becoming inactive, ensuring their continuous and efficient catalytic activity during detection and guaranteeing accurate Raman signal detection. Nucleic acid chain C plays a crucial role in hydrogel construction and signal transduction within the detection system. C participates in building a stable hydrogel, and its cleavage by DNAzyme2 leads to hydrogel collapse and nanozyme release, ensuring accurate signal transmission.

[0015] From the perspective of the detection system, this stable carrier structure helps maintain the activity and function of nanozymes and nucleic acid chains, thereby ensuring the stability and effectiveness of the entire detection system. In complex detection environments, a stable detection system can reduce errors and interference, and improve the repeatability and reliability of detection results. Whether in precise laboratory analysis or rapid on-site detection, this stable programmable composite DNA hydrogel structure provides a solid foundation for OTA detection, enabling the detection method to operate accurately and stably, thus providing reliable technical support for the detection of mycotoxins.

[0016] This invention provides the application of the aforementioned programmable composite DNA hydrogel in the rapid detection of fungal toxins. On one hand, it leverages the unique recognition ability of aptamers for OTA (anti-adrenergic OTA); on the other hand, it innovatively combines DNAzymes with catalytic hairpin self-assembly (CHA) reactions to design a dual signal amplification mechanism. Ultimately, through colorimetric and Raman signal conversion and output, it achieves highly specific and sensitive on-site rapid detection of fungal toxins (OTA). This sensing method uses nucleic acid aptamers to replace antibodies in traditional ELSA detection methods, solving the problems of antibody stability and cost. Throughout the process, the cDNA chain and HP / HPn trigger chains cyclically participate in the reaction, enabling the reuse of reaction materials and laying the foundation for signal amplification. Simultaneously, this method, combined with the high target specificity of nucleic acid aptamers and the dual signal amplification system, can effectively distinguish interference from other substances and reduce false positives. The entire detection process requires no complex pretreatment or large instruments; signal conversion is achieved through color change and Raman signal detection, completing the analysis of OTA. Visual colorimetric detection is intuitive and convenient, suitable for rapid on-site screening; Raman signal detection is accurate and sensitive, suitable for quantitative analysis. The two detection methods complement each other, improving the reliability and practicality of the method. Attached Figure Description

[0017] Figure 1 A schematic diagram illustrating the dual-mode detection of ochratoxin A using a programmable DNA hydrogel-mediated cascade amplification of DNAzyme-mediated nanozyme release.

[0018] Figure 2 For material characterization. Among them: TEM images of Au NPs (A), Au@Pt (B) and Au@Pt@4-MBN (C); (DF) TEM-Mapping image of Au@Pd@4-MBN.

[0019] Figure 3 To verify the feasibility of signal activation and catalytic hairpin self-assembly (CHA) signal amplification using polyacrylamide gel electrophoresis. The diagram includes: (A) Schematic diagram of signal transduction activation, (B) Schematic diagram of the CHA cascade reaction, (C) Electrophoresis diagram of signal transduction activation, and (D) Electrophoresis diagram of the CHA cascade reaction.

[0020] Figure 4 This study aims to verify the feasibility of a programmable composite DNA hydrogel construction method and dual-mode detection. The results include: SEM images of the lyophilized DNA hydrogel before (A) and after (B) nanozyme embedding; (C) feasibility of colorimetric detection; and (D) feasibility of Raman detection.

[0021] Figure 5Parameter optimization for the construction of programmable composite DNA hydrogel systems. This includes: absorbance values ​​at different acrylamide monomer concentrations (A), linker concentrations (B), and nanozyme dosages (C); and Raman intensities at different acrylamide monomer concentrations (D), linker concentrations (E), and nanozyme dosages (F) (error bars indicate three independent parallels).

[0022] Figure 6 Optimization of reaction system parameters for fungal toxin detection using programmable composite DNA hydrogels. This includes: absorbance values ​​at different apt to cDNA stoichiometric ratios (A) and HP to HPn stoichiometric ratios (B); and Raman intensities at different apt to cDNA stoichiometric ratios (C) and HP to HPn stoichiometric ratios (D) (error bars indicate three independent parallels).

[0023] Figure 7 Optimization of incubation conditions for fungal toxin detection using programmable composite DNA hydrogels. This includes: absorbance values ​​at different times (A) and temperatures (B); and Raman signal intensities at different times (C) and temperatures (D) (error bars represent three independent parallels).

[0024] Figure 8 Sensitivity of programmable composite DNA hydrogels for fungal toxin detection. The following parameters are considered: (A) Relationship between absorbance and OTA concentration; (B) Absorbance exponential relationship of the sensing system for different OTA concentrations; (C) Logarithmic relationship between absorbance and OTA concentration; (D) Relationship between SERS intensity and OTA concentration; (E) SERS exponential relationship of the sensing system for different OTA concentrations; (F) Logarithmic relationship between SERS intensity and OTA concentration. Error bars represent SD (n=3).

