Composition for treating spinal cord injury disease and use thereof
By using a drug combination containing Gsta4 and other nucleic acid sequences at the site of spinal cord injury, somatic cells can be directly transdifferentiated into motor neurons, overcoming the limitations of existing spinal cord injury treatments and achieving lasting functional recovery.
Patent Information
- Application Number
- CN202380099989.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-06-28
- Filing Date
- 2023-07-06
- Publication Date
- 2026-01-27
AI Technical Summary
Existing treatments for spinal cord injury have problems such as significant side effects, high invasiveness, and inability to effectively repair damaged spinal cords. Stem cell therapy carries the risk of teratoma and cancer, while compound therapy can only bring temporary improvement.
A pharmaceutical composition comprising Gsta4 protein or its nucleic acid, Hb9 protein or its nucleic acid, and Lhx3 protein or its nucleic acid is provided. This composition is delivered to the site of spinal cord injury via an adeno-associated virus vector, whereby the spinal cord injury is directly transdifferentiated into motor neurons, thereby achieving spinal cord injury repair.
It achieves direct transdifferentiation into motor neurons in vivo, restoring spinal cord function, overcoming the limitations of traditional methods, and providing lasting therapeutic effects.
Smart Images

Figure CN121419786A_ABST
Abstract
Description
Technical Field
[0001] This application relates to a composition for treating spinal cord injury diseases, and a method of using the composition to treat spinal cord injury diseases. Background Technology
[0002] The spinal cord is the central nervous system located within the spinal cord, and once damaged, it is difficult to recover. In particular, when the spinal cord is damaged, nerve conduction between the brain and the body cannot proceed normally, leading to the loss of motor function, sensory function, and other functions.
[0003] The spinal cord contains various nerve cells and glial cells, including astrocytes, microglia, and motor neurons.
[0004] When motor neurons are damaged, they undergo gradual degeneration, potentially affecting upper motor neurons that transmit signals from the brain to the medulla oblongata or spinal cord, or lower motor neurons that transmit signals from the spinal cord to the muscles. Furthermore, research reports indicate that astrocytes at the site of spinal cord injury can form glial scars, thereby hindering signal transmission between ascending and descending nerve cells.
[0005] Spinal cord injury, as an injury to the central nervous system, still lacks a definitive treatment plan despite continuous advancements in medical and surgical approaches. Currently, treatment for spinal cord injury primarily relies on methods with significant side effects, such as steroid therapy or invasive surgical procedures.
[0006] In addition, although cell therapy drugs and compound therapy drugs that use stem cells to treat spinal cord injuries have been developed, stem cell therapy drugs have the risk of inducing teratomas or cancer, while compound therapy drugs can only bring temporary improvement in motor function, but cannot truly repair the damaged spinal cord.
[0007] Therefore, there is an urgent need to develop new drugs for the treatment of spinal cord injury. Summary of the Invention
[0008] Technical issues One object of this application is to provide a composition for treating spinal cord injury diseases. Specifically, the composition contains a differentiation factor for directly transdifferentiating somatic cells into motor neurons. More specifically, the composition contains the Gsta4 (Glutathione S-transferase A4) protein or nucleic acid encoding the protein.
[0009] Another object of this application is to provide another composition for treating spinal cord injury diseases. In particular, the composition comprises Gsta4 (Glutathione S-transferase A4) protein or nucleic acid encoding thereof for directly transdifferentiating somatic cells into motor neurons; Hb9 (MNX1) protein or nucleic acid sequence encoding thereof; and Lhx3 protein or nucleic acid sequence encoding thereof.
[0010] Another objective of this application is to provide a method for preparing the composition.
[0011] Another aspect of this application is to provide a method for treating spinal cord injury diseases.
[0012] Another objective of this application is to provide a variety of uses for the said composition.
[0013] Problem-solving methods In order to solve the problems of the present application mentioned above, according to one embodiment of the present invention, a pharmaceutical composition for treating spinal cord injury is provided.
[0014] The pharmaceutical composition for treating spinal cord injury may include: a nucleic acid sequence encoding the Gsta4 (Glutathione S-Transferase Alpha 4) protein; a nucleic acid sequence encoding the Lhx3 (LIM homeobox 3) protein; and a nucleic acid sequence encoding the MNX1 (Motor neuron and pancreas homeobox 1) protein.
[0015] At this time, the spinal cord injury disease can be selected from: lower body paralysis, total paralysis, amyotrophic lateral sclerosis, primary lateral sclerosis, progressive pseudobulbar palsy, progressive muscular atrophy, progressive bulbar palsy, and post-poliomyelitis syndrome.
[0016] The nucleic acid sequences encoding the Gsta4 protein, the Lhx3 protein, and the MNX1 protein can be contained in the vector independently or in a combination of two or more nucleic acid sequences.
[0017] Here, the vector can be an adeno-associated virus (AAV). The adeno-associated virus can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.
[0018] The nucleic acid sequence encoding the Gsta4 protein can be sequence number 12, the nucleic acid sequence encoding the Lhx3 protein can be sequence number 16, and the nucleic acid sequence encoding the MNX1 protein can be sequence number 14.
[0019] The vector may further include a promoter, a 2A self-cleaving peptide, and an ITR (inverted terminal repeat). The promoter may be a CMV promoter, and the 2A self-cleaving peptide may be P2A or T2A. Furthermore, the CMV promoter may be the sequence shown in sequence number 37, P2A may be the sequence shown in sequence number 38, and T2A may be the sequence shown in sequence number 39.
[0020] The pharmaceutical composition can be formulated into an injectable dosage form. In this case, the AAV contained in the pharmaceutical composition can be 1 × 10⁻⁶. 5 GC / kg to 1×10¹ 5 The AAV was administered to the test subjects at a dose of GC / kg. Furthermore, the AAV could be administered at a dose of 1 × 10⁻⁶. 6 The subjects were administered doses ranging from GC / kg to 1×10¹²GC / kg.
[0021] The pharmaceutical composition is administered to the damaged spinal cord site in a subject suffering from spinal cord injury, wherein the damaged spinal cord site is selected from: L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), T8 (thoracic 8), T9 (thoracic 9), T10 (thoracic 10), T11 (thoracic 11), T12 (thoracic 12), T13 (thoracic 13), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 The pharmaceutical compositions are: C5 (cervical 4), C6 (cervical 5), C7 (cervical 7), C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3), and S4 (sacrum 4). When administered to a test subject, the pharmaceutical composition may be administered in a volume of 1 μL to 1 mL per administration.
[0022] To address the aforementioned issues of this application, according to another embodiment of the present invention, a pharmaceutical composition for treating spinal cord injury is provided, the pharmaceutical composition comprising a nucleic acid sequence encoding the Gsta4 (Glutathione S-TransferaseAlpha 4) protein.
[0023] Here, the nucleic acid sequence encoding the Gsta4 protein can be contained in a vector. The nucleic acid sequence encoding the Gsta4 protein can be the sequence numbered 12.
[0024] Furthermore, the vector may further contain a promoter sequence. Here, the promoter sequence may be the sequence shown in sequence number 37.
[0025] Invention Effects According to this application, the following effects can be achieved: According to this application, a composition for treating spinal cord injury diseases can be provided. In particular, the composition comprises the Gsta4 (Glutathione S-transferase A4) protein or the nucleic acid sequence encoding it for the direct transdifferentiation of somatic cells into motor neurons.
[0026] As a specific example, the composition comprises Gsta4 (glutathione S-transferase A4) protein or nucleic acid encoding thereof for directly transdifferentiating somatic cells into motor neurons; Hb9 protein or nucleic acid sequence encoding thereof; and Lhx3 protein or nucleic acid sequence encoding thereof.
[0027] According to this application, a method for treating spinal cord injury diseases using the composition can also be provided. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of the AAV carrier used in this experimental example.
[0029] (a) is a schematic diagram of an AAV vector containing Gsta4; (b) is a schematic diagram of an AAV vector containing Ascl1, Isl1, Lhx3 and Ngn2 (also known as Neurog2); (c) is a schematic diagram of an AAV vector containing Brn2, Hb9 (also known as Mnx1 (motor neuron and pancreatic homeobox 1)) and NeuroD1; (d) is a schematic diagram of an AAV vector containing Gsta4 and Myt1l; (e) is a schematic diagram of an AAV vector containing Gsta4, Hb9 and Lhx3.
[0030] Figure 2 This is a schematic diagram of the AAV vector used in this experimental example, which illustrates the details. Figure 1 (e) shows a schematic diagram of an AAV vector containing Gsta4, Hb9 and Lhx3.
[0031] Figure 3 This image shows the results of confirming the degree of direct transdifferentiation into motor neurons in mouse fibroblasts after introducing the direct transdifferentiation factor Gsta4, using the expression of neuronal markers ChAT and Map2. The control group represents the control group that received no treatment. Figure 3 (a) shows the results of the immunofluorescence staining experiment, and (b) is a numerical graph of the results of (a).
[0032] Figure 4 The image shows the results of confirming the degree of direct transdifferentiation into motor neurons by observing changes in the expression of neuronal markers (Synapsin, Map2, Hb9) after introducing a composition containing conventional direct transdifferentiation factors into fibroblasts. Figure 4(a) shows the result of introducing mouse-derived fibroblasts, and (b) shows the result of introducing human-derived fibroblasts.
[0033] Figure 5 This image shows the results of confirming the degree of transdifferentiation into neurons in mouse primary astrocytes after introducing direct transdifferentiation factors, using the expression of neuronal markers Tuj1 and Map2. The direct transdifferentiation factors used included: GSTA4-only, MNX1-only (also known as Hb9), LHX3-only, a combination of GSTA4 and MNX1, and a combination of GSTA4 and LHX3.
[0034] Figure 6 for Figure 5 Numericalized graph of the results.
[0035] Figure 7 This image shows the results of immunofluorescence staining to confirm the degree of direct transdifferentiation into motor neurons in mouse fibroblasts after introducing a composition containing differentiation factors, using the expression of neuronal markers ChAT and Map2. The differentiation factors used included combinations of Mnx1 and Lhx3, and combinations of Gsta4, Mnx1, and Lhx3. Figure 7 (a) shows the immunofluorescence staining results, and (b) and (c) are numerical representations of the results in (a).
