Application of EVX2 gene methylation in evaluation of cervical carcinoma risk of high-risk HPV infected person

Abstract

The invention belongs to the technical field of gene detection, and discloses application of EVX2 gene methylation in evaluation of cervical carcinoma risk of high-risk HPV infected persons. The biomarker for evaluating the cervical cancer risk of the high-risk HPV infected person is a methylation site of an EVX2 gene. According to the invention, detection of the methylation level of the EVX2 gene is applied to evaluation of cervical cancer risk of high-risk HPV infected people, and the kit can be used for screening and shunting cervical HSIL and cervical cancer and is beneficial to early intervention of high-risk HPV infected people.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, specifically to the application of EVX2 gene methylation in assessing the risk of cervical cancer in high-risk HPV-infected individuals. Background Technology

[0002] Cervical cancer is a highly prevalent malignant tumor among women worldwide. HPV infection is the main culprit behind cervical cancer, and persistent high-risk HPV infection is the primary cause of cervical intraepithelial lesions and cervical cancer. High-risk HPV testing is currently the most commonly used clinical method for cervical cancer screening, while cervical cytology is used as a triage method for HPV-positive patients. Although HPV testing has high sensitivity, it also has some limitations, such as low specificity and high cost. Cytology examination is highly susceptible to subjective interpretation and has low sensitivity. For patients who are positive for the main carcinogenic HPV types (i.e., HPV16 and HPV18), most undergo invasive colposcopy, which can lead to patient anxiety, overtreatment, and other problems.

[0003] DNA methylation detection has proven to be a promising method in cancer screening. Numerous studies have found that hypermethylation of host genes and HPV genes is common in the early stages of cervical cancer. Methylation of host gene promoters occurs in various genes, including tumor suppressor genes, histone modification genes, and microRNAs (miRNAs), and is also present in HPV viral genes. Hypermethylation of promoters of tumor suppressor genes (such as CDKN2A, RASSF1, and DAPK1) is common in cervical cancer tissue, leading to gene expression silencing and promoting abnormal cell proliferation. Kong et al. found that methylation of the EPB41L3 and JAM3 genes can be used to detect cervical intraepithelial neoplasia (CIN2) or more severe lesions (CIN2). + Hypermethylation of the FAM19A4 and miR124-2 promoters has been identified as a key epigenetic event in the progression of cervical squamous cell carcinoma, particularly in the diagnosis of HSIL and above (HSIL). + The sensitivity of methylation testing for cervical intraepithelial neoplasia grade 2 (CIN2) and its specificity are 97.6% and 85.7%, respectively. Numerous studies have shown that methylation testing, as a triage method for hr-HPV-positive women, is effective for cervical intraepithelial neoplasia grade 2 (CIN2) or more severe lesions. +Cervical methylation testing exhibits good screening sensitivity. Therefore, compared to traditional HPV testing, methylation testing can significantly reduce false positive rates, decrease unnecessary referrals for colposcopy, and enable risk stratification management. Methylation testing can be achieved through various methods, including quantitative methylation-specific polymerase chain reaction (qMSP) and whole-genome sulfite sequencing. These methods differ in sensitivity, turnaround time, cost, and applicability to large clinical sample sizes. Currently, cervical methylation testing kits are available on the market, such as the PAX1 / JAM3 dual-gene detection based on qMSP technology, and the FAM19A4 / miR124-2 / PAX1 / EPB41L3 multi-gene methylation combination detection kit. However, due to differences in primer design, instrument platforms, poor reproducibility, and high testing costs, these kits have not yet been widely adopted in clinical practice.

[0004] Therefore, although methylation detection of host genes or HPV gene promoters associated with cervical cancer has been recommended for cervical cancer screening by several guidelines, this technology has not yet been widely used in clinical practice. The main reasons are shortcomings in detection reliability, analytical sensitivity, and broad applicability. There is an urgent need to develop a more efficient and non-invasive detection method for risk stratification and triage of high-risk HPV-infected individuals, reducing the referral rate for colposcopy and other invasive procedures. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a biomarker for assessing the risk of cervical cancer in high-risk HPV-infected individuals, a kit for assessing the risk of cervical cancer in high-risk HPV-infected individuals, and the application of EVX2 gene methylation in assessing the risk of cervical cancer in high-risk HPV-infected individuals.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a biomarker for assessing the risk of cervical cancer in individuals with high-risk HPV infection, wherein the biomarker is a methylation site of the EVX2 gene, and the nucleotide sequence of the EVX2 gene is shown in SEQ ID NO: 1.

