Nucleic acid products, kits and methods for detecting multiple pathogens

Abstract

The application discloses nucleic acid products, kits and methods for detecting multiple pathogens. The nucleic acid products comprise primer pairs and probes with nucleotide sequences shown in SEQ ID NO:1-24. The application designs specific primers and probes for the conserved regions of eight respiratory tract pathogens, realizes the synchronous detection of multiple pathogens through one-tube eight-color fluorescent PCR, freeze-drying and ultrasonic direct extension technology, significantly reduces the experimental operation steps, shortens the detection time, and reduces the complexity of result interpretation. In addition, the anti-interference ability is strong, and the sensitivity is high.

Description

Technical Field

[0001] This application relates to the field of biodetection technology, specifically to nucleic acid products, kits, and methods for detecting multiple pathogens. Background Technology

[0002] Respiratory tract infections refer to pathogens infecting the human respiratory system, including the nasal cavity, pharynx, trachea, and bronchi. The respiratory tract is divided into the upper and lower respiratory tracts. Patients with upper respiratory tract infections may experience symptoms such as cough, runny nose, sneezing, and nasal congestion; patients with lower respiratory tract infections may experience symptoms such as fever, cough, shortness of breath, sputum production, and palpitations. Specimen databases show that approximately 17.5% of respiratory specimens were positive for Legionella pneumophila (LP), Escherichia coli (E. coli), Enterobacter cloacae (EC), Serratia marcescens (SMar), Klebsiella pneumoniae (KO) / Klebsiella pneumoniae (KA), Proteus spp. (PS), and Stenotrophomonas maltophilia (SMA), indicating that these eight bacteria are prevalent in lower respiratory tract infections and pose a significant threat to patient health. Therefore, a rapid, efficient, and low-cost detection method for multiple respiratory pathogens is particularly important in clinical applications.

[0003] Multiplex PCR-based pathogen detection for lower respiratory tract pathogens has long relied on culture (sputum / blood culture), antigen detection (such as rapid influenza tests), or single-target PCR. This approach suffers from drawbacks such as long processing times (culture takes 2-5 days), low sensitivity (e.g., cultures are easily affected by antibiotics), and narrow coverage. Furthermore, the pathogens are complex (e.g., bacterial + viral co-infection rates are as high as 20-30%), and traditional empirical antibiotic treatment easily leads to drug resistance. Multiplex nucleic acid detection can rapidly identify pathogens, guiding targeted drug therapy (e.g., differentiating bacterial pneumonia from influenza, reducing antibiotic overuse), and boasts high sensitivity and specificity, reducing the time from several days to several hours, thus improving prognosis.

[0004] Currently, multiplex nucleic acid detection technologies for respiratory pathogens have seen some development. For example, CN115992270A describes a primer-probe combination for detecting 14 respiratory pathogens, including Staphylococcus aureus, Streptococcus pneumoniae, Moraxella catarrhalis, Legionella, Escherichia coli, Enterobacter cloacae, Stenotrophomonas maltophilia, Enterococcus, Serratia spp., Staphylococcus epidermidis, Acinetobacter baumannii, Haemophilus influenzae, Pseudomonas aeruginosa, and Klebsiella pneumoniae. However, its limitation is that a single system can only detect 5 respiratory pathogens, and it cannot detect combinations of more than 5 pathogens in one tube.

[0005] On the other hand, CN119242864A describes a composition for detecting respiratory infection-related pathogens, comprising upstream and downstream primers and probes for detecting coronaviruses, Bordetella pertussis, Group A Streptococcus, parainfluenza virus, Streptococcus pneumoniae, Haemophilus influenzae, and Chlamydia pneumoniae. Although this method can detect seven common respiratory infection pathogens in a single tube, it exhibits poor resistance to interference from meropenem, imipenem, cefoperazone / sulbactam, moxifloxacin, amikacin, linezolid, vancomycin, sodium chloride, anhydrous ethanol, EDTA, human whole blood, and purified mucin. Furthermore, it shows cross-reactivity with other common pathogens exhibiting similar infection symptoms, including Neisseria meningitidis, Aspergillus flavus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Summary of the Invention

[0006] Therefore, it is necessary to provide nucleic acid products, kits, and methods for detecting multiple pathogens.

[0007] The first aspect of this application provides a nucleic acid product for detecting multiple pathogens, comprising the following primer and probe set:

[0008] Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for primer pairs and probes for detecting Proteus genus;

[0009] Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae;

[0010] Primer and probe set 3: The nucleotide sequences are shown in SEQ ID NO: 7~9 for the primer pairs and probes for detecting Klebsiella acidogenic bacteria;

[0011] Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12;

[0012] Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia;

[0013] Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens;

[0014] Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and,

[0015] Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

[0016] In some embodiments, a primer-probe set for detecting the RNase P gene is also included, comprising primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 25-27, respectively.

