Multifunctional nanofluid hybrid membrane as well as preparation method and application thereof

Abstract

The invention discloses a multifunctional nanofluid hybrid membrane as well as a preparation method and application thereof. The hybrid membrane comprises a layer of self-assembled and arranged plasma electronic sponge membrane and a layer of membrane material with a macroporous structure, plasma nano particles in the plasma electronic sponge membrane are gold nano particles and are connected with ssDNA probes through Au-S bonds, the ssDNA probes comprise a probe 1 and a probe 2, the probe 1 is matched with protein on the surface of tumor-derived extracellular vesicles, and the probe 2 is complementarily paired with miRNAs released by the vesicles; and the electronic sponge is polyacid. The multifunctional nanofluid hybrid membrane disclosed by the invention can integrate capture and quantification of tumor-derived extracellular vesicles and in-situ detection of miRNAs released by the tumor-derived extracellular vesicles, is excellent and stable in performance, realizes multiple detection of tumor-derived extracellular vesicle biomarkers, and provides a new strategy with a wide prospect for efficient clinical diagnosis.

Description

Technical Field

[0001] This invention relates to an ion channel composite membrane, its preparation method and application, and particularly to a multifunctional nanofluid hybrid membrane, its preparation method and application. Background Technology

[0002] Extracellular vesicles (EVs) are heterogeneous membrane-coated bio-nano / micron-sized particles actively secreted by cells into biological fluids such as blood, urine, and tears, carrying molecular components of the parent cell (proteins, nucleic acids, and other metabolites). Taking tumor-derived EVs (tEVs) as an example, these vesicles exhibit differentiated protein expression levels and types during the occurrence, development, and treatment response of different cancers. Therefore, tEVs have become highly promising biomarkers in the field of cancer liquid biopsy. Furthermore, tEVs carry small RNAs (miRNAs) that reflect the molecular characteristics of the primary tumor; these miRNAs with unique expression profiles can provide important information for tumor diagnosis and prognostic assessment. Electrochemical analysis techniques based on nanochannel arrays have attracted increasing attention in the field of high-sensitivity detection of cancer biomarkers due to their high specificity and sensitivity. Previous work has reported the sensitive detection of tEVs based on the recognition of exosomal proteins and EV miRNAs using functionalized nanochannel arrays. While these methods offer advantages such as ease of operation and high sensitivity, making rapid detection of tEVs possible, they still cannot achieve simultaneous detection of multiple analytes in tEVs. Summary of the Invention

[0003] Objectives of the Invention: The first objective of this invention is to provide a multifunctional nanofluidic hybrid membrane for in-situ integrated synergistic detection of surface proteins and released miRNAs from tumor-derived extracellular vesicles; the second objective of this invention is to provide a method for preparing the multifunctional nanofluidic hybrid membrane; and the third objective of this invention is to provide applications of the multifunctional nanofluidic hybrid membrane.

[0004] Technical solution: The multifunctional nanofluidic hybrid membrane of the present invention comprises a self-assembled plasma-electron sponge membrane and a membrane material with a macroporous structure; the plasma nanoparticles in the plasma-electron sponge membrane are gold nanoparticles, and the surface of the plasma-electron sponge membrane is connected to ssDNA probes via Au-S bonds. The ssDNA probes include probe 1 and probe 2. Probe 1 is adapted to proteins on the surface of tumor-derived extracellular vesicles (tEVs), and probe 2 is complementary to miRNAs released from the vesicles; the electron sponge is a polyacid.

[0005] The multifunctional nanofluidic hybrid membrane captures tEVs by means of protein complementarity between probe 1 and the surface of tEVs, and then ruptures tEVs by light to release miRNAs. Probe 2 is complementary to miRNAs, thus realizing the integration of tEVs capture, quantification and in situ detection of released miRNAs.

[0006] The gold nanoparticles have a particle size of 30-40 nm.

[0007] Preferably, the tumor-derived extracellular vesicles are A549-tEVs, the protein on their surface is epithelial cell adhesion molecule (EpCAM), and the miRNA they release is miR-10b.