[0007] In a preferred embodiment of the biomarker described in this invention, the methylation site is at least one of chr2_176948693, chr2_176948699, chr2_176948728, and chr2_176948759.

[0008] Secondly, the present invention provides a kit for assessing the risk of cervical cancer in individuals with high-risk HPV infection, comprising a formulation for detecting the methylation level of the biomarkers described in the first aspect.

[0009] As a preferred embodiment of the kit described in this invention, the formulation includes reagents for detecting the methylation level of the biomarker based on gene chip detection or PCR detection; the reagents are primers and / or probes that specifically bind to the methylation sites of the biomarker.

[0010] As a further preferred embodiment of the kit described in this invention, the nucleotide sequences of the primers are shown in SEQ ID NO: 2 and / or SEQ ID NO: 3.

[0011] Thirdly, this invention applies the detection of methylation levels of the EVX2 gene to assess the risk of cervical cancer in individuals with high-risk HPV infection.

[0012] Fourthly, this invention applies the methylation of the EVX2 gene in the preparation of products for assessing the risk of cervical cancer in individuals with high-risk HPV infection.

[0013] In a preferred embodiment of the application described in this invention, the methylation site is at least one of chr2_176948693, chr2_176948699, chr2_176948728, and chr2_176948759.

[0014] In a preferred embodiment of the application described in this invention, the detection method is matrix-assisted laser desorption / ionization tandem time-of-flight mass spectrometry (MALS). MALS enables high-resolution, high-throughput quantitative detection of multiple CpG sites with high sensitivity. The methylation level of a single CpG site can be determined by single nucleotide amplification without any normalization.

[0015] As a preferred embodiment of the application described in this invention, the cervical cancer includes cervical squamous cell carcinoma, cervical adenocarcinoma, high-grade cervical intraepithelial neoplasia, and low-grade cervical intraepithelial neoplasia.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention identifies a multi-site, low-input, and highly accurate single-gene methylation biomarker that can be used to assess the risk of cervical cancer in high-risk HPV-infected individuals. It can be used for screening and triage of cervical HSIL and cervical cancer, improving management strategies and facilitating early intervention in high-risk HPV-infected populations. In particular, the MALDI-TOF-MS-based detection method for single EVX2 gene methylation significantly improves detection sensitivity compared to cytological examination and HPV 16 / 18 testing, effectively distinguishing normal squamous epithelium from HSIL and higher-level cervical lesions. This allows for non-invasive stratification and triage of cancer risk in hr-HPV-infected individuals. Attached Figure Description

[0017] Figure 1 In Figure A, after excluding interference from leukocyte DNA methylation, there are 679 differentially methylated sites between normal cervical tissue and cervical cancer; in Figure B, LASSO analysis shows that the AUC of the four methylation markers can reach a maximum of 0.955, which can best distinguish cervical cancer from normal squamous epithelium; in Figure C, in the GSE dataset, the four methylation markers can distinguish effective cervical cancer from normal tissue.

[0018] Figure 2 A shows that IHC analysis revealed high expression of EVX2 protein in normal squamous epithelium, but significantly decreased expression in HSIL and cervical cancer. B shows that quantitative analysis indicated that EVX2 expression in normal tissues was significantly higher than that in HSIL and squamous cell carcinoma, with higher expression in HSIL. C shows that analysis based on the TCGA database confirmed that EVX2 expression in normal tissues was significantly higher than that in cervical cancer. D shows that ROC curve analysis indicated that EVX2 has a strong ability to distinguish between cervical cancer and normal tissues.

[0019] Figure 3 In Figure A, EVX2 CpG sites showed significant differences in methylation detection between cervical cancer and normal tissues. In Figure B, a cluster heatmap of methylation detection in 104 hr-HPV infected individuals showed that four selected EVX2 CpG sites were significantly higher in the LSIL / HSIL and cervical cancer groups than in the normal group.