[0036] Figure 8 The results show the degree of direct transdifferentiation into motor neurons by using the expression of neuronal markers Synapsin, Map2, and Hb9 after introducing a composition containing differentiation factors into mouse-derived fibroblasts.
[0037] At this time, the differentiation factors used include those containing only Gsta4; combinations of Mnx1 and Lhx3; and combinations of Gsta4, Mnx1, and Lhx3.
[0038] Figure 9 This diagram illustrates the results of confirming the degree of differentiation into motor neurons in mouse primary astrocytes by measuring the expression of neuronal markers Tuj1 and Map2 after introducing a composition containing differentiation factors. In the diagram, Naive represents the control group without any treatment; control represents the solvent control group treated with AAV2 buffer; and STUP-001 represents the composition containing Gsta4, Hb9, and Lhx3.
[0039] Figure 10The figure shows the results of confirming the effect of a composition containing GSTA4 by administering it to the spinal cord injury site in a mouse model of lower limb paralysis (SCI) through changes in the expression of motor neuron markers ChAT and Map2. Figure 10 (a) shows the results of immunofluorescence staining, and (b) is a numerical representation of the results in (a).
[0040] Figure 11 This figure shows the results of evaluating cell viability in mouse primary astrocytes after treatment with a combination containing Gsta4, MNX1, and Lhx3 (hereinafter referred to as STUP-001) at different concentrations. Naive represents the control group without any treatment; control represents the solvent control group treated with AAV2 buffer.
[0041] Figures 12 to 15 The figure shows the results of BBB score (Basso Beattie and Bresnahan score), action potential (APfiring ratio), resting membrane potential (RMP), and efficacy-related protein quantity after treating STUP-001 with different concentrations in the SCI mouse model.
[0042] At this point, E0 represents the normal ICR mouse control group; E1 represents the solvent control group treated with AAV2 buffer in the SCI mouse model; and E2 represents the solvent control group treated with 2.0 × 10⁻⁶ AAV2 buffer in the SCI mouse model. 8 The experimental group treated with GC / head dose for STUP-001; E3 indicates the SCI mouse model treated with 2.0 × 10⁻⁶ GC / head dose. 7 The experimental group treated with GC / head dose for STUP-001; E4 indicates the SCI mouse model treated with 2.0 × 10⁻⁶ GC / head dose. 6 The experimental group treated with GC / head dose for STUP-001; E5 indicates the SCI mouse model treated with 2.0 × 10⁻⁶ GC / head dose. 5 Experimental group treated with GC / head dose to STUP-001. Detailed Implementation
[0043] This application will be described in more detail with reference to the accompanying drawings and the following description. The drawings illustrate embodiments of this application, but do not encompass all embodiments. Furthermore, the content of this application can be embodied in various ways and is not limited to the specific embodiments described below. In other words, this application can be modified in many ways and may have various experimental examples. Although the structure and features of this application are illustrated with experimental examples based on this application, this application is not limited thereto. It will be apparent to those skilled in the art that various changes or modifications can be made within the spirit and scope of this application; therefore, it should be understood that these changes or modifications also fall within the scope of the appended claims.
[0044] Unless otherwise defined, all technical and scientific terms used in this specification have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. The same or similar methods and substances described in this specification may also be used in the practice or testing of this invention. All publications, patent applications, patents, and other references cited in this specification are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and embodiments described are exemplary only and are not intended to limit the scope of this invention.
[0045] Terminology Definition Spinal cord injury (SCI) In this application, the term "spinal cord injury (SCI)" refers to damage to the central nervous system located within the spine, i.e., the spinal cord. Spinal cord injury disease should be interpreted as including spinal cord injury caused by disease or trauma, and the resulting diseases. Specifically, in this application, "spinal cord injury" as a representative example refers to damage to motor neurons, leading to abnormal motor nerve function. The term "spinal cord injury" may be used interchangeably with "damaged spinal cord."
[0046] Neuron In this application, "neuron" refers to the nerve cells that make up the nervous system. Nerve cells differ from other cells in that they can transmit signals electrically. Neurons can be divided into sensory neurons that make up sensory nerves, interneurons that make up the central nervous system, and motor neurons that make up motor nerves. All nerve cells are electrically excitable. Before signal transmission, nerve cells are in a resting state, and their electrical potential is maintained at approximately [value missing]. 70mV. This application specifically relates to a technique for efficiently generating motor nerve cells (motor neurons).
[0047] Induced motor neuron (iMN) The term "induced motor neuron" as used in this application refers to a motor neuron induced (generated) through direct transdifferentiation. Specifically, the induced motor neuron refers to a motor neuron artificially generated by directly transdifferentiating somatic cells, etc., using the novel differentiation factor described in this application. The induced motor neuron possesses the same functions as motor neurons existing in vivo (i.e., non-artificially manufactured motor neurons). For example, the induced motor neuron can transmit motor stimuli occurring in the brain and spinal cord to muscles, but this is merely an example and not intended to be limiting. The term "induced motor neuron" is used interchangeably with "motor neuron" and "iMN".
[0048] Direct reprogramming / direct conversion / transdifferentiation As used in this application, the term "direct reprogramming / direct conversion / transdifferentiation" refers to the process of introducing a specific factor into differentiated cells, thereby converting them into target cells. Specifically, direct transdifferentiation refers to the induction of conversion between mature cells of completely different cell types. In other words, it is the process of directly converting somatic cells into target cells without going through a pluripotent state. The terms "direct reprogramming," "direct conversion," "cell conversion," and "transdifferentiation" are used interchangeably.
[0049] Direct conversion factor (converting factor) The term "direct conversion factor" as used in this application refers to a factor involved in the aforementioned direct conversion process. Here, the conversion factor can be a gene, compound, protein, nucleic acid, etc. The terms "direct conversion factor" and "converting factor" are used interchangeably.
[0050] treat As used in this application, the term "treatment" refers to actions that alleviate a disease, condition, or symptom, or inhibit its progression. The treatment includes all actions that improve symptoms or produce beneficial changes through the compositions of this invention, direct transdifferentiation factors, etc.
[0051] About As used in this application, the term "about" means a quantity, level, value, frequency, percentage, size, size, quantity, weight, or length that varies relative to a reference within the range of about 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%.
[0052] The invention disclosed in this application will be described in detail below.
[0053] 1. A composition for treating spinal cord injury diseases Overview of compositions for the treatment of spinal cord injury.
[0054] One embodiment of this application relates to a composition for treating spinal cord injury diseases. In particular, the composition for treating spinal cord injury diseases of this application comprises a direct transdifferentiation factor.
[0055] The following will provide a detailed explanation of the mechanism of action of spinal cord injury, existing treatment methods for spinal cord injury, GST, and the active ingredients of the composition.
[0056] Spinal cord injury The invention disclosed in this application is intended for the treatment of spinal cord injury diseases.
[0057] The spinal cord is composed of nerve cells, oligodendrocytes, astrocytes, microglia, and other cells.
[0058] When the spinal cord is injured, the cells that make up the spinal cord undergo different fates. Nerve cells and oligodendrocytes initiate apoptosis and die. In contrast, astrocytes and microglia, while not dying, are activated, their numbers increase dramatically, and their cell size also enlarges. Furthermore, they secrete various substances that hinder the repair of the damaged spinal cord.
[0059] In particular, the apoptosis mechanism of nerve cells and glial cells is closely related to the loss of nerve cell function. It is known that nerve cell loss due to necrosis can occur at all stages of spinal cord injury (Cell death in models of spinal cord injury. Prog Brain Res. 2002;137:37-47.).
[0060] Therefore, the key to repairing or treating spinal cord injuries lies in regenerating apoptotic nerve cells, thereby restoring their function. In particular, the invention of this application achieves the repair or treatment of the aforementioned spinal cord injury by effectively generating and regenerating motor neurons at the site of the spinal cord injury.
[0061] Spinal cord injury-related diseases Spinal cord injury diseases in this application include injuries to the central nervous system located within the spine, namely the spinal cord, or all related diseases arising therefrom.
[0062] Spinal cord injury diseases include: traumatic spinal cord injury, amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), multifocal motor neuron disease (MMN), Werdnig-Hoffman disease, spinal muscular atrophy (SMA), Kugelberg-Welander syndrome, stroke, ataxia telangiectasia, familial motor neuron disease, bulbar palsy, lower body paralysis, generalized paralysis, hemiplegia, quadriplegia, bilateral paralysis, cerebral palsy, etc. Preferably, the spinal cord injury disease can be selected from traumatic spinal cord injury, amyotrophic lateral sclerosis, lower body paralysis, generalized paralysis, hemiplegia, quadriplegia, bilateral paralysis, or cerebral palsy.
[0063] Problems with conventional spinal cord injury treatment As mentioned above, there are currently no reported effective treatments for spinal cord injuries.
[0064] However, research is underway that aims to treat spinal cord injuries by using cell transplantation or axonal regeneration.
[0065] To regenerate nerve tissue lost due to spinal cord injury, cell-based therapeutic drugs utilizing cells have been developed. The main research focuses on transplanting Schwann cells, neural progenitor cells, and stem cells. However, some studies have reported that axonal process growth is limited after transplantation due to the inhibitory effect of glial cell scarring. Furthermore, the potential risk of stem cells forming teratomas or inducing cancer has been raised. Most importantly, there is currently insufficient evidence to prove whether transplanted cells truly differentiate into nerve cells, and the survival rate of transplanted cells is extremely low, resulting in very limited therapeutic effects.
[0066] In addition to the aforementioned cell therapy agents, the development of antibodies and compounds is also underway. Once the central nervous system is damaged, its regenerative capacity is inhibited, particularly since oligodendrocyte axons are considered a major inhibitor of axonal growth in the central nervous system. Therefore, research primarily focuses on inhibitors of axonal growth. Key research areas include inhibitors of the Rho / ROCK pathway and chondroitinase ABC (ChABC), an enzyme that breaks down chondroitin sulfate proteoglycan (CSPG), which inhibits axonal regeneration. However, these compounds not only have toxicity issues but also only regenerate axons from residual nerve cells around the damaged site, thus only temporarily improving the function of the damaged spinal cord and are difficult to apply as a fundamental treatment.