[0017] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0018] In some embodiments, the fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405.

[0019] In some embodiments, the quenching group includes one or more of BHQ1, BHQ2, and TAMRA.

[0020] A second aspect of this application provides a kit for detecting multiple pathogens, which includes the nucleic acid product described in the first aspect of this application.

[0021] In some implementations, one or more of nucleic acid extraction reagents and PCR amplification reagents are also included.

[0022] In some embodiments, the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0023] In some embodiments, the kit further includes a lyophilization protectant, and the nucleic acid product and the PCR amplification reagent are packaged in the form of a lyophilized reagent.

[0024] In some implementations, one or more of positive and negative control samples are also included.

[0025] A third aspect of this application provides a lyophilized PCR premix, comprising the nucleic acid product, lyophilization protectant, and PCR amplification reagent described in the first aspect of this application, wherein the PCR amplification reagent comprises PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0026] The fourth aspect of this application provides a method for nucleic acid amplification for non-diagnostic purposes, comprising the following steps:

[0027] The sample to be tested was mixed with liquefied sputum and subjected to ultrasonic treatment to obtain a nucleic acid solution; and

[0028] The nucleic acid solution was mixed with PCR amplification solution for amplification.

[0029] The sample to be tested includes sputum, and the PCR amplification solution includes the nucleic acid product for detecting multiple pathogens as described in the first aspect of this application.

[0030] In some embodiments, the conditions for the ultrasonic treatment include: an ultrasonic frequency of 10 kHz to 80 kHz and an ultrasonic time of 100 s to 150 s.

[0031] The fifth aspect of this application provides a method for detecting multiple pathogens for non-diagnostic purposes, the method comprising the following operations in a closed reaction tube: pretreating the sample to be tested in sputum liquefaction solution, and quantitatively mixing the resulting pretreatment product with a lyophilized PCR premix as defined in the third aspect of this application or a nucleic acid product as described in the first aspect of this application to achieve nucleic acid detection of the sample to be tested.

[0032] In some embodiments, in the mixed reaction system, the working concentration of each primer is 200 nM to 400 nM, and the working concentration of each probe is 100 nM to 200 nM.

[0033] In some implementations, the sample to be tested includes sputum.

[0034] In some embodiments, the pretreatment includes ultrasonic treatment, wherein the conditions for ultrasonic treatment include: ultrasonic frequency of 10kHz to 80kHz and ultrasonic time of 100s to 150s.

[0035] This application's implementation method designs specific primers and probes for the conserved regions of eight respiratory pathogens. Using one-tube eight-color fluorescent PCR, lyophilization, and ultrasonic direct amplification techniques, it achieves simultaneous detection of multiple pathogens. It exhibits strong anti-interference ability against meropenem, imipenem, cefoperazone / sulbactam, moxifloxacin, amikacin, linezolid, vancomycin, sodium chloride, anhydrous ethanol, EDTA, human whole blood, and purified mucin. Furthermore, it does not exhibit cross-reactivity with other common pathogens with similar infection symptoms, including Neisseria meningitidis, Aspergillus flavus, Aspergillus terreus, Candida glabrata, and Candida tropicalis. Attached Figure Description

[0036] To more clearly illustrate the technical solutions in the embodiments and examples of this application, and to more completely understand this application and its beneficial effects, the accompanying drawings used in the description of the embodiments or examples will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of this application. Those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0037] Figure 1 The detection results of the magnetic bead method used in one embodiment of this application;

[0038] Figure 2 The detection results are obtained using the direct ultrasonic amplification method in one embodiment of this application;

[0039] Figure 3 This is the sensitivity detection result in one embodiment of this application;

[0040] Figure 4 The detection results of ultrasonic direct amplification using other primers and probes in one embodiment of this application;

[0041] Figure 5 This is an example of using other primers and probes to detect interference in one embodiment of this application. Detailed Implementation

[0042] To facilitate understanding of this application, a more complete description will be provided below with reference to the accompanying drawings. Preferred embodiments of this application are shown in the drawings. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of this application.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0044] In this application, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or embodiments that achieve better results, and should be understood not to limit the scope of protection of this application.

[0045] The terms “having,” “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, not excluding additional, uncited members or features. Members or features include, for example, materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions under which actions occur, timing, states, etc.

[0046] In this application, the technical features or solutions described in open-ended language include both closed-ended technical features or solutions consisting of the listed contents and open-ended technical features or solutions that include the listed contents.

[0047] In this application, if the unit of a data range is only followed by the right endpoint, it means that the units of the left and right endpoints are the same.

[0048] In this application, where the method flow involves multiple steps, unless otherwise explicitly stated herein, there is no strict order restriction on the execution of these steps; they can be executed in any order other than those described. Moreover, any step may include multiple sub-steps or multiple stages, which are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or simultaneously with other steps or parts of the sub-steps or stages of other steps.