[0020] Figure 4 In the training, validation, and additional validation cohorts, the AUC areas under the curve for EVX2 methylation were 0.948 (0.951-1), 0.909 (0.802-1), and 0.933 (0.825-1), respectively. In the additional validation cohort, DF showed that when applied to the diagnosis of LSIL, HSIL, cervical cancer patients, and all cervical lesions, the EVX2 AUCs compared to the healthy control group were 0.948, 0.958, and 0.954, respectively. G and H indicated that the cancer risk in the SIL and CC groups was significantly higher than in the normal population in both the validation and additional validation cohorts. I represents the comparison of the model's risk score between the healthy control group (normal) and patients with LSIL, HSIL, and CC. n =126, pairing t test);*** P <0.001.

[0021] Figure 5In Figure A, the areas under the AUC curves for EVX2 methylation, LCT, and HPV16 / 18 in detecting HSIL and cervical cancer are 0.95, 0.85, and 0.57, respectively; Figure B shows the sensitivity and specificity of EVX2 methylation in detecting all cervical lesions compared to LCT and HPV16 / 18; Figure C shows the sensitivity and specificity of EVX2 methylation in detecting LSIL; and Figure D shows the sensitivity and specificity of EVX2 methylation in detecting HSIL and cervical cancer. Detailed Implementation

[0022] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0023] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0024] Example 1: Anchoring Differential Methylation Markers Based on Database Analysis We accessed the GDC database (https: / / portal.gdc.cancer.gov / ) of The Cancer Genome Atlas (TGGA) and downloaded cervical cancer DNA methylation data, containing 307 cervical cancer patients. We also downloaded DNA methylation data for normal tissue, cervical cancer, and white blood cells (WBCs) from the GEO (Gene Expression Omnibu) database (https: / / www.ncbi.nlm.nih.gov / geo / ). The GSE211668 dataset contained 131 cases (102 cervical cancer cases and 29 normal cervical cases), and the GSE48684 dataset contained 656 WBCs. To identify cervical cancer-specific biomarkers, we first compared the methylation data of 102 squamous cell carcinoma tissues and 29 normal cervical epithelial tissues (GSE211668). Next, methylation data from 307 cervical SCC tissue samples from TCGA and 656 normal leukocyte samples from GSE48684 were compared to exclude interference from leukocyte methylation. t The test was used for statistical analysis, in order to P≤0.01 and mean difference >0.35 were used as preliminary criteria for biomarker selection. The Person correlation coefficient (r²) between the β values ​​of any two CpG sites located close to each other (within a 200 bp range) was calculated, and r² > 0.5 was used as the threshold for identifying methylation-related blocks (MCBs). LASSO and random forest methods were used for variable selection and hazard model construction. ROC curves were generated using the pROC R package (version 1.15.3) to evaluate the performance of EVX2 methylation. Heatmaps were plotted using the Complex Heatmap package (version 2.14.0). Statistical significance levels were set. p Value < 0.05.

[0025] Differential methylation analysis was performed on 102 cervical cancer tissues and 29 normal tissues from the GEO dataset. To eliminate the influence of leukocyte DNA in cervical mucus, DNA methylation profiles were further analyzed from 307 cervical cancer tissues from TCGA and 656 normal blood samples from the GSE dataset (GSE48684). The intersection of these two sets of differentially expressed data was taken to exclude WBC interference, ultimately yielding 679 common differentially expressed sites. Figure 1 A) These data were ultimately assembled into 31 methylation-correlated blocks (MCBs) using the Person correlation method (with r² = 0.5 as the cutoff value). Subsequently, Least absolute shrinkage and selection operator (LASSO) regression analysis was applied for variable selection. Ultimately, the combination of four methylation markers—ZNF135, EVX2, MARCHF11, and UBD—was determined to be the most effective in distinguishing cervical cancer from normal squamous epithelium, achieving the largest area under the AUC curve (0.955). Figure 1 A). The GSE dataset shows high and stable methylation levels in cervical cancer tissues, while methylation levels are extremely low in normal tissues. Therefore, these four methylation markers can be used for the diagnosis of cervical cancer. Figure 1 C).

[0026] Example 2: Expression and biological significance of EVX2 and ZNF135 in cervical cancer tissues 1. Materials and Experiments (1) Collection of tissue and cervical exfoliated cell samples Fifteen cervical squamous cell carcinoma specimens and five normal cervical formalin-fixed and paraffin-embedded (FFPE) tissue specimens were selected for DNA methylation detection. The specimens were obtained from the Pathology Department of the Southern Theater Command General Hospital. Tissue blocks with a tumor tissue content of more than 30% were selected, sectioned to a thickness of 3–4 μm, and 6–8 sections were prepared. The sections were then mounted on clean, treated, non-detachable glass slides. The tumor tissue was circled according to the location and extent of the tumor on the HE section for DNA extraction and scraping.