[0008] Preferably, the base sequence of probe 1 (SEQ ID NO.1) is as follows:

[0009] CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTTTTTTTTT;

[0010] The base sequence of probe 2 (SEQ ID NO.2) is as follows:

[0011] CACAAATTCGGTTCTACAGGGTATTTTTTTTTTTT.

[0012] The preferred miR-10b base sequence (SEQ ID NO.3) is as follows:

[0013] UACCCUGUAGAACCGAAUUUGUG.

[0014] Preferably, the membrane material with a macroporous structure is anodized aluminum oxide membrane or titanium dioxide nanotubes with a pore size of 50~100 nm.

[0015] Preferably, the polyacid is phosphotungstic acid, phosphomolybdic acid, or silicotungstic acid, and the thickness of the plasma electron sponge film is 50~100 nm.

[0016] Preferably, the polyacid is Keggin-type phosphotungstic acid.

[0017] The preparation method of the multifunctional nanofluidic hybrid membrane of the present invention includes the following steps:

[0018] (1) Fixing the plasma electron sponge membrane to a membrane material with a macroporous structure;

[0019] (2) Drop the ssDNA solution onto the membrane surface treated in step (1) and incubate it to modify the ssDNA through Au-S bonds to obtain the multifunctional nanofluid hybrid membrane.

[0020] Preferably, the ssDNA concentration is 1-5 μM and the incubation time is 3-8 h.

[0021] The method for preparing the plasma electron sponge film includes the following steps:

[0022] (1) Fixing the plasma electron sponge membrane to a membrane material with a macroporous structure;

[0023] (2) Drop the ssDNA solution onto the membrane surface treated in step (1) and incubate it to modify the ssDNA through Au-S bonds to obtain the multifunctional nanofluid hybrid membrane.

[0024] Preferably, the ssDNA concentration is 1-5 μM and the incubation time is 3-8 h.

[0025] The method for preparing the plasma electron sponge film includes the following steps:

[0026] (1) Synthesis of gold seeds: Dissolve trisodium citrate in ultrapure water, add HAuCl4 aqueous solution while stirring, mix thoroughly, then quickly add sodium borohydride aqueous solution and stir vigorously until the solution turns orange to obtain gold seed solution;

[0027] (2) Preparation of gold solution: Boil HAuCl4 aqueous solution, add gold seed solution and trisodium citrate aqueous solution in sequence, and stop heating when the solution gradually changes from colorless to purple-red. Cool naturally to room temperature under stirring to obtain gold solution.

[0028] (3) Preparation of Au@POMs: Dissolve phosphotungstic acid in water, add isopropanol, reduce under ultraviolet light, and mix the reduced phosphotungstic acid solution with the gold solution to obtain Au@POMs solution;

[0029] (4) Au@POMs are self-assembled into the water-oil two-phase interface formed by Au@POMs solution and n-hexane using an inducing agent to form a plasma electron sponge film.

[0030] Preferably, in steps (1) and (2), the concentration of the HAuCl4 aqueous solution is 5~30 mM.

[0031] Preferably, in step (1), the mass ratio of trisodium citrate to water is 1~3:20.

[0032] Preferably, in step (1), the concentration of the sodium borohydride aqueous solution is 0.05~0.2 M.

[0033] Preferably, in step (1), the volume ratio of the trisodium citrate aqueous solution, HAuCl4 aqueous solution, and sodium borohydride aqueous solution is 20:0.1~1:0.3~1.2.

[0034] Preferably, the gold seeds have a particle size of 5-10 nm.

[0035] Preferably, in step (2), the concentration of the HAuCl4 aqueous solution is 0.1~1 mM.

[0036] Preferably, in step (2), the concentration of the trisodium citrate aqueous solution is 5~20 mg / mL.

[0037] Preferably, in step (2), the volume ratio of the HAuCl4 aqueous solution, the gold seed solution and the trisodium citrate aqueous solution is 201:1~3:1.6~6.4.