[0049] In this application, the exemplary descriptions such as "in some implementations (or embodiments)" and "in one implementation (or embodiment)" may cover, but are not limited to, the following meanings: these solutions can be combined with other solutions in a suitable manner to form new technical solutions.

[0050] In this application, the terms "first aspect," "second aspect," "third aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0051] In this application, when numerical intervals (i.e., numerical ranges) are involved, unless otherwise specified, the distribution of selectable numerical values ​​within the numerical interval is considered continuous, and includes the two endpoints of the numerical interval (i.e., the minimum and maximum values), as well as every numerical value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that numerical interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints, which is equivalent to directly listing every integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all subranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, percentage, ratio, etc. The term "numerical interval" can be broadly included to include numerical interval types such as percentage intervals, ratio intervals, and proportion intervals.

[0052] Currently, respiratory multiplex PCR detection technology significantly improves detection throughput and speed by designing multiple sets of specific primers and adding specific primers and probes targeting multiple pathogens to a single reaction tube, enabling the simultaneous detection of multiple pathogens. It is primarily based on TaqMan probes labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. When the probe is intact, fluorescence is quenched due to the FRET effect; during PCR amplification, Taq enzyme exerts its 5'→3' exonuclease activity, hydrolyzing the probe and releasing a fluorescent signal, thus achieving simultaneous detection of multiple targets in a single amplification. Respiratory bacterial multiplex nucleic acid detection technology is in a rapid development phase. This technology is evolving towards faster, more accurate, and more integrated methods, and is expected to become the preferred solution for respiratory infection diagnosis. Based on current technological bottlenecks and clinical needs, future technological evolution will include single-tube multiplex detection, reagent lyophilization, and reagent-compatible direct amplification methods. For example:

[0053] Patent CN110273026A provides a multiplex detection kit and method for respiratory infections, which can be used to detect influenza A virus, influenza B virus, respiratory syncytial virus, adenovirus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Streptococcus pneumoniae, Legionella pneumophila, and Haemophilus influenzae. Its advantages include the use of MGB probes, which can improve the sensitivity and specificity of the kit, and a short detection cycle. It can achieve rapid detection and analysis of multiple respiratory pathogens in samples such as nasopharyngeal swabs, bronchoalveolar lavage fluid, and sputum. Its limitations are that the inventor divides the nine respiratory pathogens into three systems for multiplex fluorescent PCR amplification. A single system can only detect three respiratory pathogens, and it cannot detect combinations of more than three pathogens in one tube. The transportation cost is high, and the manual preparation is cumbersome.

[0054] Patent CN119351588A provides a multiplex detection kit and method for respiratory infections, which can be used to detect 96 pathogenic microorganisms, including Staphylococcus aureus, Streptococcus pneumoniae, drug-resistant bronchopneumoniae, Mycoplasma pneumoniae, Stenotrophomonas maltophilia, Legionella pneumophila, Moraxella catarrhalis, Pseudomonas aeruginosa, Acinetobacter baumannii, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Burkholderia cepacia, Serratia marcescens, and Klebsiella pneumoniae. Multiple fluorescent channels are used to label corresponding detection targets, and the amplification of different targets is monitored by observing changes in fluorescence signals in different channels, thus achieving the detection of 96 pathogenic microorganisms. It boasts high accuracy, strong specificity, high sensitivity, speed, and reliable results. However, its limitations include the ability to detect only three respiratory pathogens per system, the inability to detect combinations of more than three pathogens in a single tube, high transportation costs, cumbersome manual preparation, high transportation costs for liquid reagents, and significant temperature-dependent performance.

[0055] Patent CN106053803A describes a method for combined detection of multiple respiratory pathogens within 15 minutes. It is simple and quick to operate, requires minimal technical expertise from operators, and is suitable for point-of-care testing. However, its drawbacks include limited sensitivity and significant fluctuations in results due to environmental factors such as pH and salt content. Furthermore, it presents certain risks, such as the risk of radiation damage from radioactive materials; insufficient sample processing to completely inactivate degrading enzymes; and a tendency to produce false positives due to cross-reactions. Therefore, due to methodological limitations, this patent's detection method can only serve as a preliminary reference.

[0056] In multi-pathogen nucleic acid co-detection technologies, the reaction system contains a large number of primers and probes, which are prone to dimerization or non-specific binding, leading to non-specific amplification. Although this can be predicted and mitigated to some extent during the design phase, the design difficulty increases significantly under the practical conditions of multiplex detection. The core challenge lies in ensuring the conservation of primer and probe sequences to guarantee detection accuracy while minimizing their mutual interference. This design difficulty often manifests in practical applications as incomplete amplification curves, low amplification efficiency, poor repeatability, and missed detection of some targets, severely impacting the overall detection effect and reliability.