[0027] Cervical exfoliated cell collection requirements: Cervical exfoliated epithelial cells were collected using a special brush and stored in DNA cell preservation solution at 4°C for later use. A total of 467 cervical exfoliated cell specimens were collected from women infected with high-risk human papillomavirus (HR-HPV). Among them, 104 underwent thin-layer liquid-based cytology screening and cervical tissue biopsy, with definitive histopathological results. These included 3 cases of cervical squamous cell carcinoma (SCC), 2 cases of cervical adenocarcinoma (ECA), 17 cases of high-grade cervical intraepithelial neoplasia (HSIL), 26 cases of low-grade cervical intraepithelial neoplasia (LSIL), and 56 patients with normal cervical mucosa. The patients' ages ranged from 22 to 69 years, with a mean age of 45 years. Cervical exfoliated cells were also collected from 34 high-risk HR-HPV infected individuals as an additional validation set; 22 of these patients underwent liquid-based thin-layer cytology screening and / or tissue biopsy. Clinical data of 126 patients are shown in Table 1.

[0028] (2) DNA extraction and HPV-DNA genotyping Genomic DNA was extracted using a Tellgen DNA extraction kit. One DNA sample was used for HPV-DNA genotyping, while the other sample underwent bisulfite conversion using the TANTICA EZ-96 DNA Methylation Gold Kit according to the manufacturer's instructions. After bisulfite treatment, methylated cytosine (C) at CpG sites remained unchanged, while unmethylated cytosine (C) was converted to uracil (U). HPV DNA genotyping was performed using the Tellgen HPV 27 genotyping kit, which can simultaneously detect 27 human papillomavirus types, including 17 high-risk types (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68, 26, 53, 82) and 10 low-risk types (6, 11, 40, 42, 43, 44, 55, 61, 81, 83).

[0029] Table 1. Clinicopathological data of 126 qualified cervical exfoliated cell samples *Including 3 cases of cervical adenocarcinoma.

[0030] (3) Immunohistochemical examination ThermoFisher rabbit anti-human polyclonal antibodies EVX2 and ZNF135 (final concentration 1:150) were used. FFPE specimens from 58 cases of normal cervical epithelium, 30 cases of high-grade intraepithelial neoplasia, and 55 cases of cervical cancer were cut into 4 μm thick sections. Immunohistochemical staining was performed on a Dako automated immunohistochemistry instrument according to the manufacturer's instructions, including endogenous peroxidase blocking, primary antibody addition, washing, addition of anti-rabbit IgG (Dako), colorimetric detection, counterstaining, dehydration, and clearing. Negative control sections were incubated with PBS instead of the primary antibody. Results were independently evaluated by two senior pathologists with more than 10 years of experience. EVX2 immunohistochemical staining localized to the cell nucleus, while ZNF135 localized to the cytoplasm. The staining quantification criteria are as follows: <10% stained cells are rated as negative (-, 0); 10-49% stained cells are rated as (+, 1); 50-74% stained cells are rated as (++, 2); 75-100% stained cells are rated as (+++, 3).

[0031] (4) Detection by matrix-assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF-MS) The EVX2 gene (Even-Skipped Homeobox 2) is located on human chromosome 2q31.1 and encodes a transcription factor containing approximately 340 amino acids. Its structure includes a highly conserved homeobox domain.

[0032] EVX2 bisulfite-specific primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. A 192 bp amplification region (target sequence: GACTGGTCAAAATGACCCATACATCCTTCCGATCCCGAGATGTCATTCATCAAAAAGTAGCGCCCGCTCGTCATTAAGGTACGAATGACGCTGTTCGAATAATCATTTATTGTAACAGGTTTATAAGCAAATAAATACACCCTCCTGTCAGTGGGTAATGAAGGCAGCTTCAGAGCAGACAAATAGATCCAG) was designed, covering seven CpG sites in the EVX2 amplification region (176948693-176978459). No known single nucleotide polymorphisms were found at the primer binding region or CpG sites.