[0038] Preferably, in step (2), the particle size of Au is 30~40 nm.

[0039] In step (3), the volume ratio of the phosphotungstic acid aqueous solution, isopropanol and Au solution is 0.2~0.8:0.05~0.09:8.

[0040] The application of the multifunctional nanofluidic hybrid membrane described in this invention in the synergistic detection of tumor-derived extracellular vesicles and their released miRNAs.

[0041] The application method is as follows:

[0042] (1) Tumor-derived extracellular vesicles were added to the nanofluidic hybrid membrane and incubated to detect the successful capture of tumor-derived extracellular vesicles;

[0043] (2) Irradiate the sample after step (1) and detect miRNA.

[0044] Taking lung cancer A549 as an example, the preparation and extraction steps of its tumor-derived extracellular vesicles (A549-tEVs) are as follows:

[0045] (1) The lung cancer A549 cell line was cultured in DMEM medium containing 10% fetal bovine serum (FBS), 1% penicillin and 100 µg / mL streptomycin at 37 ℃ and 5% CO2. When the cell confluence reached 70%~80%, the medium was replaced with serum-free DMEM medium and cultured for 12~24 hours until the confluence reached 90%-100%. The supernatant was then subjected to gradient centrifugation, and finally tEVs were extracted using a commercial kit.

[0046] (2) In the salt solution, probe 1 specifically captures the EpCAM protein on the outer surface of tEVs, successfully capturing and detecting tEVs. Then, under light conditions, thanks to the excellent photothermal and photoelectric effects of Au@POMs, tEVs rupture and release their contents. The highly expressed miR-10b contained therein specifically binds to probe 2, realizing the cascade detection of miR-10b.

[0047] Invention Mechanism:

[0048] Polyoxometalates (POMs), also known as electron sponges, can regulate charge density while maintaining structural stability. Au nanoparticles possess a unique localized surface plasmon resonance (LSPR) effect, providing abundant hot electrons under illumination. When bound to POMs, electrons are continuously transferred from Au nanoparticles (NPs) to POMs, significantly enhancing the surface negative charge and signal response. Probe 1, specifically recognizing tEVs, and probe 2, specifically recognizing miR-10b, were stabilized on the surface of a nanofluidic hybrid membrane via Au-S bonds. Based on changes in ion current, specific capture and quantitative analysis of EpCAM protein-positive tEVs were achieved. Under illumination, due to the excellent photothermal effect of Au@POMs, the local temperature of the hybrid membrane increases, leading to vesicle lysis and release of contents, thus enabling cascade detection of miRNAs. Notably, during illumination, hot electrons generated by gold nanoparticles are transferred to POMs, while holes are quenched by water molecules. This process effectively increases the charge density of the plasmon electron sponge membrane, significantly improving the miRNA detection response range and sensitivity.

[0049] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The multifunctional nanofluidic hybrid membrane of the present invention can integrate tEVs capture, quantification and in situ detection of miRNA released by tEVs, with excellent performance and stability, realizing multiple detection of tumor-derived extracellular vesicle (tEVs) biomarkers, providing a promising new strategy for efficient clinical diagnosis; (2) The multifunctional nanofluidic hybrid membrane of the present invention can accurately detect tEVs and miR-10b, with detection limits (LODs) of 1.995×10⁻⁶ respectively. 2 particles / mL, 2.297 aM; (3) The multifunctional nanofluid hybrid membrane of the present invention has high discrimination in the detection of clinical serum, indicating that the method has broad application prospects in actual sample analysis; (3) The preparation method is simple and easy to industrialize. Attached Figure Description

[0050] Figure 1 A schematic diagram of the preparation process of the multifunctional nanochannel hybrid membrane prepared in Example 1;

[0051] Figure 2 Transmission electron microscope (TEM) images of individual 35 nm Au and Au@POMs in Example 1;

[0052] Figure 3 The images show the surface and cross-sectional scanning electron microscope (SEM) images of the 75 nm AAO film in Example 1.