[0067] The composition of this application for treating spinal cord injury The composition of this application for treating spinal cord injury contains direct transdifferentiation factor as an active ingredient.
[0068] Specifically, the direct transdifferentiation factor of this application has the function of directly transdifferentiating somatic cells into motor neurons. The characteristic of this direct transdifferentiation is that somatic cells are directly converted into motor neurons without undergoing an induced pluripotent stem cell reprogramming stage.
[0069] The composition of this application for treating spinal cord injury can, upon application to a patient, for example at the site of spinal cord injury, convert somatic cells into motor neurons. This allows for the large-scale generation and regeneration of motor neurons at the site of spinal cord injury. The somatic cells can be selected from: fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair matrix cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells / G cells, B cells, peridermal cells, astrocytes, blood cells, and oligodendrocyte precursor cells.
[0070] Specifically, the composition of this application for treating spinal cord injury must contain GSTA4 (glutathione S-transferase α4) protein or nucleic acid encoding the protein.
[0071] GSTA4's standard functions Gsta4 is an enzyme belonging to the glutathione S-transferase (GST) family. Eight types of GST are known to be produced in the cytoplasm of mammals: α, κ, μ, ω, π, σ, θ, and zeta. The α-type is located on chromosome 6 and includes GSTA1, GSTA2, GSTA3, GSTA4, and GSTA5. Gsta4, also known as GTA4, is believed to be involved in cellular defense mechanisms, toxin breakdown, and anti-tumor effects. Furthermore, it plays a crucial role in reducing cellular stress by decreasing reactive oxygen species. Gsta4 deficiency is reportedly adversely associated with diseases such as Parkinson's disease and Alzheimer's disease. However, its function as a direct intercellular differentiation factor, particularly in facilitating cell differentiation into motor neurons, has not yet been reported.
[0072] New features of GSTA4 in this invention The composition of this application for treating spinal cord injury diseases contains GSTA4 as an essential active ingredient, which enables direct transdifferentiation.
[0073] Through research on GSTA4, the inventors have revealed a novel function of it as a differentiation factor that directly transdifferentiates into motor neurons, rather than its existing known function.
[0074] As can be confirmed from the embodiments of this application, GSTA4 can induce somatic cells to directly transdifferentiate into motor neurons, and further promote the repair of damaged spinal cord in animal models of spinal cord injury.
[0075] Therefore, the term GSTA4 as used below should be interpreted as GSTA4 with direct transdifferentiation factor function.
[0076] Function of GSTA4 in spinal cord injury As mentioned above, when the spinal cord is injured, nerve cells and oligodendrocytes die due to apoptosis, while astrocytes and microglia are activated, leading to an increase in cell number. In particular, the increase in astrocytes leads to the formation of glial scars, which inhibit the regeneration and regrowth of axons. Furthermore, this blocks signal transduction between nerve cells.
[0077] The GSTA4 described in this application has the function of directly transdifferentiating abnormally increased astrocytes into motor neurons. GSTA4 exerts the above-mentioned effects in the injured spinal cord, not only facilitating signal transmission between blocked nerve cells, but also directly participating in the regeneration or repair of damaged motor neurons, thereby achieving the treatment of spinal cord injury.
[0078] In particular, the composition of this application for treating spinal cord injury contains GSTA4, which can directly transdifferentiate somatic cells such as astrocytes into motor neurons, thus having the advantage of being applicable in vivo. This will overcome many problems, such as the cumbersome ex vivo steps required in most traditional cell-based spinal cord injury treatments.
[0079] The present application provides a composition for treating spinal cord injury diseases containing GSTA4 as the sole active ingredient.
[0080] Another composition of this application for treating spinal cord injury diseases comprises GSTA4 and one or more known direct transdifferentiation factors as active ingredients.
[0081] Examples of known direct transdifferentiation factors Among direct transdifferentiation factors, known factors used to achieve direct transdifferentiation include: Ascl1 (Achaete-scute homolog 1), Nurr1 (Nuclear Receptor Subfamily 4 Group A Member 2), Lmx1a (LIM Homeobox Transcription Factor 1 Alpha), Foxa2 (Forkhead box protein A2), Brn2 (POU Class 3 Homeobox 2), Sox2 (sex determining region Y-box 2), Foxg1 (Forkhead Box G1), Lhx3 (LIM homeobox 3), HB9 (Homeobox HB9; also known as Mnx1 (Motorneuron and pancreas homeobox 1)), IsL1 (ISL LIM homeobox 1), Ngn2 (neurogenin 2; also known as Neurog2), NeuroD1 (Neuronal Differentiation 1), Myt1l (Myelin Transcription Factor 1 Like), and NeuroD2 (Neuronal Differentiation Factor 1 Like). 2), miR-9 (microRNA-9), miR-124 (microRNA-124), Zic1 (Zic Family Member 1), Gata5 (GATA Binding Protein 5), Hnf4α (Hepatocyte nuclear factor 4 alpha), HNF1α (hepatocyte nuclear factor 1 alpha), Foxa1 (Forkhead Box A1), Foxa3 (Forkhead Box A3), Tbx5 (T-Box Transcription Factor 5), Mef2c (Myocyte Enhancer Factor 2C), Oct4 (Octamer-binding transcription factor 4), PRDM16 (PR / SET Domain 16), MyoD (myoblast determination protein 1), Klf4 (Kruppel-like factor 4), c-Myc (cellular Myc), etc. (Mol Cell.2012 Sep 28;47(6):827-838.). .
[0082] In particular, the direct transdifferentiation factor used in this application may be one or more factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1.
[0083] The following will describe specific embodiments of the active ingredients contained in the composition for treating spinal cord injury diseases of this application, but this application is not limited thereto.
[0084] For convenience, examples of the composition are described below as containing only GSTA4, containing GSTA4 and one known differentiation factor, containing GSTA4 and two known differentiation factors, etc., but the number of known direct transdifferentiation factors included is not limited. In other words, GSTA4 can be included in the composition along with one to eight of the above-mentioned "factors for inducing direct transdifferentiation into motor neurons".
[0085] Specifically, all examples of the compositions contain GSTA4, which functions as an "essential active ingredient" for treating spinal cord injury. Furthermore, the known differentiation factors may also be used as one of the active ingredients in the compositions of this application.
[0086] Composition Example Composition example (1): Contains GSTA4 alone The composition of this application for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid sequence encoding the protein.
[0087] Composition Example (2): Contains Gsta4 and a conventional direct transdifferentiation factor The composition of this application for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid sequence encoding the protein; and further includes a conventional direct transdifferentiation factor.
[0088] For example, the conventional direct transdifferentiation factor may be a protein selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid sequence encoding the selected protein.
[0089] As an example, a composition for treating spinal cord injury may comprise the Gsta4 protein or a nucleic acid sequence encoding the protein; and the Ascl1 protein or a nucleic acid sequence encoding the protein.
[0090] As an example, a composition for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid sequence encoding the protein; and the Brn2 protein or a nucleic acid sequence encoding the protein.
[0091] As an example, a composition for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid sequence encoding the protein; and the Hb9 protein or a nucleic acid sequence encoding the protein.
[0092] As an example, a composition for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid sequence encoding the protein; and the Lhx3 protein or a nucleic acid sequence encoding the protein.
[0093] Composition example (3): Contains Gsta4 and two conventional direct transdifferentiation factors The composition of this application for treating spinal cord injury may contain the Gsta4 protein or a nucleic acid encoding the protein; and further contain two conventional direct transdifferentiation factors.
[0094] For example, the conventional direct transdifferentiation factor may be two proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or it may be a nucleic acid sequence encoding the selected protein.
[0095] As an example, a composition for treating spinal cord injury may comprise the Gsta4 protein or a nucleic acid sequence encoding the protein; the Hb9 protein or a nucleic acid sequence encoding the protein; and the Ngn2 protein or a nucleic acid sequence encoding the protein.
[0096] As an example, a composition for treating spinal cord injury may comprise the Gsta4 protein or a nucleic acid sequence encoding the protein; the Lhx3 protein or a nucleic acid sequence encoding the protein; and the Ngn2 protein or a nucleic acid sequence encoding the protein.
[0097] As an example, a composition for treating spinal cord injury may comprise the Gsta4 protein or a nucleic acid sequence encoding the protein; the Hb9 protein or a nucleic acid sequence encoding the protein; and the Isl1 protein or a nucleic acid sequence encoding the protein.
[0098] As an example, a composition for treating spinal cord injury may comprise the Gsta4 protein or a nucleic acid sequence encoding the protein; the Ngn2 protein or a nucleic acid sequence encoding the protein; and the Isl1 protein or a nucleic acid sequence encoding the protein.
[0099] Preferably, the composition for treating spinal cord injury comprises Gsta4 protein or a nucleic acid sequence encoding the protein; Hb9 protein or a nucleic acid sequence encoding the protein; and Lhx3 protein or a nucleic acid sequence encoding the protein.
[0100] The combination ratio of Gsta4 with conventional direct differentiation factor As described above, in the composition for treating spinal cord injury, Gsta4 and conventional direct transdifferentiation factor can be combined in any proportion as needed by those skilled in the art.
[0101] In this case, Gsta4 and conventional direct transdifferentiation factor can be used in the same or different proportions.
[0102] For example, when using Gsta4 with a conventional direct transdifferentiation factor, it can be used in a ratio of 1:1, 1:2, or 2:1.
[0103] As a specific example, when using Gsta4 and Hb9, they can be used in a ratio of 1:1, 2:1, or 1:2.
[0104] As a specific example, when using Gsta4 and Lhx3, they can be used in a ratio of 1:1, 2:1, or 1:2.
[0105] Another example is that when using Gsta4 with two conventional direct transdifferentiation factors, it can be used in ratios of 1:1:1, 2:1:1, 2:1:2, or 1:2:1.
[0106] As a specific example, when using Gsta4, Hb9, and Lhx3, they can be used in ratios of 1:1:1, 2:1:1, 2:1:2, or 1:2:1.