[0057] Based on this, the embodiments of this application provide at least nucleic acid products, kits and methods for detecting multiple pathogens.

[0058] In this application, "direct ultrasonic amplification" refers to treating a sample with ultrasound to lyse pathogens or cells and release nucleic acids. After that, the ultrasound-treated sample can be directly used for subsequent nucleic acid amplification reactions without the need for traditional nucleic acid extraction and purification steps.

[0059] In a first aspect of this application, a nucleic acid product for detecting multiple pathogens is provided, comprising primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 1-24, respectively.

[0060] In some implementations, the nucleic acid product includes the following primer-probe set:

[0061] Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for primer pairs and probes for detecting Proteus genus;

[0062] Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae;

[0063] Primer and probe set 3: The nucleotide sequences are shown in SEQ ID NO: 7~9 for the primer pairs and probes for detecting Klebsiella acidogenic bacteria;

[0064] Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12;

[0065] Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia;

[0066] Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens;

[0067] Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and,

[0068] Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

[0069] In some implementations, the nucleic acid product also includes primer pairs and probes for detecting internal standards.

[0070] In some implementations, the internal label is the human housekeeping gene Rnase P, and the sequences of the primer pairs and probes are shown in SEQ ID NO: 25~27, respectively.

[0071] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0072] In some embodiments, the fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7 and AF405.

[0073] In some embodiments, the quenching group includes one or more of BHQ1, BHQ2, and TAMRA. Exemplarily, the probes described above all use dual quenching groups to enhance the quenching effect and improve detection sensitivity and signal-to-noise ratio.

[0074] It should be noted that in the embodiments of this application, both Klebsiella acidogenic (KO) and Klebsiella gasogenic (KA) probes are synthesized into ROX channels without distinction, thereby enabling the simultaneous detection of 8 respiratory pathogens in one tube.

[0075] In a second aspect of this application, a kit for detecting multiple pathogens is provided, comprising the aforementioned nucleic acid product.

[0076] In some implementations, the kit also includes one or more of nucleic acid extraction reagents and PCR amplification reagents.

[0077] In some embodiments, the PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0078] In some implementations, the kit also includes a lyophilization protectant, and the nucleic acid products and PCR amplification reagents are packaged in the form of lyophilized reagents.

[0079] In some implementations, the kit also includes one or more positive and negative controls.

[0080] In a third aspect of this application, a lyophilized PCR premix is ​​provided, comprising the aforementioned nucleic acid product, lyophilization protectant, and PCR amplification reagent, wherein the PCR amplification reagent comprises PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

[0081] In a fourth aspect of this application, a nucleic acid amplification method is provided, comprising the following steps:

[0082] S100: The sample to be tested is mixed with liquefied sputum and subjected to ultrasonic treatment to obtain a nucleic acid solution; and

[0083] S200: Mix the nucleic acid solution with the PCR amplification solution for amplification;

[0084] The samples to be tested include sputum, and the PCR amplification solution includes the aforementioned nucleic acid products for detecting multiple pathogens.

[0085] In this application, "sputum liquefaction solution" refers to a solution used to process sputum samples, reduce sputum viscosity, and assist in the release of pathogen nucleic acids from sputum samples.

[0086] In some embodiments, in step S100, the conditions for ultrasonic treatment include: an ultrasonic frequency of 10kHz to 80kHz and an ultrasonic time of 100s to 150s. Non-limitingly, the ultrasonic frequency can be, but is not limited to, 10kHz, 20kHz, 30kHz, 40kHz, 50kHz, 60kHz, 70kHz, 80kHz, or any value or range between two of the above values; the ultrasonic time can be, but is not limited to, 100s, 110s, 120s, 130s, 140s, 150s, or any value or range between two of the above values.

[0087] In this application, the nucleic acid amplification method provided above does not require nucleic acid purification. The method uses ultrasonic treatment of the sample, and all operations can be completed and amplification can be performed directly in the PCR reaction tube. The operation is simple and time-saving.

[0088] In a fifth aspect of this application, a method for detecting multiple pathogens is provided, comprising the following operations in a closed reaction tube: placing the sample to be tested in sputum liquefaction solution for pretreatment, and quantitatively mixing the resulting pretreatment product with a lyophilized PCR premix as defined in a third aspect of this application to achieve nucleic acid detection of the sample to be tested.

[0089] In some implementations, the methods described above for detecting multiple pathogens are for non-diagnostic purposes. It is understood that they can be used for public health and food safety monitoring, as well as animal and plant quarantine and healthy aquaculture.

[0090] In some implementations, the above-described methods for detecting multiple pathogens are for diagnostic purposes.

[0091] In some implementations, the sample to be tested includes sputum.

[0092] In some embodiments, the pretreatment includes ultrasonic treatment, and the conditions for ultrasonic treatment include: ultrasonic frequency of 10kHz to 80kHz and ultrasonic time of 100s to 150s.