[0053] Figure 4 A scanning electron microscope (SEM) schematic diagram of the multifunctional nanofluidic hybrid membrane prepared in Example 1;

[0054] Figure 5 Transmission electron microscopy image of tEVs prepared in Example 1;

[0055] Figure 6 Linear range curves and detection limit analysis diagrams for the detection of tEVs using multifunctional nanochannel hybrid membranes;

[0056] Figure 7 Linear range curves and detection limit analysis diagrams for the detection of miR-10b using a multifunctional nanochannel hybrid membrane;

[0057] Figure 8 The current signal response diagram for dual-marker detection of a multifunctional nanochannel hybrid membrane;

[0058] Figure 9 This is a graph showing the time stability analysis of a multifunctional nanochannel hybrid membrane.

[0059] Figure 10 Three-dimensional scatter plot of a multifunctional nanochannel hybrid membrane used to differentiate patient types in clinical serum samples. Detailed Implementation

[0060] The technical solution of the present invention will be further described below with reference to the embodiments.

[0061] Example 1

[0062] The multifunctional nanofluidic hybrid membrane of the present invention is prepared by means of the following steps:

[0063] (1) Synthesis of gold seeds: 1.47 mg of trisodium citrate was dissolved in 20 mL of ultrapure water. 0.5 mL of 10 mM HAuCl4 aqueous solution was added while stirring. After thorough mixing, 0.6 mL of 0.1 M sodium borohydride aqueous solution was quickly added. The solution was stirred vigorously until it turned orange to obtain a gold seed solution with a gold seed particle size of 5 nm.

[0064] (2) Preparation of Au NPs with a particle size of 35 nm: After boiling 201 mL of 0.3 mM HAuCl4 aqueous solution, 1.5 mL of gold seed solution prepared in step (1) and 3.2 mL of trisodium citrate aqueous solution with a concentration of 10 mg / mL were added in sequence. After the solution gradually changed from colorless to wine red and did not change color, the heater was turned off and allowed to cool naturally to room temperature under stirring to obtain Au NPs aqueous solution.

[0065] (3) Preparation of Au@POMs NPs: 0.1202 g of Keggin-type phosphotungstic acid (H3PW) was added. 12 O 40 PW (abbreviated as PW) 12 Dissolve in 2.7 mL of deionized water, add 296 μL of isopropanol, and irradiate under ultraviolet light for 30 minutes to reduce. Mix the blue-black solution of reduced phosphotungstic acid with 32 mL of Au NPs aqueous solution prepared in step (2) to obtain Au@POMs NPs solution.

[0066] (4) Preparation of plasma electron sponge membrane: 5 mL of n-hexane was added to 30 mL of Au@POMs NPs solution to form a two-phase interface. Using ethanol as an inducer, Au@POMs NPs were extracted to the two-phase interface to self-assemble and form a plasma electron sponge membrane.

[0067] (5) Preparation of anodic aluminum oxide (AAO): AAO film was synthesized by a two-step anodizing method. First, aluminum foil (Al) was cleaned with ethanol and KOH, and then rinsed with H2O. In the first anodizing step, 0.3 M oxalic acid was used as the electrolyte and a voltage of 50 V was applied for half an hour. To remove the irregular oxide layer formed in this step, the Al anodized in the first step was placed in a mixed solution containing 6 wt% H3PO4 and 1.8 wt% H2CrO4 and treated at 60 °C for 40 minutes. Then, a second anodizing was carried out under the same conditions as the first step for 4 hours. The Al substrate was peeled off with SnCl2 solution, and the AAO film was placed in 1.8 wt% H3PO4 solution for 40 minutes to remove the barrier layer. The prepared AAO was then immersed in boiling hydrogen peroxide (30 % H2O2) to generate a large number of hydroxyl groups, and finally soaked in water overnight and dried thoroughly.