[0025] Figure 9 Evaluation of selectivity, reproducibility, and stability of programmable composite DNA hydrogels for fungal toxin detection. (A) Selectivity, (B) Reproducibility, (C) Stability. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0027] This invention provides a programmable composite DNA hydrogel, the specific steps of which are as follows: Step 1: Preparation of Au@Pt@4-MBN nanozymes: Modifying the surface of Au@Pt nanozymes with the Raman reporter 4-mercaptobenzonitrile (4-MBN) endowed Au@Pt nanozymes with excellent Raman signals, resulting in Au@Pt@4-MBN nanozymes. A 1 mM 4-MBN solution was added to a freshly prepared Au@Pt NPs solution at a volume ratio of 1:10. After stirring for 30 min, unreacted substances were removed by washing to obtain Au@Pt@4-MBN nanozymes.

[0028] Step 2: Pre-assembly of monomers and nucleic acids yields the polymer product. A 1:1 volume ratio solution of 25%-40% acrylamide monomer (5 μL) was mixed with acrylate-modified nucleic acid molecules (5 μL), and the mixture was subjected to pre-assembly between the monomer and nucleic acid under vacuum at 37°C to obtain a mixture. Ammonium persulfate (APS), a free radical polymerization initiator, and tetramethylethylenediamine (TEMED), an accelerator, were added to the mixture, and the acrylamide monomer and nucleic acid molecules were cross-linked under vacuum at 37°C to form a three-dimensional network structure polymerization product.

[0029] The nucleic acid molecule includes nucleic acid chain A and nucleic acid chain B, where the sequence of nucleic acid chain A is Acrydite-TTTGTGGGCCTAGCGA and the sequence of nucleic acid chain B is Acrydite-TTTACACGTGCCCAAC.

[0030] The three-dimensional network structure polymerization products include a three-dimensional network structure polymerization product (P-SA) formed by acrylamide monomer and acrylate-modified nucleic acid chain A, and a three-dimensional network structure polymerization product (P-SB) formed by acrylamide monomer and acrylate-modified nucleic acid chain B. Step 3: Constructing a composite DNA hydrogel: P-SA, P-SB, and nucleic acid chain C (10 μL, 25 μM-35 μM) and Au@Pt@4-MBN (10 μL, 1 mg·mL) were added. -1 The nanozymes were mixed, treated in a 65°C water bath and cooled to room temperature to achieve DNA hybridization-mediated nanozyme encapsulation, and finally a programmable composite DNA hydrogel was constructed.

[0031] The sequence of nucleic acid chain C is ATGTGCACGGGTTG / rA / TCGCTAGGCCCACA; like Figure 1 As shown, the specific steps for detecting fungal toxins using the above-mentioned programmable composite DNA hydrogel are as follows: The apt-cDNA complex was mixed with equal volumes of HP, HP1, HP2, HP3, and magnesium chloride solution (100 mM) and then added to a pre-prepared programmable composite DNA hydrogel. A fungal toxin test solution (10 μL) was added, and the mixture was reacted at 32℃-42℃ for 80-120 min. The Raman signal of the reaction product was measured. Simultaneously, TMB-H2O2 was added to the reacted solution, and the colorimetric signal was measured after the reaction to achieve dual-mode detection. The reaction mechanism for ochratoxin A detection is as follows: Using OTA aptamers as recognition units, and taking advantage of the strong affinity between OTA and aptamers, OTA competitively binds to the target aptamer from the complementary bistranded complex, thereby releasing the complementary strand.

[0032] The released complementary strand (cDNA) binds to the hairpin HP, activating the DNAzyme1 (double-stranded complex) cleavage activity. DNAzyme1 cleaves the hairpin HP, producing and releasing a large amount of free cDNA and trigger strand. The cDNA continues to participate in the activation of DNAzyme1 cleavage activity, thereby accumulating the release of more free trigger strands, completing the first cycle.

[0033] The generated trigger strand can serve as the initiating strand for the catalytic hairpin self-assembly (CHA) reaction, initiating the CHA reaction. During the CHA reaction, the trigger strand sequentially opens HP1, HP2, and HP3. HP1 exposes the active site of DNAzyme2 (a triple-stranded complex) and the sequence complementary to HP2. HP1 binds to HP2, opening HP2 and exposing the sequence complementary to HP3. HP2 then binds to HP3, forming the HP1-HP2-HP3 complex. Simultaneously, the trigger strand is released and continues to participate in triggering the CHA reaction, achieving the second cycle. Half of the DNAzyme2 sequence is located at the 3' and 5' ends of HP1 and HP3, respectively. After forming the HP1-HP2-HP3 complex, its cleavage activity is activated, specifically cleaving the programmable composite DNA hydrogel. The excellent peroxidase-like activity of Au@Pt nanozyme catalyzes the TMB-H2O2 system to generate blue oxidation products. The difference in SERS signal intensity before and after hydrogel disintegration enables dual-mode detection of OTA colorimetry and Raman.