[0107] direct transdifferentiation factor form The direct transdifferentiation factor contained in the composition for treating spinal cord injury diseases of this application may be a protein, a nucleic acid, or a mixture of protein and nucleic acid, but is not limited thereto.
[0108] Gsta4 format example The Gsta4 can be derived from mammals. For example, the mammal can be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, or chimpanzee. Preferably, it is derived from a human.
[0109] The compositions of this application may contain Gsta4 protein.
[0110] The Gsta4 protein may be composed of a wild-type amino acid sequence, or it may be a variant in which one or more amino acids in the wild-type amino acid sequence are deleted, substituted, or inserted.
[0111] The amino acid sequence of the Gsta4 wild-type protein can be obtained from known databases. The Gsta4 protein of this application can be an amino acid sequence having more than 60% sequence identity with the wild-type amino acid sequence. In this case, the sequence identity can be a range between any two values selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Preferably, the Gsta4 protein can have about 90% to 100% sequence identity with the wild-type amino acid sequence.
[0112] As an example, the Gsta4 protein used for direct transdifferentiation in this application may be the amino acid sequence shown in sequence number 1.
[0113] Sequence Number 1: maarpklhyp ngrgrmesvr wvlaaagvef deefletkeq lyklqdgnhllfqqvpmvei dgmklvqtrs ilhyiadkhn lfgknlkert lidmyvegtl dllellimhp flkpddqqkevvnmaqkaii ryfpvfekil rghgqsflvg nqlsladvil lqtilaleek ipnilsafpf lqeytvklsniptikrflep gskkkpppde iyvrtvynif rp In another embodiment, the Gsta4 protein may be a sequence that has 70% to 100% sequence identity with the amino acid sequence shown in Sequence Number 1.
[0114] Furthermore, the composition of this application may contain nucleic acid encoding the Gsta4 protein. The nucleic acid may be DNA or RNA.
[0115] The nucleic acid encoding the Gsta4 protein may have a wild-type nucleic acid sequence, or it may be a sequence in which one or more nucleotides are deleted, substituted, or inserted in the wild-type nucleic acid sequence.
[0116] Wild-type nucleic acids for Gsta4, such as DNA sequences, can be obtained from well-known databases.
[0117] The Gsta4 nucleic acid sequence of this application can be a sequence with more than 60% sequence identity to the wild-type nucleic acid sequence. In this case, the sequence identity can be a range between any two values selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Preferably, the nucleic acid encoding the Gsta4 protein can have about 90% to 100% sequence identity to the wild-type nucleic acid sequence.
[0118] The nucleic acid sequence can be the full-length sequence of the Gsta4 gene, which includes intron and exon sequences.
[0119] Alternatively, the nucleic acid sequence may be a sequence containing only exons. For example, the nucleic acid sequence encoding the Gsta4 protein may contain a CDS (coding sequence) sequence with introns removed.
[0120] For example, the nucleic acid sequence may be a DNA sequence encoding the Gsta4 protein and its corresponding (transcriptional product) mRNA sequence.
[0121] In another example, the nucleic acid sequence may be an mRNA sequence (transcription product) corresponding to the exon sequence of the Gsta4 gene.
[0122] In one specific example, the nucleic acid encoding the Gsta4 protein may contain the full-length DNA sequence of the Gsta4 gene, i.e., sequence number 2.
[0123] Sequence number 2: gctttgtgcg gctccaggcc tccgagtgga ctccagaaag cctgaaaagctatcatggca gcaaggccca agctccacta tcccaacgga agaggccgga tggagtccgt gagatgggttttagctgccg ccggagtcga gtttgatgaa gaatttctgg aaacaaaaga acagttgtac aagttgcaggatggtaacca cctgctgttc caacaagtgc ccatggttga aattgacggg atgaagttgg tacagacccgaagcattctc cactacatag cagacaagca caatctcttt ggcaagaacc tcaaggagag aaccctgattgacatgtacg tggaggggac actggatctg ctggaactgc ttatcatgca tcctttctta aaaccagatgatcagcaaaa ggaagtggtt aacatggccc agaaggctat aattagatac tttcctgtgt ttgaaaagattttaaggggt cacggacaaa gctttcttgt tggtaatcag ctgagccttg cagatgtgat tttactccaaaccattttag ctctagaaga gaaaattcct aatatcctgt ctgcatttcc tttcctccag gaatacacagtgaaactaag taatatccct acaattaaga gattccttga acctggcagc aagaagaagc ctccccctgatgaaatttat gtgagaaccg tctacaacat ctttaggcca taaaacaaca catccatgtg tgagtgacagtgtgttccta gagatggtat tgtctacagt catgtcttaa tggatcccag ctctgtcatg gtgctatctatgtattaagt tgggtcctaa gttgggtctt ttgtgtcaac gagatcatct cttctagaaa tatcaaccttttttgtccag taaataattgttaggggatc tttattggaa aacttttttg gagaggctgg tatttaagttagatctgatt gggctactca tgtcctgtag ccagttcatc ctcataataa gaatgggcag gatctcttgttctctcctga gtgtctttct actctcctga gcgtctttct gctctcctta tcctgttctc ttatccttatcccctccagt ctctgcctaa tttttagtgt ttaataacaa ccgaatgtct agtaaatgac tctcctctgagctgtaataa ataaaatggt agtaatgaat gcaatcagta ttagccaaaa taaagaattt atgagtcatt In another specific example, the nucleic acid encoding the Gsta4 protein may have sequence number 12 as a CDS sequence.
[0124] Serial number 12: Atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaagtgcc catggttgaaattgacgggatgaagttggtacagacccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctttct taaaaccagatgatcagcaaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctcta gaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa In another embodiment, the nucleic acid encoding the Gsta4 protein may contain a sequence that has 90% to 100% sequence identity with the DNA sequence shown in Sequence Number 2.
[0125] In another embodiment, the nucleic acid encoding the Gsta4 protein may contain a sequence that has 90% to 100% sequence identity with the CDS sequence shown in sequence number 12.
[0126] Conventional direct transdifferentiation factor form The conventional direct transdifferentiation factor can be derived from mammals. For example, the mammal can be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, or chimpanzee. Preferably, it is derived from a human.
[0127] In addition to containing the Gsta4 protein, the composition of this application may further contain conventional direct transdifferentiation factor in protein form.
[0128] When the conventional direct transdifferentiation factor is in protein form, it can be composed of a wild-type amino acid sequence or a variant in which one or more amino acids in the wild-type amino acid sequence are deleted, substituted, or inserted.
[0129] Wild-type amino acid sequences can be obtained from known databases. The direct transdifferentiation factor protein of this application can be an amino acid sequence with more than 60% sequence identity to the wild-type amino acid sequence. In this case, the sequence identity can be a range between any two values selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Preferably, conventional direct transdifferentiation factor proteins can have about 90% to 100% sequence identity to the wild-type amino acid sequence.
[0130] As an alternative embodiment, the conventional direct transdifferentiation factor protein used for direct transdifferentiation in this application may be the amino acid sequence indicated by the selected sequence numbers below.
[0131] In another embodiment, the conventional direct transdifferentiation factor protein may be a sequence that has 70% to 100% sequence identity with the amino acid sequence shown by the selected sequence number below.
[0132] The amino acid sequence of the Ascl1 protein is sequence number 17; The amino acid sequence of the Brn2 protein is sequence number 19; The amino acid sequence of the Myt1L protein is sequence number 21; The amino acid sequence of the Hb9 (also known as Mnx1) protein is sequence number 13; The amino acid sequence of the Isl1 protein is sequence number 23; The amino acid sequence of the Lhx3 protein is sequence number 15; The amino acid sequence of the Ngn2 (also known as Neurog2) protein is sequence number 25; The amino acid sequence of the NeuroD1 protein is sequence number 27.
[0133] Furthermore, the compositions of this application may contain nucleic acids encoding conventional direct transdifferentiation factor proteins. The nucleic acids may be DNA or RNA.
[0134] The nucleic acid encoding the conventional direct transdifferentiation factor protein may have a wild-type nucleic acid sequence, or a sequence in which one or more nucleotides are deleted, substituted, or inserted.
[0135] Nucleic acid, such as DNA sequence, of wild-type conventional direct transdifferentiation factor can be obtained from known databases.
[0136] The nucleic acid sequence of the conventional direct transdifferentiation factor of this application can be a sequence with more than 60% sequence identity with the wild-type nucleic acid sequence. In this case, the sequence identity can be a range between any two values selected from about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. Preferably, the nucleic acid sequence encoding the conventional direct transdifferentiation factor protein can have about 90% to 100% sequence identity with the wild-type nucleic acid sequence.
[0137] The nucleic acid sequence can be the full-length sequence of a conventional direct transdifferentiation factor gene containing intron and exon sequences.
[0138] Alternatively, the nucleic acid sequence may be a sequence containing only exons. For example, the nucleic acid sequence encoding a conventional direct transdifferentiation factor protein may contain a CDS (coding sequence) sequence with introns removed.
[0139] For example, the nucleic acid sequence may be a DNA sequence encoding a conventional direct transdifferentiation factor protein and its corresponding (transcriptional product) mRNA sequence.
[0140] In another example, the nucleic acid sequence may be an mRNA sequence of (transcriptional product) corresponding to the exon sequence of a conventional direct transdifferentiation factor gene.
[0141] In a specific example, the nucleic acid encoding a conventional direct transdifferentiation factor protein may include any of the following selected sequence numbers.
[0142] In another specific example, the nucleic acid encoding a conventional direct transdifferentiation factor protein may contain a sequence that has 90% to 100% sequence identity with the sequence shown in the selected sequence numbers below.
[0143] The nucleic acid sequence encoding the Ascl1 protein is sequence number 18; The nucleic acid sequence encoding the Brn2 protein is sequence number 20; The nucleic acid sequence encoding the Myt1L protein is sequence number 22; The nucleic acid sequence encoding the Hb9 (also known as Mnx1) protein is sequence number 14; The nucleic acid sequence encoding the Isl1 protein is sequence number 24; The nucleic acid sequence encoding the Lhx3 protein is sequence number 16; The nucleic acid sequence encoding the Ngn2 (also known as Neurog2) protein is sequence number 26; and The nucleic acid sequence encoding the NeuroD1 protein is sequence number 28.