[0068] (6) Preparation of multifunctional nanochannel hybrid membrane: The plasma electron sponge membrane prepared in step (4) was transferred to the nanochannel end face of the anodic aluminum oxide membrane prepared in step (5), and heat-fixed in an oven at 80 °C for 2 h to obtain the unmodified probe nanochannel hybrid membrane (PESM); then, 1 μM of each of the two probes (the sequences of probe 1 and probe 2 with thiol groups modified at the 3' end are shown in Table 1, and the synthetic sequences were commissioned to Sangon Biotech Co., Ltd.) were dropped onto the surface of the PESM membrane and incubated at room temperature for 5 h to uniformly modify the probes on the surface of the PESM membrane, thus obtaining the multifunctional nanochannel hybrid membrane (PESMD) shown. The entire preparation process is as follows. Figure 1 As shown.

[0069] Table 1

[0070] name sequence Thiolization probe 1 CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTTTTTTTTT-SH Thiolization probe 2 CACAAATTCGGTTCTACAGGGTATTTTTTTTTTTT-SH

[0071] Transmission electron microscopy analysis was performed on the Au NPs and Au@POMs prepared in step (2), such as... Figure 2 As shown on the left, the Au NPs have a particle size of 35 nm. Due to the excellent contrast of W element in TEM imaging, Figure 2 (Right) It can be observed that the gold nanoparticles are surrounded by ring-shaped POMs.

[0072] The AAO membrane prepared in step (5) was analyzed by scanning electron microscopy, and the results were as follows: Figure 3 As shown, the pore size of the AAO membrane is 75 nm (3A), and the thickness of the nanochannel is approximately 79 μm (3B).

[0073] The multifunctional nanochannel hybrid membrane prepared in step (6) was analyzed by scanning electron microscopy, such as... Figure 4 As shown, scanning electron microscopy (SEM) images reveal that a tightly packed hybrid layer completely covers the top of the AAO membrane. Figure 4 A), forming an array layer approximately 75 nm thick ( Figure 4 B).

[0074] Example 2

[0075] Extraction of tEVs and detection of electrical signals:

[0076] 1. Detection of A549-tEVs: A549 cells were cultured in DMEM medium (containing 10% fetal bovine serum (FBS), 1% penicillin, and 100 µg / mL streptomycin) at 37 °C and 5% CO2. When the cell confluence reached 70%-80%, the medium was replaced with serum-free DMEM and cultured for another 12-24 hours until the confluence reached 90%-100%. The supernatant was then subjected to gradient centrifugation: first, dead cells were removed at 500×g (4 °C, 5 min), and then microvesicles were removed at 16,500×g (4 °C, 30 min). After filtration through a 0.22 μm filter, A549-tEVs were extracted using a commercial kit.

[0077] like Figure 5 As shown, the extracted A549-tEVs were scanned by transmission electron microscopy and revealed a typical bilayer film ring structure.

[0078] 2. Electrochemical detection

[0079] Electrochemical measurements related to ion current were performed using a CHI 660E electrochemical workstation. The prepared membrane was immobilized between two custom-made electrochemical cells, each half-cell filled with 2 mL of 100 mM KCl solution. A pair of highly sensitive and stable Ag / AgCl electrodes were used to record the transmembrane ion current. Scan voltages ranging from -1.2 V to +1.2 V (in 0.05 V steps) were applied under different experimental conditions to obtain current-voltage (IV) curves.

[0080] (1) Capture of A549-tEVs: Based on Example 1, in step (6), only 1 μM probe 1 was added to obtain a nanochannel hybrid film modified only with probe 1; in the electrochemical measurement, 1.35 × 10 3 1.35×10 4 1.35×10 5 1.35×10 6 1.35×10 7 1.35×10 8 1.35×10 9 A549-tEVs particles / mL were dropped onto the surface of a nanochannel hybrid membrane modified only with probe 1 and incubated at room temperature for 1 h. After rinsing with deionized water to remove unbound tEVs, the membrane was then analyzed. The test results are as follows: Figure 6 As shown.