[0033] The primer sequences are: F: aggaagagagTTGTTTGTTTTGAAGTTGTTTTTAT; R: cagtaatacgactcactatagggagaaggctAACTAATCAAAATAACCCATACATCCTT.

[0034] After amplification of the target sequence by polymerase chain reaction (PCR), the DNA methylation level was quantitatively determined by MALDI-TOF mass spectrometry (Agena Bioscience, San Diego, CA, USA). The specific procedures were performed according to the detailed instructions described by Lei et al. (LEI S, LI L, YANGX, et al. The association between RAPSN methylation in peripheral blood and breast cancer in the Chinese population[J]. Journal of Human Genetics, 2021, 66(11): 1069-1078.). In short, after dephosphorylation of the amplicons with alkaline phosphatase (SAP), in vitro transcription was performed using T7 polymerase according to the Agena EpiTYPERs instructions, followed by RNase A digestion. After resin purification, the digested products were added to a SpectroCHIP chip using a MassARRAY nanometer spotter. The chip was read using a MassARRAY analyzer; data acquisition was performed using SpectroACQUIRE v3.3.1.3 software, and data analysis was performed using EpiTYPER v1.3 software.

[0035] 2. Experimental Results (1) Expression and biological significance of EVX2 and ZNF135 in cervical cancer tissues Database searches further revealed that EVX2 and ZNF135 are tumor suppressor genes regulated by methylation and functioning in tumors. Therefore, immunohistochemical staining was performed on paraffin-embedded tissue samples from 58 normal cervical epithelial cells, 30 high-grade intraepithelial neoplasia cases, and 55 cervical cancer cases to detect the expression of EVX2 and ZNF135 proteins. The results showed that EVX2 was highly expressed in normal cervical epithelium (55 / 58), but its expression was significantly reduced in HSIL (18 / 30) and cervical squamous cell carcinoma (17 / 55). Figure 2 A). Statistical analysis showed that EVX2 expression in normal cervical tissue was significantly higher than that in HSIL and cervical squamous cell carcinoma (HSIL). P <0.001, Table 2), HSIL expression was higher than in cervical cancer ( P <0.01, Table 2, Figure 2B). EVX2 expression was not significantly correlated with patient age (≤40 years vs. >40 years), tumor differentiation grade (high / moderate vs. low), clinical stage (I / II vs. III), tumor size (≤2 cm vs. >2 cm), hr-HPV type (HPV16 / 18 vs. other types), depth of invasion (≤1 / 2 vs. >1 / 2), or presence of lymph node metastasis. However, ZNF135 showed high expression in normal cervical epithelium, HSIL, and cervical squamous cell carcinoma, with no significant difference in expression levels among these groups. P >0.05).

[0036] Further analysis based on TCGA data confirmed that the expression level of EVX2 in cervical squamous cell carcinoma was significantly lower than that in adjacent normal tissue, suggesting that it may play a tumor suppressor gene role. Figure 2 C). ROC curve analysis also showed that EVX2 had a very strong ability to distinguish between tumors and normal tissues (AUC=0.909). Figure 2 D), which has high diagnostic value. Therefore, the EVX2 gene was ultimately targeted for further methylation detection.

[0037] Table 2 Immunohistochemical expression of EVX2 in normal tissues, HSIL, and cervical cancer (2) Association between EVX2 methylation and cervical cancer First, time-of-flight mass spectrometry (TOF-MS) was used to detect the methylation levels of seven sites (EVX2_CpG_1, EVX2_CpG_2, EVX2_CpG_3, EVX2_CpG5, EVX2_CpG_6, EVX2_CpG_7, and EVX2_CpG_8) in paraffin-embedded samples from 5 normal cervical epithelial cells and 15 cervical squamous cell carcinoma cells. A t-test was used to compare the differences in their distribution between normal squamous epithelium and cervical cancer. The results showed that the differences in EVX2_CpG_1, EVX2_CpG_2, EVX2_CpG_5, and EVX2_CpG_7 between the two groups were statistically significant. p <0.05), corresponding chromosomal loci are 176948693, 176948699, 176948728 and 176948759 (based on the sequence of human reference genome Hg19). These four loci were ultimately selected to establish the diagnostic efficacy of the random forest model for non-invasive carcinogenesis risk stratification of cervical exfoliated cells in hr-HPV infected individuals. Figure 3 A).