[0034] Example 1 This invention provides a programmable composite DNA hydrogel comprising Au@Pt@4-MBN nanozyme, acrylamide monomer, acrylate-modified nucleic acid molecules, and nucleic acid chain C. The programmable composite DNA hydrogel encapsulating the Au@Pt@4-MBN nanozyme is obtained through hydrothermal crosslinking, as detailed below: 1. Materials and Reagents Tetrachloroauric acid (HAuCl4·4H2O, ≥98%) was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd. Chloroplatinic acid hexahydrate (H2Pt6·6H2O, 37.5%) and 4-mercaptobenzonitrile (4-MBN) were purchased from Shanghai Maclean Biochemical Technology Co., Ltd. Sodium citrate (C6H5Na3O7, analytical grade) and 3,3′,5,5′-tetramethylbenzidine (TMB, analytical grade) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Acrylamide was purchased from Tianjin Kemeo Chemical Reagent Co., Ltd. Ascorbic acid, ammonium persulfate (APS), glacial acetic acid, anhydrous sodium acetate (C2H3NaO2, analytical grade), hydrogen peroxide (H2O2), and N,N,N',N'-tetramethylethylenediamine (TEMED) were purchased from Tianjin Tianli Chemical Reagent Co., Ltd. 50×TBE, 4S GreenPlus nucleic acid dye, 25-500bp DNA Marker, and 6×Loading Buffer were purchased from Shanghai Sangon Biotech Co., Ltd. Ochratoxin (OTA), aflatoxin (AFB1), fumonisin B1 (FB1), zearalenone (ZEN), T-2 toxin (T-2), and patulin (PAT) were all purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0035] The oligonucleotide sequences were synthesized and purified by Shanghai Sangon Biotech Co., Ltd., and the specific sequences are shown in Table 1.

[0036] Table 1 Nucleic Acid Sequences

[0037] HP: A hairpin structure containing the DNAzyme catalytic core sequence. Its stem forms a double strand through complementary base pairing, and each side of the stem contains an / rA / cleavage site. In its initial state, HP is a hairpin structure. After binding with cDNA, it forms the HP-cDNA complex-DNAzyme1, whose cleavage activity is activated. By cleaving the / rA / cleavage site on the single side of the stem, it releases the trigger strand that initiates the CHA reaction.

[0038] HP1: Contains the half-sequence of DNAzyme2 (3' end) and the initiation region of the CHA reaction. Initially, it is a hairpin structure, concealing the DNAzyme2 active site and the CHA reaction trigger sequence. During the CHA reaction, after the triggered strand opens, the DNAzyme2 active site and the sequence complementary to HP2 are exposed.

[0039] HP2: Serves as a bridging probe, with its two ends complementary to HP1 and HP3, respectively. Initially, it has a hairpin structure, hiding its complementary sequences. In the CHA reaction, it is opened by HP1 and further opens HP3, forming a complex.

[0040] HP3: Contains the half-sequence of DNAzyme2 (5' end) and the termination region of the CHA reaction. Initially, it is a hairpin structure, concealing the DNAzyme2 active site and the sequence complementary to HP2. During the CHA reaction, after being opened by HP2, it forms a complex with HP1, activating DNAzyme2 cleavage activity.

[0041] 2. Preparation of Au@Pt nanozymes Step 1: Synthesis of gold nanoparticles: 300 μL of 1% (w / v) tetrachloroauric acid aqueous solution was added to 30 mL of deionized water and reacted for 5 min. Then, 180 μL of 1% (w / v) sodium citrate solution was added and reacted for 6 min to obtain gold nanoparticles with a particle size of 50 nm. After cooling, the nanoparticles were placed in a refrigerator at 4 °C for later use.

[0042] Step 2: Synthesis of Au@Pt nanozymes: 2 mL of synthesized gold nanoparticles were diluted in 8 mL of ultrapure water containing polyvinylpyrrolidone (PVP, 1%, w / v, molecular weight = 10 kDa) to obtain a diluted solution. The diluted solution was mixed at 37 °C for 5 minutes to stabilize the system.

[0043] Then ascorbic acid (100 mg·mL) was added. -1 Au@Pt nanoparticles (Au@Pt nanozyme) were added to the diluent along with chloroplatinic acid hydrate (100 mM, 800 μL) and immediately incubated at 65 °C for 1 hour until the solution color gradually changed from red to brown and finally to black, indicating that platinum (Pt) had been successfully deposited. Excess reagent was removed by centrifugation at 12000 rpm for 15 minutes, and the solution was washed three times with ultrapure water to obtain Au@Pt nanoparticles, i.e., Au@Pt nanozymes. Finally, the nanoparticles were resuspended in 10 mL of ultrapure water and stored at 4 °C.