[0144] The active ingredient contained in the composition of this application is in the form of... The effective component of the composition for treating spinal cord injury diseases described in this application may be a protein, a nucleic acid sequence, or a mixture of protein and nucleic acid sequences, but is not limited thereto. In this case, the nucleic acid may be DNA, RNA, or a mixture of DNA and RNA.
[0145] The active ingredient in the composition for treating spinal cord injury of this application may be the Gsta4 protein or a nucleic acid sequence encoding the protein. In one specific embodiment, the active ingredient in the composition for treating spinal cord injury of this application may be a nucleic acid sequence encoding the Gsta4 protein.
[0146] The active ingredient in the composition for treating spinal cord injury diseases of this application may be Gsta4 protein or a nucleic acid sequence encoding the protein; and one or more conventional direct transdifferentiation factor proteins, or nucleic acid sequences encoding one or more conventional direct transdifferentiation factors.
[0147] As a specific example, the active ingredient of the composition for treating spinal cord injury diseases in this application may be a nucleic acid sequence encoding the Gsta4 protein; a nucleic acid sequence encoding the Hb9 protein; and a nucleic acid sequence encoding the Lhx3 protein.
[0148] In the following description, various forms in which the active ingredient of compositions for treating spinal cord injuries is a nucleic acid sequence will be described. It should be noted that this description is for illustrative purposes only and does not constitute a limitation.
[0149] For example, when the active ingredient of a composition used to treat spinal cord injury is in the form of a nucleic acid sequence, it can be contained in a vector.
[0150] Example of active ingredient form: carrier As another embodiment of this application, the composition for treating spinal cord injury diseases may include a vector containing a direct transdifferentiation factor nucleic acid sequence capable of expressing the active ingredient direct transdifferentiation factor in vivo.
[0151] Essential factors The vector for this application must contain a nucleic acid sequence encoding the Gsta4 protein.
[0152] The nucleic acid sequence encoding the Gsta4 protein can be the full-length sequence or a partial sequence of the Gsta4 gene.
[0153] For example, a partial sequence of the Gsta4 gene can be an exon sequence of Gsta4. In this case, the exon sequence can refer to a CDS (coding sequence) sequence obtained by removing introns from the Gsta4 gene sequence.
[0154] For example, the vector may contain a sequence of sequence number 2 or sequence number 12. In another embodiment, the vector may contain a sequence that has 70% to 100% homology with the sequence of sequence number 2 or sequence number 12.
[0155] Optional factors In addition to containing a nucleic acid sequence encoding the Gsta4 protein, the vector of this application may further contain a nucleic acid sequence encoding one or more conventional direct transdifferentiation factors.
[0156] The nucleic acid sequence encoding a conventional direct transdifferentiation factor can be the full-length sequence or a partial sequence of the conventional direct transdifferentiation factor. For example, a partial sequence of a conventional direct transdifferentiation factor can be an exon sequence of the conventional direct transdifferentiation factor.
[0157] As an example, the vector may optionally further comprise nucleic acid sequences encoding one or more factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.
[0158] When the vector further includes the optional factors, the vector can consist of one or more vectors. The vector can contain both essential and optional factors in one vector, or in two or more vectors. In other words, independent vectors can be used depending on the number of differentiation factors, or two or more differentiation factors can be combined and contained in one vector.
[0159] Carrier Examples The carrier must contain the above-mentioned required factors, and the optional factors can be combined in various ways, but are not limited to those described below.
[0160] Example (1): A vector containing only the essential factors The vector can contain a nucleic acid sequence encoding the Gsta4 protein.
[0161] For example, the vector may contain a sequence numbered 2 or 12.
[0162] As another example, the vector may contain a sequence that is 90% to 100% homologous to the sequence numbered 2 or 12.
[0163] Example (2): A carrier containing a required factor and an optional factor The vector may contain a nucleic acid sequence encoding the Gsta4 protein, and a nucleic acid sequence of a conventional direct transdifferentiation factor.
[0164] For example, the vector may contain a nucleic acid sequence encoding the Gsta4 protein and a nucleic acid sequence encoding the Ascl1 protein. In one specific embodiment, the vector may contain sequence numbers 2 and 18. In another specific embodiment, the vector may contain sequence numbers 12 and 18.
[0165] For example, the vector may contain a nucleic acid sequence encoding the Gsta4 protein and a nucleic acid sequence encoding the Brn2 protein. In one specific embodiment, the vector may contain sequence numbers 2 and 20. In another specific embodiment, the vector may contain sequence numbers 12 and 20.
[0166] For example, the vector may contain a nucleic acid sequence encoding the Gsta4 protein and a nucleic acid sequence encoding the Hb9 protein. In one specific embodiment, the vector may contain sequence numbers 2 and 14. In another specific embodiment, the vector may contain sequence numbers 12 and 14.
[0167] For example, the vector may contain a nucleic acid sequence encoding the Gsta4 protein and a nucleic acid sequence encoding the Lhx3 protein. As one specific embodiment, the vector may contain sequences numbered 2 and 16. In another specific embodiment, the vector may contain sequences numbered 12 and 16.
[0168] Example (3): A vector containing a required factor and two optional factors The vector may contain a nucleic acid sequence encoding the GSTA4 protein, as well as nucleic acid sequences of two conventional direct transdifferentiation factors.
[0169] For example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding the Hb9 protein; and a nucleic acid sequence encoding the Ngn2 protein. As one specific embodiment, the vector may contain sequences numbered 2, 14, and 26. As another specific embodiment, the vector may contain sequences numbered 12, 14, and 26.
[0170] For example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding the Lhx3 protein; and a nucleic acid sequence encoding the Ngn2 protein. As one specific embodiment, the vector may contain sequences numbered 2, 16, and 26. As another specific embodiment, the vector may contain sequences numbered 12, 16, and 26.
[0171] For example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding the Hb9 protein; and a nucleic acid sequence encoding the Isl1 protein. As one specific embodiment, the vector may contain sequences numbered 2, 14, and 24. As another specific embodiment, the vector may contain sequences numbered 12, 14, and 24.
[0172] For example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding the Ngn2 protein; and a nucleic acid sequence encoding the Isl1 protein. As one specific embodiment, the vector may contain sequences numbered 2, 26, and 24. As another specific embodiment, the vector may contain sequences numbered 12, 26, and 24.
[0173] For example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding the Hb9 protein; and a nucleic acid sequence encoding the Lhx3 protein. As one specific embodiment, the vector may contain sequences numbered 2, 14, and 16. As another specific embodiment, the vector may contain sequences numbered 12, 14, and 16.
[0174] The expression element of a vector. In addition to the aforementioned essential and optional components, the vector may further contain expression elements required for the expression of the target protein.
[0175] For example, the expression element may include a "regulatory element" that controls the expression of differentiation factors. Furthermore, the expression element may, as needed, include a "selection element" that facilitates the screening of differentiation factors.
[0176] The following examples include regulatory elements and selection elements of the vector, but may further include any elements known in the art for the effective expression of the target protein in the vector.
[0177] Regulation element The regulatory elements may include promoters, enhancers, polyadenylation signals, Kozak consensus sequences, ITRs (inverted terminal repeats), LTRs (long terminal repeats), terminators, origins of replication, multicloning sites (MCS), internal ribosome entry sites (IRES), and 2A self-cleaving peptides.
[0178] For example, the promoter can be the SV40 early promoter, LTR (mouse mammary tumor virus long terminal repeat) promoter, Ad MLP (adenovirus major late) promoter, HSV (herpessimplex virus) promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, U6 promoter, CBA promoter, PGK promoter, CAG promoter, etc.
[0179] For example, the 2A self-cleaving peptide can be T2A, P2A, E2A, F2A, etc. The vector used for expressing the differentiation factor can contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptide can generate multiple proteins in the same transcript. Therefore, the 2A self-cleaving peptide can be located between two or more different proteins intended to be expressed in the vector.
[0180] Select element The selected elements can be fluorescent protein genes, tags, reporter genes, or antibiotic resistance genes, etc.
[0181] For example, the fluorescent protein gene may be the GFP gene, YFP gene, RFP gene, or mCherry gene, etc.
[0182] For example, the tag may be a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, and a thioredoxin (Trx) tag, etc.
[0183] For example, the reporter gene may be glutathione S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, or β-glucuronidase, etc.
[0184] For example, the antibiotic resistance gene may be an ampicillin resistant gene, a hygromycin resistant gene, a neomycin resistant gene, a kanamycin resistant gene, a blasticidin resistant gene, or a zeocin resistant gene, etc.
[0185] Specific embodiments of the carrier Examples of the essential, optional and expressive elements of the aforementioned carrier will be described below, but are not limited to those described below.
[0186] The following examples are merely illustrations, and those skilled in the art can modify the design to express the target protein.
[0187] Example (1): A carrier containing a single GSTA4 As one embodiment of this application, the vector may contain a promoter and a nucleic acid sequence encoding the GSTA4 protein. In this case, the nucleic acid sequence encoding the GSTA4 protein may be derived from human. Preferably, the nucleic acid sequence encoding the GSTA4 protein may be the sequence numbered 2 or 12. In this case, the promoter may be a CBA promoter, PGK promoter, CMV promoter, or CAG promoter, etc. Preferably, the promoter may be a CMV promoter. In a specific embodiment, the sequence of the promoter may be the sequence numbered 37.
[0188] In one embodiment, the carrier of this application may include sequences numbered 37 and 2.
[0189] In another embodiment, the carrier of this application may include sequences numbered 37 and 12.
[0190] Example (2): A vector containing GSTA4 and a conventional direct transdifferentiation factor As another embodiment of this application, the vector may include a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding a conventional direct transdifferentiation factor.
[0191] As an example, the vector may contain a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the Ascl1 protein.
[0192] The vector may contain a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the Brn2 protein.
[0193] The vector may contain a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the MNX1 (Motor neuron and pancreas homeobox 1; also known as Hb9) protein.
[0194] The vector may contain a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the Lhx3 (LIM homeobox 3) protein.