[0081] Depend on Figure 6 (A) It can be seen that under the condition of 1 μM probe 1, the ion current at +1 V voltage gradually decreases with the increase of A549-tEVs concentration; Figure 6(B) The standard calibration curve shows a negative correlation between the ion current value and the target concentration of A549-tEVs, at 1.35 × 10⁻⁶. 3 ~1.35×10 9 A good linear relationship was observed in the particle / mL range (R0). 2 =0.99706), with a detection limit (LOD) as low as 1.995×10⁻⁶. 2 particles / mL (3σ / k).

[0082] (2) Detection of miR-10b

[0083] Based on Example 1, in step (6), only 1 μM probe 2 was added to obtain a nanochannel hybrid film modified only with probe 2; in the electrochemical measurement, the experimental group used a concentration of 10 -4 μM, 10 -5 μM, 10 -6 μM, 10 -7 μM, 10 -8 μM, 10 -9 μM, 10 -10 μM, 10 -11 μM miR-10b (base sequence shown in Table 2, synthesized by Sangon Biotech Co., Ltd.) was dropped onto the surface of a nanochannel hybrid membrane modified only with probe 2, and incubated at room temperature for 20 min. It was then rinsed with deionized water to remove unbound miR-10b, and then incubated under light conditions (808 nm, 1 W cm⁻¹). -2 The laser was used as the light source for detection; the difference between the control group and the experimental group was that the concentration of miR-10b was 10. -5 μM, 10 -6 μM, 10 -7 μM, 10 -8 μM, 10 -9 μM, 10 -10 μM, no light was applied during the detection process, all other conditions remained unchanged, and the test results are as follows: Figure 7 As shown.

[0084] Table 2

[0085] name sequence miR-10b UACCCUGUAGAACCGAAUUUGUG

[0086] Depend on Figure 7 (A) It can be seen that under illumination conditions (using 808 nm, 1 W cm⁻¹), -2 (Using a laser as the light source), the ion current at +1 V gradually increases with increasing miR-10b concentration; Figure 7(B) The standard calibration curve shows a positive correlation between the ion current value and the miR-10b target concentration, exhibiting a good linear relationship in the range of 10 aM-0.1 nM (Rm). 2 =0.99501), with a detection limit (LOD) as low as 2.297 aM (3σ / k). From Figure 7 (C, D) show that, without illumination, the linear range is 100 aM–10 pM, and the detection limit (LOD) is 25.704 aM (3σ / k), both lower than under illumination. This is because under illumination, electrons transfer from gold nanoparticles (AuNPs) to polyoxometalates (POMs), and the "hot electrons" generated by plasmons reduce the charge transfer resistance, thereby improving the overall conductivity.

[0087] Example 3

[0088] The PESMD prepared in Example 1, on which probes 1 and 2 were uniformly modified, was used for detection. The test method was as follows:

[0089] (1) Capture of A549-tEVs: In electrochemical measurements, 1.35 × 10 9 A549-tEVs at particle / mL (extraction method as in Example 2) were dropped onto the PESMD surface prepared in Example 1 and incubated at room temperature for 1 h; after rinsing with deionized water to remove unbound tEVs, the samples were then analyzed.

[0090] (2) At 808 nm, 1 W cm -2 The laser light was applied to the surface of the device for 12 minutes, at which point the tEVs fractured and miR-10b was detected.

[0091] Test results are as follows Figure 8 As shown.

[0092] Depend on Figure 8 It can be seen that, at +1V, the decrease in current value of the PESMD curve relative to the PESM curve proves the successful modification of the PESM film by probes 1 and 2; the decrease in current value of the PESMD-tEVs curve relative to the PESMD curve proves that probe 1 successfully captured tEVs; subsequently, illumination was applied (808 nm, 1 W cm⁻¹). -2 Under the excellent photothermal effect of Au@POMs, the vesicles rupture and release the contents miR-10b. The subsequent increase in the current value of the PESMD-miR-10b curve proves the successful binding of probe 2 with miR-10b. The signal response before and after photothermal rupture verifies the synergistic detection capability of this nanofluid platform.

[0093] Example 4

[0094] Considering that device stability is a key factor in evaluating the practical application of biosensors, the PESMD of the fabricated device was tested using IV curves, such as... Figure 9 As shown.