[0044] 3. Preparation of Au@Pt nanozymes modified with Raman reporter Take 1 mM Raman reporter 4-mercaptobenzonitrile (4-MBN) solution and add it to Au@Pt nanozyme solution. Stir the above solution for 30 min, then centrifuge twice with 1×PBS buffer at 8000 rpm, 10 min and 4℃ to remove unreacted chemicals. Resuspend in ultrapure water for later use to obtain Raman reporter modified Au@Pt nanozyme.

[0045] The morphology of Au NPs, Au@Pt, and Au@Pt@4-MBN nanozymes was observed using transmission electron microscopy (TEM). (See attached image.) Figure 2 As shown in Figure A, the Au NPs have a relatively smooth surface and a size of approximately 50 nm. Adding a Pt precursor produces a nearly spherical Au@Pt structure (approximately 75 nm) with a dendritic shell (attached). Figure 2B). However, after loading 4-MBN, there was no significant change in shape and size (see appendix). Figure 2 C). Elemental maps of the nanostructure were obtained using TEM-mapping. The results showed that Au was concentrated in the core, Pt was distributed throughout the nanostructure, and the S element, unique to 4-MBN, was distributed on the Au@Pt surface (see attached image). Figure 2 (DF), which further verified the observation results of TEM, indicating that the Au@Pt@4-MBN nanozyme was successfully synthesized.

[0046] 4. Construction of hydrogels 5 μL of 10% (w / v) acrylamide monomer was added to 5 μL of 100 μM acrylate-modified nucleic acid A and nucleic acid B and mixed evenly. After vacuum drying at 37°C overnight, 3% APS (initiator ammonium persulfate) and TEMED (accelerator tetramethylethylenediamine) were added, mixed evenly, and vacuum dried at 37°C for 6 h to obtain the polymerization product.

[0047] The polymer product was mixed evenly with nucleic acid chain C and Au@Pt@4-MBN nanozyme, and then incubated in a water bath at 65°C for 5 min. After cooling to room temperature, a programmable composite DNA hydrogel encapsulating Au@Pt@4-MBN nanozyme was obtained.

[0048] The formation of the DNA hydrogel was characterized by scanning electron microscopy (SEM), as shown in the attached figure. Figure 4 A shows that the hydrogel exhibits a typical highly porous structure. After encapsulating the nanozyme, the pore size of the gel material is significantly reduced (see attached image). Figure 4 (B) indicates that a programmable composite DNA hydrogel encapsulating Au@Pt@4-MBN nanozymes was successfully constructed.

[0049] 5. Feasibility analysis and verification of using the programmable composite DNA hydrogel prepared in step 4 for ochratoxin A detection. Feasibility analysis of OTA detection using a sensor system: Step 1: Mix the OTA-specific aptamer and complementary DNA in Tris-HCl buffer (20 mM Tris-HCl, pH=7.4) at equal molecular concentrations. Heat the resulting solution to 95°C for 5 min and then cool it to room temperature to obtain the apt-cDNA complex (aptamer-complementary DNA complex).

[0050] Step 2: Verify feasibility using polyacrylamide gel electrophoresis. The feasibility of signal activation and CHA signal amplification was verified by polyacrylamide gel electrophoresis. A 15% polyacrylamide gel was prepared using 5 mL of 30% acrylamide monomer, 2 mL of 5×TBE buffer, 3 mL of deionized water, 50 μL LAPS (10%), and 5 μL LTEMED. Each reaction component was incubated at 37°C for 90 min before loading. The electrophoresis conditions were 120 V, 400 A, and 65 min.

[0051] Appendix Figure 3 A and B show schematic diagrams of signal transduction activation and the CHA cascade reaction, respectively. (See attached diagram) Figure 3 As shown in lane C, compared to lanes 1 and 2, the band in lane 3 demonstrates that the aptamer reacted with cDNA to produce an apt-cDNA duplex. After incubation of OTA with apt-cDNA, the intensity of the apt-cDNA band significantly decreased (lane 4), indicating the specific binding of OTA and the aptamer. HP is clearly shown in lane 5. After incubation of OTA with apt-cDNA duplex and HP, a high molecular weight band appeared in lane 6, indicating that cDNA hybridized with HP. In the absence of the target, no cDNA strand was produced, resulting in no hybridization of HP to form a complex, thus resulting in two clearly visible low molecular weight bands in lane 7, corresponding to the apt-cDNA duplex and HP, respectively.