[0093] In some embodiments, in the mixed reaction system, the working concentration of each primer is 200 nM to 400 nM, and the working concentration of each probe is 100 nM to 200 nM. Non-limitingly, the working concentration of each primer can be, but is not limited to, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, or any value or range between two of the above values; the working concentration of each probe can be, but is not limited to, 100 nM, 150 nM, 200 nM, or any value or range between two of the above values.

[0094] In this application, "working concentration" refers to the actual effective concentration of the indicator or probe in the total reaction system of quantitative real-time PCR.

[0095] In some implementations, the amplification program for the quantitative real-time PCR reaction includes: UDG enzyme reaction at 50°C for 2 min to 4 min; pre-denaturation at 95°C for 30 s to 60 s; denaturation at 95°C for 1 s to 3 s; annealing, extension, and fluorescence detection at 61°C for 8 s; 41 cycles.

[0096] In a fifth aspect of this application, the above-mentioned nucleic acid product is provided for use in the preparation of products for detecting respiratory infections.

[0097] The following are some examples.

[0098] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0099] In the following examples, the measurement parameters of the raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0100] Unless otherwise specified, all test materials used in the following examples are commercially available products.

[0101] Example 1

[0102] In this application, specific primers and probes were designed for the conserved regions of eight respiratory pathogens, as well as primers and probes for the RNase P gene. Using one-tube eight-color fluorescent PCR technology + lyophilization + direct amplification, eight respiratory pathogens can be detected simultaneously in one tube, greatly shortening the detection time.

[0103] I. Primer and probe design

[0104] Gene sequence alignment: Gene sequences (FASTA format files) of Legionella pneumophila (LP), Escherichia coli (E. coli), Enterobacter cloacae (EC), Serratia marcescens (SMar), Klebsiella acidogenic (KO) / Klebsiella aerogenes (KA), Proteus spp. (PS), and Stenotrophomonas maltophilia (SMA) were downloaded from the NCBI nucleic acid database. Online alignment of these gene sequences was performed to identify conserved regions for each bacterial target, which were then used for subsequent primer and probe design. In this application, the following conserved sequences for each bacterium were found using the above method:

[0105] The conserved regions of Legionella pneumophila are as follows:

[0106] TGGTAAGCCAGCAACTTTTCAGGTTTCACAAGTTATCCCAGGATGGACAGAAGCTTTGCAATTGATGCCAGCTGGATCAACTTGGGAAATTTATGTTCCCTCAGGTCTTGCATATGGCCCACGTAGCGTTGGCGGACCTATTGGCCCAAATGAAACTTTAATATTTAAAATTCACTTAATTTCAGTGAAAAAATCATCTTAAGTTTTTTTGAATTAAA (SEQ ID NO: 28)

[0107] The conserved regions of Escherichia coli are as follows:

[0108] GTAGAGCATTACGCTGCGATGGATCCCGGCATAGTTAAAGAAATCATGGAAGTAAGACTGCTTTTTCTTGCCGTTTTCGTCGGTAATCACCATTCCCGGCGGGATAGTCTGCCAGTTCAGTTCGTTGTTCACACAAACGGTGATACGTACACTTTTCCCGGCAATAACATACGGCGTGACATCGGCTTCAAATGGCGTATAGCCGCCCTGATGCTCCATCACTTCCTGATTATTGACCCACACTTTGCCGTAATGAGTGA (SEQ ID NO: 29)

[0109] The conserved regions of Enterobacter cloacae are as follows:

[0110] GTTTCACCGCTCTCTTCCTGCAGCGGCAGGGCGTCGATATCAGCACGCAGTGCCCACATCGGGCCGGGTTTTTCACCCTGTAATACCGCCACCACGCTGTTCTCCAGCGGGCGGCTAATCGTCAGCTCCGGCAGATTCGCCAGTTCACGGGCGATAAAATCTGCGGTCGGCTTTTCCTGAAATGAGAGATCCGGGTTGGCATGAATATG (SEQ ID NO:30)

[0111] The conserved regions of Serratia marcescens are as follows:

[0112] ATTAAGTCGAGCGGTAGCACAAGGGAGCTTGCTCCCTGGGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGTGGTGAGCTTAATACGTTCATCAATTGACGTTACTCGCAGAAGAAGCACCG (SEQ ID NO: 31)

[0113] The conserved regions of Klebsiella oxytoca are as follows:

[0114] GCATGAATTCTGGTTTCAGTTTTCATATCGCTATCGGGATCGCCATACACAAAGTGAACTCTTTCTCCATTCAACACGTAATGTGGCTAAACATGCACACGCTTTTGCTAGAATCTACCGGTGACAACTGCTTAAGTTTTATCACAGCGTATCCTGATTTTTCCCCTTCATGACATGAATAGACCGTGCGCAGGTAAACTGACCTTAACGATCTGGTGAACTAACGTAATGAAATTAAAGAATAAATTACTTCGTCATTTGATTTCGGCTGGGGTAGTGGTCCTGAC (SEQ ID NO: 32)