[0095] Depend on Figure 9 It can be seen that after the device was immersed in KCl electrolyte for 1 to 7 days, its electrochemical state did not change, which proves the good stability of the device.

[0096] Example 5

[0097] Clinical sample processing:

[0098] Blood samples were collected from 10 healthy volunteers (HP), 10 lung cancer patients (LP), and 10 lung cancer patients who had undergone chemotherapy (CP) from a local hospital, and analyzed using the developed nanochannel platform. The collected blood samples were immediately centrifuged at 3000 rpm for 15 minutes at 4 °C, and the separated serum supernatant was aliquoted and stored for subsequent experiments. The processed serum was added to a nanofluidic hybrid membrane modified with two probes as described in Example 1, and the changes in the current signal response of tEVs capture and specific recognition of miR-10b were detected, using the same testing method as in Example 3. The test results are as follows: Figure 10 As shown.

[0099] Depend on Figure 10 The test results show that the multifunctional nanofluid hybrid membrane based on the present invention can clearly distinguish between lung cancer patients before and after chemotherapy and healthy volunteers, demonstrating the advantages of this nanofluid platform in the analysis of actual clinical samples.

Claims

1. A multifunctional nanofluidic hybrid membrane, characterized in that, It includes a self-assembled plasma-electron sponge membrane and a membrane material with a macroporous structure; the plasma nanoparticles in the plasma-electron sponge membrane are gold nanoparticles, and the surface of the plasma-electron sponge membrane is connected to ssDNA probes via Au-S bonds. The ssDNA probes include probe 1 and probe 2. Probe 1 is adapted to proteins on the surface of tumor-derived extracellular vesicles, and probe 2 is complementary to miRNAs released from the vesicles; the electron sponge is a polyacid.

2. The multifunctional nanofluidic hybrid membrane according to claim 1, characterized in that, The tumor-derived extracellular vesicles are A549-tEVs, the proteins on their surface are epithelial cell adhesion molecules, and the miRNAs they release are miR-10b.

3. The multifunctional nanofluidic hybrid membrane according to claim 2, characterized in that, The base sequence of probe 1 is as follows: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTTTTTTTTT; The base sequence of probe 2 is as follows: CACAAATTCGGTTCTACAGGGTATTTTTTTTTTTT.

4. The multifunctional nanofluidic hybrid membrane according to claims 1-3, characterized in that, The membrane material with a macroporous structure is anodized aluminum oxide membrane or titanium dioxide nanotubes with a pore size of 50~100 nm.

5. The multifunctional nanofluidic hybrid membrane according to claim 4, characterized in that, The polyacid is phosphotungstic acid, phosphomolybdic acid, or silicotungstic acid, and the thickness of the plasma electron sponge film is 50~100 nm.

6. The multifunctional nanofluidic hybrid membrane according to claim 5, characterized in that, The polyacid is Keggin-type phosphotungstic acid.

7. A method for preparing a multifunctional nanofluidic hybrid membrane according to any one of claims 1 to 6, characterized in that, Includes the following steps: (1) Fixing the plasma electron sponge membrane to a membrane material with a macroporous structure; (2) Drop the ssDNA solution onto the membrane surface treated in step (1) and incubate it to modify the ssDNA through Au-S bonds to obtain the multifunctional nanofluid hybrid membrane.

8. The method for preparing the multifunctional nanofluidic hybrid membrane according to claim 7, characterized in that, The concentration of ssDNA was 1-5 μM, and the incubation time was 3-8 h.

9. The application of the multifunctional nanofluidic hybrid membrane according to any one of claims 1 to 6 in the synergistic detection of surface proteins and released miRNAs of tumor-derived extracellular vesicles.

10. The application according to claim 9, characterized in that, The application method is as follows: (1) Tumor-derived extracellular vesicles were added to the surface of the multifunctional nanofluid hybrid membrane and incubated to detect the successful capture of tumor-derived extracellular vesicles; (2) Irradiate the sample after step (1) and detect miRNA.

Images