[0052] Appendix Figure 3 As shown in diagram D, each of the three groups, HP1, HP2, and HP3, exhibits a distinct individual band (lanes 1, 2, and 3). Lane 4, a mixture of T and HP1, shows the production of a higher molecular weight product, indicating that the T chain can open HP1 and form a complex. With the addition of HP2 (lane 5) and HP3 (lane 6), higher molecular weight bands gradually appear, revealing the typical CHA band, and DNAzyme2 is produced. Upon the addition of nucleic acid chain C, DNAzyme2 cleaves the C chain, and the corresponding DNAzyme2 band becomes lighter due to consumption. In the absence of trigger chain T, HP1, HP2, and HP3 cannot undergo the CHA reaction, do not produce DNAzyme2, and nucleic acid chain C is not cleaved (lane 8).

[0053] Step 3: Verify feasibility by reacting with OTA standard solution of known concentration: 3 μL of apt-cDNA complex, 3 μL of 1 μM HP, HP1, HP2, HP3, and 3 μL of MgCl2 (100 mM) were mixed thoroughly and added to a programmable composite DNA hydrogel encapsulated with Au@Pt@4-MBN nanozyme. 10 μL of OTA standard solution of known concentration was added, and the mixture was reacted at 37 °C for 90 min. The Raman signal of the reaction product was measured. Simultaneously, 10 μL of 0.25 mM TMB was added to the reacted solution, and the colorimetric signal was measured after reacting for 30 min.

[0054] As attached Figure 4 As shown in Figure C, when OTA was co-incubated with the constructed biosensor system, the solution turned blue in the presence of TMB and H2O2 (see attached figure). Figure 4 (C illustration), and a characteristic peak signal appears at 652 nm. Furthermore, when the target OTA is present, an enhanced SERS signal can be obtained from the reaction products (see attached illustration). Figure 4 D).

[0055] The above results indicate that the target OTA can induce a cascade reaction to form DNAzyme2 in Mg 2+ The presence of a hydrogel that is cleaved releases a pre-encapsulated Au@Pt@4-MBN nanozyme, thus demonstrating the feasibility of the constructed sensing method.

[0056] 6. Optimization of programmable composite DNA hydrogel system To obtain the optimal performance of the proposed sensing method, the absorbance of the system after adding the target OTA at 652 nm and the 1071 cm⁻¹ at 785 nm were measured. -1 The SERS intensity at the location was optimized, and a series of important parameters were improved.

[0057] 6.1 To prepare a hydrogel with stable performance, this invention optimizes the concentration of acrylamide monomer and the concentration of linker chain (C chain).

[0058] As attached Figure 5 As shown in AB and 5D-E, high absorbance and Raman signal were obtained even without OTA when using 20% ​​(v / w) monomer and 25 μM linker, indicating that the hydrogel has weak stability. When the monomer concentration is higher than 30% and the linker concentration is higher than 30 μM, the absorbance and SERS intensity decrease with the addition of OTA, indicating that the hydrogel is difficult to disintegrate under these conditions. The highest difference in absorbance and Raman signal was observed when using 30% monomer and 30 μM linker, indicating that the hydrogel system is the most sensitive and stable. Therefore, 30% and 30 μM were selected as the optimal concentrations for synthesizing stable DNA hydrogels.

[0059] 6.2 The amount of Au@Pd@4-MBN nanozyme encapsulated has a significant impact on the stability of the hydrogel encapsulation system. This invention establishes a volume gradient of 6 μL-14 μL. Figure 5C and F show the changes in absorbance and SERS intensity under different amounts of Au@Pt@4-MBN, respectively. The results show that the absorbance value increases with increasing Au@Pt@4-MBN volume. When the amount of Au@Pt@4-MBN exceeds 10 μL, the difference in absorbance and SERS intensity between the target-containing and target-free cases decreases, which is due to the limited encapsulation capacity of the hydrogel. Therefore, the optimal embedding volume of Au@Pt@4-MBN is 10 μL.

[0060] 6.3 To maximize detection sensitivity, the present invention optimizes the hybridization ratio of aptamer and complementary strand to ensure efficient target displacement and release of complementary strand; at the same time, it optimizes the reaction stoichiometry ratio of hairpin probe HP and hairpin probe HPn (HPn represents hairpins HP1, HP2, and HP3, with a ratio of HP1:HP2:HP3=1:1:1) to accelerate the chain displacement reaction kinetics, thereby achieving ultrasensitive detection.

[0061] The results are attached. Figure 6 As shown in the figure. When the hybridization ratio is in the range of 1-1.5:1, after adding OTA, the absorbance value and SERS signal intensity increase with the increase of the hybridization ratio; while when the hybridization ratio is higher than 1.5:1, the absorbance value and SERS signal intensity decrease (see attached figure). Figure 6 (A and C). This is related to the reduced amount of cDNA released. As the amount of apt increases, apts that cannot bind to cDNA will remain free in the reaction system. OTA will bind to the free apts first, leading to a reduction in the amount of cDNA released, thereby decreasing the system's reaction efficiency.