[0195] In this case, the nucleic acid sequences encoding GSTA4 protein, Ascl1 protein, Brn2 protein, Hb9 protein, and Lhx3 protein can be human-derived sequences.
[0196] In one specific embodiment, For example, the nucleic acid sequence encoding the GSTA4 protein can be a sequence numbered 2 or 12; For example, the nucleic acid sequence encoding the Ascl1 protein could be the sequence numbered 18; For example, the nucleic acid sequence encoding the Brn2 protein may be the sequence numbered 20; For example, the nucleic acid sequence encoding the Hb9 (MNX1) protein could be the sequence numbered 14; For example, the nucleic acid sequence encoding the Lhx3 protein may be the sequence numbered 16.
[0197] In this case, the promoter contained in the vector in embodiment (2) can be selected from CBA promoter, PGK promoter, CMV promoter, CAG promoter, etc. Preferably, the promoter can be a CMV promoter. In a specific embodiment, the sequence of the CMV promoter can be the sequence numbered 37.
[0198] In this case, the vector of Example (2) may optionally further include a 2A self-cleaving peptide. In particular, when the vector of this application further includes a 2A self-cleaving peptide, the vector may contain nucleic acid sequences encoding two or more different proteins. In this case, the 2A self-cleaving peptide may be located between two or more different proteins.
[0199] The 2A self-cleaving peptide can be selected from T2A, P2A, E2A, F2A, etc. In one specific embodiment, the 2A self-cleaving peptide can be T2A or P2A. For example, P2A can be the sequence numbered 38, and T2A can be the sequence numbered 39.
[0200] As an arbitrary example, The vector may contain a promoter; a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding the Lhx3 protein.
[0201] The vector may contain a promoter; a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding the Lhx3 protein.
[0202] The vector may contain a promoter; a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding the Hb9 protein.
[0203] The vector may contain a promoter; a nucleic acid sequence encoding the GSTA4 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding the Hb9 protein.
[0204] As a specific example of embodiment (2), the carrier may contain the following sequence: Specific examples of vectors containing (promoter, Gsta4, MNX1): Serial numbers 37, 12 and 14; Serial number 37, serial number 2 and serial number 14.
[0205] Specific examples of vectors containing (promoter, Gsta4, 2A, MNX1): Serial numbers 37, 12, 38 and 14; Serial numbers 37, 12, 39 and 14; Serial number 37, serial number 2, serial number 38 and serial number 14; Serial number 37, serial number 2, serial number 39 and serial number 14.
[0206] Specific examples of vectors containing (promoter, Gsta4, Lhx3): Serial numbers 37, 12 and 16; Serial number 37, serial number 2 and serial number 16.
[0207] Specific examples of vectors containing (promoter, Gsta4, 2A, Lhx3): Serial numbers 37, 12, 38 and 16; Serial numbers 37, 12, 39 and 16; Serial number 37, serial number 2, serial number 38 and serial number 16; Serial number 37, serial number 2, serial number 39 and serial number 16.
[0208] Example (3): A vector containing GSTA4 and two conventional direct transdifferentiation factors As another example of this application, the vector may contain a nucleic acid sequence encoding the GSTA4 protein; and two nucleic acid sequences encoding known direct transdifferentiation factors.
[0209] As an example, the vector may contain a nucleic acid sequence encoding the GSTA4 protein, a nucleic acid sequence encoding the Hb9 protein, and a nucleic acid sequence encoding the Lhx3 protein.
[0210] At this time, the nucleic acid sequences encoding the GSTA4 protein, the Hb9 protein, and the Lhx3 protein can be human-derived sequences.
[0211] For example, the nucleic acid sequence encoding the GSTA4 protein may be sequence number 2 or sequence number 12.
[0212] For example, the nucleic acid sequence encoding the Hb9 protein could be sequence number 14.
[0213] For example, the nucleic acid sequence encoding the Lhx3 protein may be sequence number 16.
[0214] In this case, the promoter contained in the vector in embodiment (3) can be selected from CBA promoter, PGK promoter, CMV promoter, or CAG promoter, etc. Preferably, the promoter can be a CMV promoter. In a specific embodiment, the sequence of the CMV promoter can be the sequence shown in sequence number 37.
[0215] The carrier may optionally further comprise a 2A self-cleaving peptide. Preferably, the 2A self-cleaving peptide can be T2A, P2A, E2A, or F2A, etc. More preferably, the 2A self-cleaving peptide can be T2A or P2A. In a specific embodiment, P2A can be the sequence number 38, and T2A can be the sequence number 39. The 2A self-cleaving peptide can be located among three or more different proteins. Furthermore, in this case, the number of 2A self-cleaving peptides can be one or two. In particular, when there are two 2A self-cleaving peptides, they can be the same or different.
[0216] As an arbitrary example, The vector may contain the following components: a promoter; a nucleic acid sequence encoding the Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding the Lhx3 protein; and a nucleic acid sequence encoding the GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding the Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding the Lhx3 protein; and a nucleic acid sequence encoding the GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding the Hb9 protein; a nucleic acid sequence encoding the Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding the GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding the Hb9 protein; a nucleic acid sequence encoding the Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding the GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding P2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding P2A; and a nucleic acid sequence encoding GSTA4 protein; The vector may contain the following components: a promoter; a nucleic acid sequence encoding Hb9 protein; a nucleic acid sequence encoding T2A; a nucleic acid sequence encoding Lhx3 protein; a nucleic acid sequence encoding T2A; and a nucleic acid sequence encoding GSTA4 protein.
[0217] As a specific example of embodiment (3), the carrier may contain the following sequences: Specific examples of carriers containing (promoter, Gsta4, MNX1, and Lhx3) are as follows: Serial numbers 37, 12, 14 and 16; Serial number 37, serial number 2, serial number 14 and serial number 16; Specific examples of carriers containing (promoter, MNX12A, Lhx3, Gsta4) are as follows: Serial number 37, serial number 14, serial number 38, serial number 16 and serial number 2; Serial number 37, serial number 14, serial number 39, serial number 16 and serial number 2; Serial numbers 37, 14, 38, 16, and 12; Serial numbers 37, 14, 39, 16, and 12; Specific examples of carriers containing (promoter, MNX1, Lhx3, 2A, Gsta4) are as follows: Serial number 37, serial number 14, serial number 16, serial number 38 and serial number 2; Serial number 37, serial number 14, serial number 16, serial number 39 and serial number 2; Serial number 37, serial number 14, serial number 16, serial number 38 and serial number 12; Serial numbers 37, 14, 16, 39, and 12; Specific examples of vectors containing (promoter, MNX1, 2A, Lhx3, 2A, Gsta4) are as follows: Serial number 37, serial number 14, serial number 38, serial number 16, serial number 39 and serial number 2; Serial numbers 37, 14, 38, 16, 39 and 12; Serial number 37, serial number 14, serial number 39, serial number 16, serial number 38 and serial number 2; Serial numbers 37, 14, 39, 16, 38 and 12; Serial numbers 37, 14, 38, 16, 39 and 12; Serial numbers 37, 14, 39, 16, 38 and 12.
[0218] Types of carriers The carrier can be a viral carrier.
[0219] For example, the aforementioned viruses can be retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAV), vaccinia viruses, poxviruses, human immunodeficiency virus (HIV), mouse leukemia virus (MLV), avian sarcoma leukemia virus (ASLV), spleen necrosis virus (SNV), Rutger's sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, episomal virus, or herpes simplex virus, etc. Adeno-associated virus (AAV) is preferred.
[0220] In another example, the aforementioned vector could be a non-viral vector.
[0221] For example, the aforementioned non-viral vectors can be plasmids, bacteriophages, naked DNA, DNA-lipid complexes, DNA-polymer complexes, or mRNA, etc.
[0222] Function of the carrier: Delivery of the carrier The aforementioned vector is used to deliver the direct transdifferentiation factor of this application to cells for the treatment of spinal cord injury diseases.
[0223] In particular, in the case of a viral vector, a nucleic acid sequence encoding a direct transdifferentiation factor can be loaded into a viral capsid and delivered to the cell.
[0224] The most widely used viral vectors are lentiviral vectors, adenovirus vectors, and adeno-associated virus (AAV) vectors.
[0225] Lentiviral vectors are mainly used in in vitro therapy where cells extracted from a patient are modified in vitro before reinfusion.
[0226] Although adenovirus vectors can carry a large number of genes, they have the limitation of only being able to achieve transient expression.
[0227] Adeno-Associated Virus (AAV) vectors are widely used in therapeutic development because they overcome many of the problems associated with lentiviral and adenoviral vectors. AAV vectors can infect cells without cell division, and are therefore commonly used in the development of in vivo therapeutics. Consequently, AAV vectors are currently recognized as the safest and most effective of all viral vectors used for gene delivery to cells, and are the only therapeutics developed based on a viral vector that have received FDA approval in the United States. In this specification, "AAV vector" and "AAV particles" may be used interchangeably.
[0228] The composition of this application for treating spinal cord injury diseases can contain a direct transdifferentiation factor in the aforementioned AAV carrier and deliver it to the damaged spinal cord region. In other words, by administering the aforementioned AAV carrier to the damaged spinal cord region, it induces the expression of the direct transdifferentiation factor, thereby generating a large number of motor neurons and exerting a therapeutic effect.
[0229] The following will provide a more detailed description of the compositions containing the AAV carrier.
[0230] Compositions containing AAV carriers Another embodiment of this application relates to a composition comprising an AAV carrier for treating spinal cord injury diseases.
[0231] The composition of this application for treating spinal cord injury diseases contains an AAV carrier.
[0232] In one example, the AAV vector may contain a nucleic acid sequence encoding the GSTA4 protein.
[0233] In another example, the AAV vector may contain a nucleic acid sequence encoding the GSTA4 protein and the respective encoding nucleic acid sequences of one or more conventional direct transdifferentiation factor proteins.
[0234] The following will detail the structure and characteristics of AAV, AAV vectors containing GSTA4, and AAV vectors containing GSTA4 and traditional direct transdifferentiation factors.