[0115] The conserved regions of Klebsiella aerogenes are as follows:

[0116] TCTTGCTTATCGGGTGGTGGTATCGATCTCATGCCAGACGTCGTCGCCTCCCCTTACTGCAAGCCTTTAGCGACGCGACGACCCGCAAGCTTTCTGATGATGAACGCCAGGCGGTCGAAAAGTATCTCGATGGCCTCAGCCAGTCGCAAC (SEQ ID NO: 33)

[0117] The conserved regions of Proteus are as follows:

[0118] ATGGCCGATACATCGTTCCACCTGAAAGTTGTCAGCGCTGAAAAGCATTTATATGACGGCGAAGTCAAACATATTCAGGTAACTGGTAGCGAAGGTGAGCTCGGTATTTATCCGCAGCATACCCCGTTATTAACTGCCATAAAACCGGGCATGGTACGTGTCGTAAAAACATCGGGTGAAGAAGAGTTTATCTACCTTTCAGGTGGTATTCTCGAAGTTCAGCCTACAGGCGTCATTGTACTGGCAGATACAGCTATCCGTGGTCGTGATTTGGATGAAGCGAAAGCGTTGGAATCTAAGCGTAAAGCTGAAGAACACATTCAATCCTCTCATGGTGATGTTGATTATGCTCAAGCATCAGCAGAATTAGCCAAAGCGATTGCAAAACTACGTGTAATCGAATTGACTAGACGCTAA (SEQ ID NO: 34)

[0119] The Rnase P gene sequence is as follows:

[0120] GAATTCGGCACGAGGTGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCA TATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTTCACAACTTTGCCAATTGTACAGGGAAATCAAGACCAATTAAAATTTTAACTAGATTAACAATTATTGTC (SEQ ID NO: 35)

[0121] The conserved regions of Stenotrophomonas maltophilia are as follows:

[0122] GCCTCGGCCACCAGCAATGAAACCGCGGTGCTGACCCACAAGGTCGTCCGCTCCCTCGGCATGCTGGCATTCGACAACCAGGCACGTTGTCTGACACGGCCCGACGGTGGCAGGTCTTGCCCCGACGCTAGGCCGTGGTG (SEQ ID NO: 36)

[0123] 2) Primer and probe design: Primers and probes were designed according to primer and probe design principles, and primer specificity analysis was performed. High-performing primers and probes were manually selected as target primers and probes. Simultaneously, following the same procedure, primers and probes for the human housekeeping gene RNase P were designed as internal standard primers and probes. The 5' end of the probe was labeled with a fluorescent reporter group (FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7, AF405), and the 3' end was labeled with a non-fluorescent double-quencher group to reduce background interference. The designed primers and probes are shown in Table 1 below. The fluorescent reporter group for PS-P1 is FAM; for EC-P1 it is VIC; for KO-P / KA-P1 it is ROX; for SMA-P1 it is CY5; for SMar-P1 it is QUASAR705; for LP-P1 it is ATTO425; for E. coli-P1 it is CY7; and for IC-P1 it is AF405. All probes use double-quenched groups.

[0124] Table 1

[0125]

[0126] II. Detection Methods

[0127] Based on real-time PCR technology, a common reaction system typically contains at least the following components: PCR buffer, Taq polymerase, UDG enzyme, dNTPs, dUTPs, primer-probe mix, and Mg2+ required for DNA polymerase catalysis. 2+ Since the reagents used in this embodiment are lyophilized, the PCR reaction system also contains a lyophilization protectant. All the above raw materials were purchased from Hunan Kangde Biotechnology Co., Ltd. PCR buffer: 2.5 μL~5 μL; Taq enzyme: 5 U~20 U; UDG enzyme: 0.1 U~1 U; dNTPs: 50 μM~400 μM; each target primer and probe: 0.1 μM~1 μM. The primer and probe combination mix in this embodiment was tested using orthogonal experiments to obtain the final optimal scheme (see Table 2 below).

[0128] Table 2

[0129]

[0130] The preferred PCR reaction solution for this application is shown in Table 3 below:

[0131] Table 3

[0132]

[0133] Sample processing and loading:

[0134] The sample type was sputum sample. To simulate positive sputum samples with co-infection by multiple bacteria, eight bacterial quality control products purchased from Beina were added to negative sputum samples to make the final concentration of each target 1.0E+05 copies / mL.

[0135] Simulated positive sputum samples were liquefied using sputum liquefaction fluid Y1002 produced by Sansure Biotech. Nucleic acid was extracted from the liquefied sputum samples using magnetic bead extraction. Simultaneously, the liquefied sputum samples were diluted 5 times with pure water and extracted using direct ultrasonic amplification.