[0062] Furthermore, within the stoichiometric ratio of HP to HPn of 0.5–1.5:1, both absorbance and Raman intensity increased with increasing HP:HPn ratio. However, once the HP:HPn stoichiometric ratio reached 1.5:1, both absorbance and SERS intensity remained essentially unchanged. (See Appendix) Figure 6 (B and D) indicate that the chain substitution efficiency of the system reaches its maximum within this time period. Therefore, apt:cDNA = 1.5:1 and HP:HPn = 1.5:1 are selected as the optimal reaction stoichiometric ratios.

[0063] 6.4 Optimization of Incubation Conditions: Incubation time and temperature are key factors determining the efficiency of cascade reactions. This invention optimizes the reaction time and temperature. The results are attached. Figure 7 As shown in Figures A and C, after the addition of OTA, the absorbance and SERS intensity increased with time, and the signal remained stable after 90 min of incubation, indicating complete hydrogel lysis. Therefore, 90 min was selected as the optimal reaction time for subsequent experiments.

[0064] This invention establishes temperature gradients of 27°C, 32°C, 37°C, 42°C, 47°C, and 52°C. (See attached diagram.) Figure 7 As shown in C and D, when the reaction temperature is 37℃, the absorbance value and SERS intensity after adding the target are the largest differences compared with those without the target, indicating that the reaction efficiency is the highest at 37℃.

[0065] After optimizing the above conditions, the final selection was: acrylamide monomer concentration of 30%, nucleic acid chain C concentration of 30 μM, and encapsulation at 1 mg / mL. -1 The optimal incubation conditions were: 10 μL nanozyme solution, apt:cDNA = 1.5:1, HP:HPn = 1.5:1, reaction time of 90 min, and reaction temperature of 37 °C.

[0066] 7. Performance determination of biosensing methods: This invention evaluates the sensitivity, specificity, reproducibility, and stability of the constructed biosensing method for OTA.

[0067] To determine the sensitivity of DNAzyme-mediated programmable composite DNA hydrogels for OTA quantification, this embodiment detected the content of OTA standard solutions with a known concentration gradient under the optimal incubation conditions described above. After incubation, the concentration was measured at 1071 cm⁻¹ at 785 nm. -1 The SERS intensity was measured at the reaction site. Simultaneously, TMB (10 μL, 0.25 mM) was added to the post-reaction solution, and the colorimetric signal was measured after 30 min of reaction. Details are as follows: 7.1 Establishing a standard curve for the application of DNAzyme-mediated programmable composite DNA hydrogels in the detection of fungal toxins. The first step is to prepare the standard solution. Add 2 mg / mL of OTA stock solution. -1 ), serially diluted to different concentrations (100, 10, 5, 2.5, 1.25, 0.625, 0.3125 ng / mL). -1 ), with 3 parallel samples for each concentration.

[0068] The second step involves sequentially measuring the absorbance (400-800 nm) and SERS intensity (500-2000 cm⁻¹) of each concentration standard using this method. -1 ).

[0069] The third step is to plot the standard curve. Plot the logarithm of concentration (x) on the x-axis, and measure the absorbance at 652 nm and 1071 cm⁻¹. -1 Using the Raman intensity (y) at a given location as the ordinate, a linear regression equation is fitted.

[0070] As attached Figure 8 As shown in A and B, the absorbance is 0.3125 ng·mL. -1 -5ng·mL -1The range showed a linear relationship with the logarithm of OTA concentration, and the linear regression equation was: y = 0.63466x + 0.75628 (R²). 2 =0.997), and the limit of detection (LOD) was 0.0668 ng·mL. -1 (n=11) (Appendix) Figure 8 C). SERS intensity at 0.3125 ng / mL -1 -5ng·mL -1 The range is linearly related to the logarithm of OTA concentration (see appendix). Figure 9 (D and E), the linear regression equation is: y = 2241.66412x + 1872.72061 (R²) 2 =0.994), LOD was 0.0342 ng·mL -1 (n=11) (Appendix) Figure 8 F). Compared with the results of other OTA detection methods (Table 2), the sensing method constructed in this invention exhibits a lower detection limit and higher sensitivity.