[0235] Structure and characteristics of adeno-associated virus (AAV) Adeno-associated virus (AAV) used as a gene delivery vector consists of an icosahedral capsid with a diameter of 18–25 nm and a single-stranded DNA with a length of 4.7–6 kb inside.
[0236] The AAV genome has hairpin structures at both ends called ITRs (Inverted Terminal Repeats). ITRs are involved in AAV genome replication and AAV particle packaging.
[0237] In addition, the AAV genome contains two open reading frames (ORFs): the replication region (Rep) and the capsid region (Cap). These ORFs encode replication-related gene products and capsid-related gene products, respectively. Replication and capsid gene products are involved in the replication, assembly, and packaging of the complete AAV viral particle. The AAV replication region expresses four viral proteins, such as Rep 78, Rep 68, Rep 52, and Rep 40. Furthermore, the AAV capsid region encodes at least three proteins, such as VP1, VP2, and VP3.
[0238] In the following text, the term “AAV carrier” (also known as AAV particle or AAV) should be understood to include at least the capsid, ITR, and the active ingredient of this application.
[0239] Among them, ITR plays a role in the replication and packaging of signals in vector construction; capsid proteins not only constitute the capsid and encapsulate transdifferentiation factor DNA within it, but also determine tissue tropism, thereby delivering transdifferentiation factor DNA to target cells and tissues.
[0240] According to AAV serotype AAV has more than 20 serotypes and more than 100 variants, which can be appropriately selected and used by those skilled in the art as needed.
[0241] In this application, the AAVs that can be used for treatment may be selected from the following types: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, etc.
[0242] For example, the AAV may be AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9 or AAV10; in a specific example, the AAV may be AAV1, AAV2, AAV4, AAV9 or AAV10; in one embodiment, the AAV of this application may be AAV2.
[0243] In a preferred embodiment, the composition of this application for treating spinal cord injury diseases may employ an AAV2 vector. That is, the composition of this application for treating spinal cord injury diseases may contain an AAV2 vector comprising a nucleic acid sequence encoding a direct transdifferentiation factor. In one embodiment, the AAV2 vector may include an ITR, a replication region, a capsid region, and a nucleic acid sequence encoding a direct transdifferentiation factor.
[0244] Advantages of AAV carriers In this application, using the AAV carrier as a delivery carrier for the active ingredient may have the following advantages: Advantages (1): The AAV genome does not integrate into the host cell's genome, thus having extremely low genotoxicity and other safety issues.
[0245] Advantage (2): AAV vectors exist in the target cells in a stable epichromosomal form, enabling long-term gene expression.
[0246] Advantage (3): The AAV vector targets both dividing and non-dividing cells simultaneously. Therefore, it can target areas that are difficult to transfect, such as the central nervous system, muscles, and the eyeball. That is, cells present in the spinal cord injury site (central nervous system) of the treatment object of this application can be effectively used.
[0247] Advantage (4): The AAV vector does not contain viral structural genes and will not induce an immune response.
[0248] Advantage (5): AAV carriers can be produced under high-titer conditions.
[0249] The following will describe specific examples of the compositions of this application for treating spinal cord injury diseases: An AAV vector containing a nucleic acid sequence encoding the GSTA4 protein. And an AAV vector containing a nucleic acid sequence encoding the GSTA4 protein and a nucleic acid sequence encoding a common differentiation factor.
[0250] The above division is for illustrative purposes only and is not intended to impose any limitations on this application.
[0251] Examples of compositions containing AAV carriers For example, compositions for treating spinal cord injury diseases may contain an AAV vector comprising a nucleic acid sequence encoding the GSTA4 protein.
[0252] In another example, a composition for treating spinal cord injury may comprise an AAV vector including a nucleic acid sequence encoding the GSTA4 protein and a nucleic acid sequence encoding a conventional direct transdifferentiation factor. The conventional direct transdifferentiation factor may be selected from Ascl1, Brn2, Myt1L, Mnx1 (Motor neuron and pancreas homeobox 1, also known as Hb9), Isl1, Lhx3, Ngn2, and NeuroD1. Preferably, the composition for treating spinal cord injury may comprise an AAV vector including a nucleic acid sequence encoding the GSTA4 protein, a nucleic acid sequence encoding the Mnx1 protein, and a nucleic acid sequence encoding the Lhx3 protein.
[0253] The AAV carrier can be selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, etc.
[0254] In one example, the AAV carrier may be AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, AAV9, or AAV10. Specifically, the AAV may be AAV1, AAV2, AAV4, AAV9, or AAV10. In one embodiment, the AAV carrier may be AAV2.
[0255] Method for preparing a composition for treating spinal cord injury In another aspect of this application, a method for preparing a composition for treating spinal cord injury diseases is also provided.
[0256] As described above, the composition for treating spinal cord injury can be in various forms, such as protein, nucleic acid, or a mixture of protein and nucleic acid. Preparation methods for these various forms can be achieved using methods known to those skilled in the art.
[0257] The following description uses the preparation method of a composition for treating spinal cord injury containing an AAV carrier as an example, but this description does not constitute a limitation.
[0258] Method for preparing AAV vectors The AAV vector of this application can be prepared using methods known in the art.
[0259] The preparation of AAV vectors can usually be carried out by using more than three plasmids.
[0260] For example, a method for preparing an AAV vector may include the following steps; A first plasmid containing at least an ITR, a promoter, and a direct transdifferentiation factor; A second plasmid containing at least a nucleic acid sequence encoding a replication protein and / or a capsid protein; A third plasmid containing at least a sequence encoding a helper gene; Imported into host cells; AAV particles were extracted from the host cells.
[0261] At this time, the AAV particles can be AAV2 particles.
[0262] The AAV particle refers to a particle that at least contains a capsid, an ITR, and a direct transdifferentiation factor. In other words, the capsid of the AAV particle contains at least an ITR and a direct transdifferentiation factor.
[0263] In this case, the method for preparing the AAV vector can introduce the remaining plasmids into the host cell without introducing the third plasmid.
[0264] In one specific example, the first plasmid may include at least an ITR, a promoter, and a nucleic acid sequence encoding the GSTA4 protein. In this case, the AAV particle may be an AAV2 particle.
[0265] In another specific example, the first plasmid may include at least an ITR, a promoter, a nucleic acid sequence encoding the GSTA4 protein, a nucleic acid sequence encoding the Mnx1 protein, and a nucleic acid sequence encoding the Lhx3 protein.
[0266] In another specific example, the first plasmid may include at least an ITR, a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the Mnx1 protein.
[0267] In yet another specific example, the first plasmid may include at least an ITR, a promoter, a nucleic acid sequence encoding the GSTA4 protein, and a nucleic acid sequence encoding the Lhx3 protein.
[0268] The host cell can be a cell infected with the AAV vector. For example, the host cell can be HEK293, HEK293T, Huh-7, HeLa, HepG2, Hep1A, SV40, CHO, COS, MeWo, NIH3T3, A549, PERC6, HT1180, monocytes, dendritic cells, etc., but is not limited thereto. Preferably, the host cell can be HEK293T cells.
[0269] The replication protein can be Rep78, Rep68, Rep52, Rep40, etc.
[0270] The capsid protein can be VP1, VP2, VP3, etc.
[0271] The auxiliary gene can be E2A, E4, VA, etc.
[0272] The promoter can be a CBA promoter, PGK promoter, CMV promoter, CAG promoter, etc.
[0273] The method for preparing the AAV vector may further include culturing host cells in which the first plasmid to the third plasmid has been introduced.
[0274] In this case, the culture can continue until the first to third plasmids are introduced into the host cells and induce the expression of direct transdifferentiation factor. These culture conditions can be set by the experimenter based on the type of direct transdifferentiation factor used, the type of host cell, etc.
[0275] The operation for introducing the plasmid into the host cell can be selected and performed by appropriate methods known in the art.
[0276] For example, electroporation, gene gun, ultrasonic perforation, magnetic transfection, microinjection, temporary cell compression or squeezing, cationic liposomes, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, DEAE-dextran-mediated transfection, etc., but not limited to these methods, can be used.
[0277] At this point, there are no particular restrictions on the order in which the plasmid is introduced into the host cell.
[0278] The AAV particles described above can be manufactured in the form of exosomes or microparticles, but are not limited to these. Methods for extracting AAV particles can be employed using methods known in the art.
[0279] For example, methods for extracting AAV particles include centrifugation, precipitation, immunoprecipitation, affinity chromatography, filtration, magnetic beads coated with specific antibodies or aptamers, freeze-thaw method, ultrasonic disruption method, and commercially available kits.
[0280] AAV particles can be selectively concentrated using methods known to those skilled in the art. For example, the concentration methods may include, but are not limited to, immunomagnetic capture, organic flocculation, and PEG (polyethylene glycol) precipitation.
[0281] In addition, AAV particles can be selectively subjected to further quality testing. For example, such quality testing may include, but is not limited to, titer determination, sterility testing for bacteria and fungi, and mycoplasma detection testing.
[0282] The nucleic acid sequences encoding replication proteins and / or capsid proteins contained in the plasmid introduced into the host cell form an AAV capsid, and nucleic acid sequences containing ITRs, promoters, and direct transdifferentiation factors are introduced into the AAV capsid. AAV particles extracted from the host cell containing the plasmid can then enter the cell nucleus via receptors on the target cell surface. When the nucleic acid sequence encoding the direct transdifferentiation factor contained within the capsid is delivered to a subject, the nucleic acid sequence will express the corresponding direct transdifferentiation factor in vivo.
[0283] In a preferred specific example, the AAV particle of this application may be an AAV2 particle containing sequence list 2 or sequence list 12.
[0284] In another preferred specific example, the AAV particle of this application may be an AAV2 particle containing sequence listings 2, 14 and 16.
[0285] In yet another preferred embodiment, the AAV particle of this application may be an AAV2 particle containing sequence listings 12, 14 and 16.
[0286] Multiple uses of compositions for treating spinal cord injuries Another aspect of this application relates to various uses of compositions for treating spinal cord injuries.
[0287] The composition for treating spinal cord injury may be used for pharmaceutical purposes, kits, etc.
[0288] The following will describe its pharmaceutical uses and reagent kit.