[0038] A heatmap of methylation clustering in 104 hr-HPV-infected individuals showed that the methylation levels of EVX2_CpG_1, EVX2_CpG_2, EVX2_CpG_5, and EVX2_CpG_7 in LSIL, HSIL, and cervical cancer were significantly higher than in the normal epithelial group. These results suggest that EVX2 methylation detection may be used for cancer risk triage in hr-HPV-infected individuals (the optimal cutoff value for differentiating normal from non-LSIL, HSIL, and cervical cancer is 0.55). Significant differences in EVX2 methylation sites were also observed between the positive and negative cytology screening groups, but no significant differences were found between highly pathogenic HPV types 16 / 18 and other HPV types, or between different age groups (Age ≥ 40 vs < 40 years). Figure 3 B).

[0039] (3) Construction and validation of a non-invasive diagnostic model based on EVX2 methylation for cancer risk stratification in hr-HPV infected individuals One hundred and four patients with hr-HPV infection were randomly divided into training and validation sets in a 7:3 ratio. A random forest model was used to model the infection based on the four methylation sites of EVX2 (EVX2_CpG_1, EVX2_CpG_2, EVX2_CpG_5, and EVX2_CpG_7). Patients were further divided into high-risk and low-risk groups based on the probability score calculated by the model (optimal cutoff value of 0.55). The optimal cutoff value was determined using the Youden index based on the ROC model. The results showed that EVX2 methylation distinguished normal cervix from lesions (including LSIL, HSIL, and CC) with AUC areas of 0.978 and 0.909, respectively, in the training and validation sets. Figure 4 The sensitivity and specificity of the assay in the training set were 96.67% and 94.87%, respectively; and in the validation set, they were 93.33% and 82.35%, respectively. In an additional validation set containing 22 individuals with hr-HPV infection, the area under the AUC curve distinguishing between cervical cancer (CC) and normal individuals without cervical lesions was 0.993 (AB). Figure 4 C), achieving a sensitivity of 90%. Subsequently, the efficacy of EVX2 methylation in distinguishing LSIL, HSIL, and CC patients (collectively referred to as HSIL+ patients), as well as in all cervical lesion populations and healthy controls, was evaluated, with AUC areas of 0.948, 0.958, and 0.954, respectively. Figure 4 DF). Risk scores calculated based on EVX2 methylation biomarkers showed that both the SIL and CC groups were significantly higher in the validation cohort and additional validation cohort than in the normal population. Figure 4 G,H). Furthermore, the risk scores of patients with LSIL, HSIL, and CC were significantly higher than those of HPV-infected individuals without abnormal cervical changes. Figure 4I). These data suggest that the EVX2 methylation model can serve as a reliable, non-invasive method for assessing the risk of cancer in individuals with high-risk HPV infection, facilitating further stratification and triage.

[0040] (4) Efficacy of EVX2 methylation assay in cervical HSIL and cervical cancer compared with cytology and HPV16 / 18 Liquid-based cytology (LCT) and high-risk HPV testing are among the most commonly used methods for cervical cancer screening, and HPV16 / 18 is currently recognized as a highly tumorigenic subtype. This study further compared the performance of EVX2 methylation with LCT and HPV16 / 18 in cervical cancer screening. The results showed that EVX2 methylation outperformed LCT and HPV16 / 18 testing in cervical cancer screening, with AUC areas of 0.95, 0.57, and 0.85, respectively. Figure 5 A). In a meta-analysis of the 126 included cases, the overall sensitivity of EVX2 methylation detection was 93.22%, and the specificity was 92.65% (A). Figure 5 B). Notably, in LSIL patients, EVX2 methylation showed superior sensitivity compared to LCT screening and HPV16 / 18 testing (88.4% vs 80% vs 23.08%). Figure 5 C). In patients with HSIL and cervical cancer, the sensitivity of EVX2 methylation was significantly higher than that of cytology and HPV16 / 18 testing (96.97% vs 57.14% vs 37.5%). Figure 5 D). The above indicates that EVX2 methylation detection has higher sensitivity and specificity than LCT and high-carcinogenic HPV 16 / 18 subtype detection in patients with high-grade lesions and cervical cancer.