[0071] Table 2 Comparison of different methods for detecting OTA

[0072] Note: References are: [1] LIANG X, LI QL, LI JT, et al. A facile colorimetric sensorbased on Fe3O4 magnetic nanoparticles with intrinsic catalytic activity for the rapid and selective detection of ochratoxin A [J]. Food Chemistry, 2025. [2] ZHAO Y, LI J, SHI Y, et al. A label-free and ratiometric fluorescent sensor based on porphyrin-metal-organic frameworks for sensitive detection of ochratoxin A in cereal [J]. Chinese Chemical Letters, 2024. [3] CHEN R, DONG Y, LI S, et al. A particle counting immunosensor for the sensitive detection of ochratoxin A via click chemistry-mediated signal amplification [J]. Journal of Hazardous Materials, 2025. [4] XIE [5] XIANG Y, WU G, HU C, et al. Three-in-one lateral flow aptasensorbased on magnetic nanoparticles for on-site detection of ochratoxin A inAstragalus membranaceus [J]. Sensors and Actuators B: Chemical, 2024. To determine the target detection specificity of the constructed sensing method, this invention selected several other common non-target fungal toxins, including aflatoxin B1 (AFB1), fumonisin (FB1), zearalenone (ZEN), T-2 toxin, and patulin (PAT), for comparative analysis. Using the aforementioned detection steps, the absorbance values ​​at 652 nm and 1071 cm⁻¹ of different toxins were recorded in the sensing detection system. -1 SERS intensity at the location. (Attached) Figure 9 As shown in Figure A, there was no significant difference in signal response between non-target fungal toxins and the blank control. Significant colorimetric and SERS signals only appeared in the presence of the target OTA, indicating that the constructed biosensing method has high specificity for the target OTA.

[0073] To test the reproducibility of the method, this invention set up 5 independent experiments, each with 3 parallel groups, and measured the absorbance at 652 nm and 1071 cm⁻¹ corresponding to the same OTA concentration in the sensing system. -1 The SERS intensity at the location. The RSDs for the two modes were 1.382% and 0.289%, respectively (see attached). Figure 9 (B) indicates that the proposed dual-mode sensor has good reproducibility in OTA detection.

[0074] To test the stability of the constructed sensing method, the Au@Pt@4-MBN nanozyme system encapsulated in hydrogel was stored at 4°C for 25 days before OTA detection. Results attached. Figure 9 As shown in C, in contrast, the absorbance value of OTA at 652 nm decreased by 6.25% after 25 days, and at 1071 cm⁻¹ -1 The SERS intensity decreased by 6.86% after 25 days, indicating that the constructed method still maintains good stability after being stored at 4°C for 25 days.

[0075] Example 2 A programmable composite DNA hydrogel prepared in Example 1 was used to detect OTA in a corn sample.

[0076] Signal detection: After the reaction is complete, the reaction product is measured at 785 nm and 1071 cm⁻¹. -1 The SERS intensity at the point was measured. Simultaneously, TMB (10 μL, 0.25 mM) was added to the reacted solution, and the colorimetric signal was measured after 30 min of reaction.

[0077] 1) Establish a standard curve for the application of DNAzyme-mediated programmable composite DNA hydrogels in the detection of fungal toxins. The first step is to prepare the standard solution. Add 2 mg / mL of OTA stock solution. -1 ), serially diluted to different concentrations (100, 10, 5, 2.5, 1.25, 0.625, 0.3125 ng / mL). -1 ), with 3 parallel samples for each concentration.

[0078] The second step involves sequentially measuring the absorbance (400-800 nm) and SERS intensity (500-2000 cm⁻¹) of each concentration standard using this method. -1 ).

[0079] The third step is to plot the standard curve. Plot the logarithm of concentration (x) on the x-axis, and measure the absorbance at 652 nm and 1071 cm⁻¹. -1 Using the Raman intensity (y) as the ordinate, a linear regression equation was fitted. The results are attached. Figure 8As shown in C and F, the regression equations are: y = 0.63466x + 0.75628 (R²) 2 =0.997), and y=2241.66412x+1872.72061 (R 2 =0.994).

[0080] 2) Calculate the OTA content in the corn sample. First, weigh 5.0 g of corn sample, add 25 mL of chloroform and 2.5 mL of 0.1 mol·L⁻¹ -1 The sample was extracted with phosphate buffer and vortexed for 3-5 min. The extract was then filtered through qualitative filter paper. 10 mL of the lower filtrate was transferred to a 100 mL flat-bottom flask and evaporated to near dryness using a rotary evaporator in a 40 °C water bath. The residue was dissolved in 20 mL of petroleum ether, and 10 mL of the extract was added. The sample was then vortexed for 3-5 min. After standing and separating the layers, the lower layer was collected and filtered through filter paper for later use. Different concentrations of OTA were added to the filtrate to prepare real samples. The recovery rate of OTA was determined by the formula R = (C1-C2) / C3 × 100%, where R is the recovery rate, and C1, C2, and C3 are the concentrations of the spiked sample, the blank sample, and the standard concentration of the spiked sample, respectively. This verified the ability of the constructed sensing method to detect targets in real samples.