[0136] The magnetic bead extraction method was performed using Sansure Biotech's nucleic acid extraction and purification reagent S10015.

[0137] For the direct ultrasonic amplification method, an ultrasonic instrument with an ultrasonic frequency of 10kHz-80kHz is used. The ultrasonic treatment lasts for 120 seconds. After the ultrasonic treatment is completed, the sample is left to stand for 3 minutes to cool down before use.

[0138] The PCR reaction solution with the samples added was placed on a Macroblock 48S amplification instrument for amplification, and PCR amplification was performed according to a specific temperature and time program. The preferred scheme of this embodiment is shown in Table 4.

[0139] Table 4

[0140]

[0141] After the reaction is complete, the results are automatically saved, and the amplification curves of the target and internal standard are analyzed separately. Based on the analyzed images, adjust the Start, End, and Threshold values ​​of the Baseline (the Start value can be set between 3 and 15, and the End value between 5 and 20, depending on the actual situation; adjust the amplification curve of the negative control to make it flat or below the threshold line), click Analyze to analyze, and ensure that all parameters meet the requirements in the "Quality Control" section below. Then, record the qualitative results in the Plate window.

[0142] Quality control:

[0143] Negative controls: FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405 channels all had no Ct value or Ct > 40;

[0144] Positive controls: Ct≤35 for all channels of FAM, HEX / VIC, ROX, CY5, QUSAR705, ATTO425, CY7, and AF405;

[0145] All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0146] Positive diagnostic value:

[0147] Based on the study of reference values, the reference value for Ct of the target gene detected by this kit is determined to be 40, and the reference value for Ct of the internal standard is also 40.

[0148] Interpretation of test results

[0149] First, analyze whether the internal standard has an amplification curve and Ct≤40. If so, it indicates that the test is effective and subsequent analysis can be carried out. The test results are shown in Table 5 below.

[0150] Table 5

[0151]

[0152] NEG indicates negative and POS indicates positive.

[0153] III. Test Results

[0154] The primers and probes designed in this application were used to detect simulated positive sputum samples using both magnetic bead and direct ultrasound amplification methods, following the detection method in step two. The results are as follows. Figure 1 and Figure 2As shown, both the magnetic bead method and the direct ultrasound amplification method can detect eight bacterial targets normally. This indicates that after liquefaction of sputum samples using Y1002, the direct ultrasound amplification method can obtain detection results comparable to the magnetic bead method (performance is comparable, which can be evaluated from the Ct values ​​of pathogen target detection). Considering the different operating methods of the magnetic bead method and the direct ultrasound amplification method, specifically, the magnetic bead method involves adding 300 μL of liquefied sputum sample and eluting with 80 μL, resulting in a 3.75-fold concentration; the direct ultrasound amplification method involves diluting the liquefied sputum sample 5 times. The detection method provided in this application eliminates the magnetic bead extraction process, reducing detection time.

[0155] IV. Sensitivity Results

[0156] Pretreatment of test samples: Positive test samples were the 8-bacterial control samples from BeiNa after digital PCR determination. These were diluted to 200 copies / mL with TE-SDS (0.01%) and added to artificial sputum samples, then mixed thoroughly. The simulated positive samples at the above LOD concentration were then tested using the direct ultrasonic amplification method described in step two, repeated 20 times. The number of detected samples was counted, and the detection rate was calculated. The test results showed that the 200 copies / mL simulated positive sputum samples could still detect 100% of the 8 targets, demonstrating a sensitivity of 200 copies / mL. The detection results are as follows: Figure 3 As shown.

[0157] V. Specific Results

[0158] For other pathogenic bacteria quality control samples, the same ultrasonic direct amplification method as step two of this application was used for sample processing, addition, and detection. Pathogenic bacteria (bodies) that easily cause the same or similar clinical symptoms, including Staphylococcus aureus, Acinetobacter baumannii, Enterococcus faecalis, Candida albicans, Streptococcus pyogenes, Listeria monocytogenes, Haemophilus parainfluenzae, Mycoplasma pneumoniae, Chlamydia pneumoniae, Neisseria meningitidis, Mycobacterium tuberculosis, Influenza A virus, Influenza B virus, Aspergillus flavus, Aspergillus terreus, Aspergillus fumigatus, Candida glabrata, Candida tropicalis, Streptococcus pneumoniae, Bordetella pertussis, Cryptococcus neoformans, Aeromonas hydrophila, and Morganella morganii, were detected by multiplex PCR on the Hongshi 48S fully automated medical PCR instrument. Examples of the detection results are shown in Table 6 below. The results show that the detection method provided in this application embodiment has no cross-reactivity with the above-mentioned pathogenic bacteria (bodies).