[0041] To clarify whether EVX2 gene methylation can be used for cancer risk stratification in individuals infected with hr-HPV, this invention first analyzed the EVX2 methylation status of cervical cancer and normal mucosal tissue samples in paraffin-embedded specimens. The results showed that EVX2 methylation can effectively distinguish between cervical cancer and normal tissue. Further modeling based on a random forest model demonstrated that the diagnostic model based on EVX2 gene methylation exhibited high performance in distinguishing between normal individuals and precancerous lesions and cervical cancer. In the validation set, the overall sensitivity for diagnosing precancerous lesions and cervical cancer was 91%. Compared with currently commonly used clinical methods such as liquid-based cytology and detection of highly carcinogenic HPV16 / 18, EVX2 gene methylation showed significant advantages in detecting all precancerous lesions and cervical cancer, with sensitivities of 93.62%, 67.93%, and 31.03%, and specificities of 92.65%, 72.06%, and 92.65%, respectively. For patients with HSIL and cervical cancer, EVX2 gene methylation showed a diagnostic sensitivity of 96.67% (compared to 57.14% for cytology and 37.5% for HPV16 / 18 testing), and a specificity of 94.04% (compared to 72.06% for cytology and 92.65% for HPV16 / 18 testing). The sensitivity of EVX2 in detecting LSIL was 88.4%, while the sensitivities for cytology and HPV16 / 18 were 80% and 23.08%, respectively. Compared to LSIL detection, EVX2 gene methylation demonstrated higher performance in diagnosing HSIL and cervical cancer.

[0042] Therefore, EVX2 methylation is particularly advantageous in screening individuals at risk of cancerous transformation among those infected with hr-HPV. Furthermore, cervical glandular abnormalities pose a significant challenge in cytological screening, often resulting in missed diagnoses. In the examples, all three cases of cervical adenocarcinoma were accurately identified through EVX2 methylation detection, suggesting that EVX2 gene methylation holds promise as a solution for diagnosing cervical glandular epithelial lesions. These results demonstrate that MALDI-TOF-MS-based EVX2 gene methylation detection holds promise for clinical decision-making in various patient scenarios and contexts, potentially alleviating the psychological burden and the burden of repeated colposcopy for patients.

[0043] In summary, this invention develops a multi-site, low-input, and highly accurate single-gene methylation biomarker for screening and triage of cervical HSIL and cervical cancer, improving management strategies and facilitating early intervention in high-risk HPV-infected populations.

[0044] In summary, EVX2 DNA methylation detection can effectively distinguish normal squamous epithelium from precancerous cervical lesions and cervical cancer, thus non-invasively stratifying and triaging the cancer risk in individuals infected with hr-HPV. Furthermore, the MALDI-TOF mass spectrometry-based detection method shows significantly improved sensitivity compared to cytological examination and HPV 16 / 18 testing, especially in detecting HSIL+ cervical lesions. This assay is highly sensitive, rapid, economical, and easily applicable in clinical practice.

[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A biomarker for assessing the risk of cervical cancer in individuals with high-risk HPV infection, characterized in that, The biomarker is the methylation site of the EVX2 gene, and the nucleotide sequence of the EVX2 gene is shown in SEQ ID NO:

1.

2. The biomarker according to claim 1, characterized in that, The methylation site is at least one of chr2_176948693, chr2_176948699, chr2_176948728 and chr2_176948759.

3. A kit for assessing the risk of cervical cancer in individuals with high-risk HPV infection, characterized in that, Including formulations for detecting the methylation level of the biomarker as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The formulation includes reagents for detecting the methylation level of the biomarker based on gene chip detection or PCR detection; the reagents are primers and / or probes that specifically bind to the methylation sites of the biomarker.

5. The reagent kit according to claim 4, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO: 2 and / or SEQ ID NO:

3.

6. Application of detecting methylation levels of the EVX2 gene in assessing the risk of cervical cancer in high-risk HPV-infected individuals.

7. Application of EVX2 gene methylation in the preparation of products for assessing the risk of cervical cancer in individuals with high-risk HPV infection.

8. The application according to claim 6 or 7, characterized in that, The methylation site is at least one of chr2_176948693, chr2_176948699, chr2_176948728, and chr2_176948759.

9. The application according to claim 6, characterized in that, The detection method is matrix-assisted laser desorption / ionization tandem time-of-flight mass spectrometry.

10. The application according to claim 6 or 7, characterized in that, The cervical cancers mentioned include cervical squamous cell carcinoma, cervical adenocarcinoma, high-grade cervical intraepithelial neoplasia, and low-grade cervical intraepithelial neoplasia.

Images