[0081] Table 3. Detection results of OTA in maize

[0082] Table 3 shows that the spiked recoveries in the extract solution were 97.812%-108.667% and 95.6%-104.267%, respectively, with RSDs of 0.781%-2.413% and 0.089%-0.572%, respectively, indicating that the method constructed in this invention has high detection capability and accuracy.

Claims

1. A programmable composite DNA hydrogel, characterized in that, The polymer consists of a three-dimensional network structure polymer product formed by acrylamide monomer solution and acrylate-modified nucleic acid molecules, and Au@Pt nanozymes modified with Raman reporter are encapsulated in the three-dimensional network structure polymer product.

2. The programmable composite DNA hydrogel according to claim 1, characterized in that, The acrylamide monomer solution and acrylate-modified nucleic acid molecules are mixed in equal volumes and then crosslinked under the action of initiators and accelerators to form a three-dimensional network structure polymer product. The concentration of the acrylamide monomer solution is 25%-40%, and the acrylate-modified nucleic acid molecules include nucleic acid chains A and B. The sequence of nucleic acid chain A is Acrydite-TTTGTGGGCCTAGCGA; the sequence of nucleic acid chain B is Acrydite-TTTACACGTGCCCAAC. The three-dimensional network structure polymerization products include three-dimensional network structure polymerization products formed by acrylamide monomer and acrylate-modified nucleic acid chain A, and three-dimensional network structure polymerization products formed by acrylamide monomer and acrylate-modified nucleic acid chain B.

3. The programmable composite DNA hydrogel according to claim 1, characterized in that, The three-dimensional network structure polymer product was mixed with 25 μM-35 μM nucleic acid chain C and 1 mg·mL -1 The Au@Pt nanozyme modified with Raman reporter was mixed and hydrothermally reacted and cooled to obtain a programmable composite DNA hydrogel. An equal volume of acrylamide monomer solution and acrylate-modified nucleic acid molecules were mixed. Nucleic acid chain C and the Au@Pt nanozyme modified with Raman reporter were added in equal volume to the mixture of acrylamide monomer solution and acrylate-modified nucleic acid molecules. The sequence of nucleic acid chain C is: ATGTGCACGGGTTG / rA / TCGCTAGGCCCACA.

4. The programmable composite DNA hydrogel according to claim 3, characterized in that, The amount of Au@Pt nanozyme modified with Raman reporter was 10 μL.

5. The programmable composite DNA hydrogel according to claim 1, characterized in that, In the Au@Pt nanozyme modified with a Raman reporter, the Raman reporter is 4-mercaptobenzonitrile.

6. The application of the programmable composite DNA hydrogel according to any one of claims 1-5 in rapid detection of fungal toxins, characterized in that, After mixing equal volumes of apt-cDNA complex, HP, HPn, magnesium chloride solution, and programmable composite DNA hydrogel, the fungal toxin test solution was added. After incubation, the reaction product was measured at 785 nm and 1071 cm⁻¹. -1 The content of mycotoxins was obtained by analyzing the Raman signal at 652 nm and the colorimetric signal at 652 nm.

7. The application of a programmable composite DNA hydrogel according to claim 6 in rapid detection of fungal toxins, characterized in that, The hybridization ratio of apt to cDNA in the apt-cDNA complex is 1-3:1; HPn includes HP1, HP2, and HP3 in a ratio of 1:1:1, and the stoichiometric ratio of HP to HPn is 0.5-2.5:

1.

8. The application of a programmable composite DNA hydrogel according to claim 6 in rapid detection of fungal toxins, characterized in that, The incubation conditions were 32℃-42℃ for 80-120 minutes.

9. The application of a programmable composite DNA hydrogel according to claim 6 in rapid detection of fungal toxins, characterized in that, The fungal toxin is ochratoxin A.

10. The application of a programmable composite DNA hydrogel according to claim 9 in rapid detection of fungal toxins, characterized in that, In the apt-cDNA complex, apt is OTA-apt, and the nucleic acid sequence of OTA-apt is GATGGGTGGGTGGCGTAAAGGGAGCATCGGACAG; the nucleic acid sequence of cDNA is TGTCCGATGTTTTTTTACACCCGA; the nucleic acid sequence of HP is CATCGGGTGTAAAGCGT / rA / GCTTATGCTTTTTGACTCCGAGCCGGACGAACGCAACATCGGACA; HPn includes HP1, HP2, and HP3, where the nucleic acid sequence of H1 is TGATTGATTGTACCCACACGCTTTACACCCGATGTACCTGCTCCATCCCATCGGGTGTAA; the nucleic acid sequence of H2 is TTACACCCGATGGGATGGAGCAGGTACATCGGGTGTAAAGCGTTGTACCTGCTCCATCCCATCG; and the nucleic acid sequence of H3 is GTACCTGCTCCGATGGGATGGAGCAGGTACATAGCGACTTCTCTAC.