[0159] Table 6

[0160]

[0161] VI. Anti-interference and stability

[0162] Sputum samples were diluted with a solution containing interfering substances. Potential interfering substances present in the sputum samples included: 100 μg / mL meropenem, 100 μg / mL imipenem, 100 mg / mL cefoperazone / sulbactam, 100 pg / mL moxifloxacin, 100 mg / mL amikacin, 100 μg / mL linezolid, 100 μg / mL vancomycin, 60 μg / mL sodium chloride, 20% (v / v) anhydrous ethanol, 10 μg / mL LEDTA, 20% (v / v) human whole blood, 20 μg / mL purified mucin, and 10 μg / mL heme. Testing verified that the above interfering substances had no significant impact on the LOD concentration detection results of this combination of samples, as detailed in Table 7 below.

[0163] Table 7

[0164]

[0165] Comparative Example 1

[0166] In addition, the inventors designed other primers and probes (sequences are shown in Table 8) to form different detection systems. The multiple primer detection system composed of Table 9 was selected for the multiple detection of eight pathogens in the embodiments of this application.

[0167] Referring to the detection method in Example 1, the ultrasonic direct amplification method was used for detection, and the results are shown in [Figure 1]. Figure 4 The results show that, following the method in Example 1 and using the primer-probe combination in Table 8, it is possible to detect eight pathogens simultaneously.

[0168] The specificity of the primer-probe set in Table 8 was verified by the specificity detection method in Example 1. The results are shown in Table 10, indicating that cross-reactivity exists.

[0169] The anti-interference detection method in Example 1 was used to verify the anti-interference performance of the primer-probe set in Table 8. The results are as follows: Figure 5 As shown, this indicates that the aforementioned interfering substances have a significant impact on the detection results.

[0170] Table 8

[0171]

[0172]

[0173] Table 9

[0174]

[0175] Table 10

[0176]

[0177] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0178] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A nucleic acid product for detecting multiple pathogens, characterized in that, It includes the following primer and probe set: Primer and probe set 1: The nucleotide sequences are shown in SEQ ID NO: 1~3 for primer pairs and probes for detecting Proteus genus; Primer and probe set 2: The nucleotide sequences are shown in SEQ ID NO: 4~6 for the primer pairs and probes for detecting Enterobacter cloacae; Primer and probe set 3: The nucleotide sequences are shown in SEQ ID NO: 7~9 for the primer pairs and probes for detecting Klebsiella acidogenic bacteria; Primer and probe set 4: nucleotide sequences of primer pairs and probes for detecting Klebsiella pneumoniae, as shown in SEQ ID NO: 10-12; Primer and probe set 5: nucleotide sequences are shown in SEQ ID NO: 13~15 for primer pairs and probes for detecting Stenotrophomonas maltophilia; Primer and probe set 6: nucleotide sequences are shown in SEQ ID NO: 16~18 for primer pairs and probes for detecting Serratia marcescens; Primer and probe set 7: The nucleotide sequences are shown in SEQ ID NO: 19-21 for the primer pairs and probes used to detect positive Legionella pneumophila; and, Primer and probe set 8: nucleotide sequences of primer pairs and probes for detecting Escherichia coli as shown in SEQ ID NO: 22~24.

2. The nucleic acid product for detecting multiple pathogens as described in claim 1, characterized in that, It also includes a primer and probe set for detecting the RNase P gene, which includes primer pairs and probes with nucleotide sequences as shown in SEQ ID NO: 25~27.

3. The nucleic acid product for detecting multiple pathogens as described in claim 1 or 2, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end.

4. The nucleic acid product for detecting multiple pathogens as described in claim 3, characterized in that, The fluorescent group includes one or more of FAM, HEX, ROX, CY5, QUSAR705, ATTO425, CY7 and AF405; The quenching group includes one or more of BHQ1, BHQ2 and TAMRA.

5. A kit for detecting multiple pathogens, characterized in that, It includes the nucleic acid product as described in any one of claims 1 to 4, and further includes one or more of nucleic acid extraction reagents and PCR amplification reagents.

6. The kit for detecting multiple pathogens as described in claim 5, characterized in that, One or more of the following conditions must be met: (1) The PCR amplification reagents include PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs and Mg 2+ One or more of the following; (2) The kit also includes a lyophilization protectant, and the nucleic acid product and the PCR amplification reagent are packaged in the form of lyophilized reagent; (3) The kit also includes one or more positive control and negative control.

7. A lyophilized PCR premix, characterized in that, The lyophilized PCR premix comprises the nucleic acid product, lyophilization protectant, and PCR amplification reagent as described in any one of claims 1 to 4, wherein the PCR amplification reagent comprises PCR buffer, DNA polymerase, UDG enzyme, dNTPs, dUTPs, and Mg. 2+ One or more of them.

Images