[0289] Uses (1): Pharmaceutical uses The compositions described in this application can be used to treat individuals in need of treatment. For example, the compositions for treating spinal cord injuries can be used for pharmaceutical purposes.
[0290] Pharmaceutical Composition Another aspect of this application discloses a composition for treating spinal cord injury as a pharmaceutical composition.
[0291] The pharmaceutical composition may contain the above-mentioned active ingredients as the active ingredients of the pharmaceutical composition.
[0292] The active ingredient may be one of the following (1) or (2).
[0293] (1) GSTA4 protein or the nucleic acid sequence encoding it. (2) GSTA4 protein or its encoding nucleic acid sequence; and existing direct transdifferentiation factor protein or its encoding nucleic acid sequence.
[0294] In this case, the existing direct transdifferentiation factor can be one or more of one to eight selected from Ascl1, Brn2, Myt1L, Hb9 (MNX1), Isl1, Lhx3, Ngn2 and NeuroD1.
[0295] Preferably, the existing direct transdifferentiation factor can be a nucleic acid sequence encoding Hb9 (MNX1) protein or a nucleic acid sequence encoding Lhx3 protein. Most preferably, the existing direct transdifferentiation factor can be a nucleic acid sequence encoding both Hb9 (MNX1) protein and Lhx3 protein.
[0296] Furthermore, the indications for the pharmaceutical composition, the delivery of the active ingredient, and other related information are the same as those described in "Compositions for the Treatment of Spinal Cord Injury".
[0297] For example, the pharmaceutical composition of this application may be an AAV carrier containing an active ingredient.
[0298] As an example, the pharmaceutical composition of this application may comprise an AAV vector containing a nucleic acid sequence encoding GSTA4. In this case, the AAV vector may be an AAV2 vector or an AAV4 vector. Preferably, the AAV vector is an AAV2 vector.
[0299] In another arbitrary example, the pharmaceutical composition of this application may comprise an AAV vector encoding a nucleic acid sequence encoding GSTA4, a nucleic acid sequence encoding Hb9 protein, and a nucleic acid sequence encoding Lhx3 protein. In this case, the AAV vector may be an AAV2 vector or an AAV4 vector. Preferably, the AAV vector is an AAV2 vector.
[0300] In another example, the pharmaceutical composition of this application may be AAV particles containing an active ingredient.
[0301] Optionally, the pharmaceutical composition of this application may comprise AAV particles containing a nucleic acid sequence encoding GSTA4. In this case, the AAV particles may be AAV2 particles or AAV4 particles. Preferably, the AAV particles are AAV2 particles.
[0302] In another arbitrary example, the pharmaceutical composition of this application may comprise AAV particles containing a nucleic acid sequence encoding GSTA4, a nucleic acid sequence encoding Hb9 protein, and a nucleic acid sequence encoding Lhx protein. In this case, the AAV particles may be AAV2 particles or AAV4 particles. Preferably, the AAV particles are AAV2 particles.
[0303] Additional components of a pharmaceutical composition In addition to the active ingredient, the pharmaceutical composition may optionally further contain pharmaceutically acceptable additional components.
[0304] In this application, the term "pharmaceutically acceptable" means, within the bounds of reasonable medical judgment and based on a reasonable benefit / risk ratio, a material, composition, and / or form of administration suitable for use in contact with human or animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications.
[0305] The pharmaceutically acceptable additive can be a physiologically acceptable substance that contributes to the stability, solubility, absorption, or delivery efficiency of the active ingredient of this application. For example, the pharmaceutically acceptable additive can be a carrier, solvent, diluent, preservative, etc., but is not limited thereto.
[0306] For example, the carrier, solvent, and diluent may include lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, distilled water, physiological saline, glycerol, ethanol, human serum albumin (HSA), etc.
[0307] For example, the preservative can be benzoic acid, sodium benzoate, sorbic acid, p-hydroxybenzoic acid, chlorobutanol, etc.
[0308] When formulating the pharmaceutical composition, it may further include fillers, diluents, binders, wetting agents, etc.
[0309] Formulation of pharmaceutical compositions The pharmaceutical composition can be formulated into oral or non-oral formulations.
[0310] For example, when formulated into an oral preparation, it can be prepared as a solid dosage form, liquid dosage form, suspension, granules, capsules, semi-solid form, etc.
[0311] In another example, when formulated into a non-oral formulation, it can be prepared as an injection, aerosol, etc. Preferably, it can be formulated into an injection.
[0312] In the case of injectable formulations, methods known in the art can be further implemented to prolong the drug's effect and delay its absorption as needed. For example, an injectable depot form can be prepared by encapsulating the active ingredient using a biodegradable polymer. Alternatively, an injectable depot form can be prepared by encapsulating the active ingredient in liposomes or microemulsions.
[0313] Specific examples of pharmaceutical compositions The following describes examples of pharmaceutical compositions, but is not intended to limit the scope of the description.
[0314] Example of composition (1): A pharmaceutical composition containing the GSTA4 protein or its encoding nucleic acid sequence For example, the pharmaceutical composition of this application for treating spinal cord injury may contain the GSTA4 protein or its encoded nucleic acid sequence.
[0315] In another example, the pharmaceutical composition of this application for treating spinal cord injury may include a promoter; and the GSTA4 protein or its encoding nucleic acid sequence.
[0316] In this case, the promoter can be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter can be a CMV promoter. In one specific embodiment, the sequence of the promoter can be the sequence numbered 37 in the sequence listing.
[0317] In another example, the pharmaceutical composition of this application for treating spinal cord injury may include: promoter; GSTA4 protein or the nucleic acid sequence encoding this protein; And selected from at least one of pharmaceutically acceptable solvents, carriers, diluents, and preservatives.
[0318] In this case, the promoter, pharmaceutically acceptable solvent, carrier, diluent, preservative, etc., are the same as those described above.
[0319] In a specific example, the pharmaceutical composition of this application for treating spinal cord injury may include: Sequence list number 37; Sequence list number 2 or 12; And buffer solutions containing at least one of sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and poloxamer 188.
[0320] In this case, the pharmaceutical composition can be formulated into an injectable formulation.
[0321] Example of composition (2): Contains the GSTA4 protein or a nucleic acid sequence encoding the protein; and the MNX1 (Hb9) protein or a sequence encoding the protein. Pharmaceutical compositions containing the nucleic acid sequence of this protein For example, the pharmaceutical composition for treating spinal cord injury of this application may include, GSTA4 protein or the nucleic acid sequence encoding the protein; and MNX1 (Hb9) protein or the nucleic acid sequence encoding the protein.
[0322] In another example, the pharmaceutical composition of this application for treating spinal cord injury may comprise: promoter; GSTA4 protein or its encoding nucleic acid sequence; and MNX1 (Hb9) protein or its encoding nucleic acid sequence.
[0323] At this time, the promoter can be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter can be a CMV promoter. In a specific example, the sequence of the promoter can be the sequence numbered 37.
[0324] In another example, the pharmaceutical composition of this application for treating spinal cord injury may comprise: promoter; GSTA4 protein or the nucleic acid sequence encoding it; MNX1 (Hb9) protein or the nucleic acid sequence encoding it; and One or more components selected from pharmaceutically acceptable carriers, solvents, diluents, and preservatives.
[0325] In this case, the promoter, pharmaceutically acceptable carrier, solvent, diluent, preservative, etc., are the same as those described above.
[0326] As a specific example, the pharmaceutical composition for treating spinal cord injury according to this application may comprise: The sequence number is 37; The sequence numbered 2; The sequence numbered 14; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and poloxamer 188.
[0327] In another specific example, the pharmaceutical composition of this application for treating spinal cord injury may comprise: The sequence number is 37; The sequence numbered 12; The sequence numbered 14; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and poloxamer 188.
[0328] In this case, the pharmaceutical composition can be formulated as an injectable.
[0329] Example of composition (3): Contains GSTA4 protein or its encoding nucleic acid sequence; and Lhx3 protein or its encoding nucleic acid sequence. pharmaceutical compositions For example, the pharmaceutical composition for treating spinal cord injury according to this application may contain, GSTA4 protein or its encoding nucleic acid sequence; and Lhx3 protein or its encoding nucleic acid sequence.
[0330] In another example, the pharmaceutical composition may include, promoter; GSTA4 protein or its encoding nucleic acid sequence; and Lhx3 protein or its encoding nucleic acid sequence.
[0331] In this case, the promoter can be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter can be a CMV promoter. In a specific example, the sequence of the promoter can be the sequence numbered 37.
[0332] In another example, the pharmaceutical composition of this application for treating spinal cord injury may include: promoter; GSTA4 protein or the nucleic acid sequence encoding this protein; The Lhx3 protein or the nucleic acid sequence encoding the protein; and One or more of a pharmaceutically acceptable carrier, solvent, diluent, or preservative.
[0333] In this case, the promoter, pharmaceutically acceptable carrier, solvent, diluent, preservative, etc., are the same as those described above.
[0334] In a specific example, the pharmaceutical composition for treating spinal cord injury according to this application may include, Serial number 37; Serial number 2; Serial number 16; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and Poloxamer 188.
[0335] In a specific example, the pharmaceutical composition for treating spinal cord injury according to this application may include, Serial number 37; Serial number 12; Serial number 16; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and Poloxamer 188.
[0336] In this case, the pharmaceutical composition can be formulated into an injectable formulation.
[0337] Example of composition (4): Contains GSTA4 protein or its encoding nucleic acid sequence, MNX1 (Hb9) protein or its encoding nucleic acid sequence List, and pharmaceutical compositions of Lhx3 protein or its encoded nucleic acid sequence.
[0338] For example, the pharmaceutical composition for treating spinal cord injury of this application may contain, GSTA4 protein or its encoding nucleic acid sequence; MNX1 (Hb9) protein or its encoding nucleic acid sequence; and Lhx3 protein or its encoding nucleic acid sequence.
[0339] In another example, the pharmaceutical composition of this application for treating spinal cord injury may include, promoter; GSTA4 protein or its encoding nucleic acid sequence; MNX1 (Hb9) protein or its encoding nucleic acid sequence; and Lhx3 protein or its encoding nucleic acid sequence.
[0340] At this time, the promoter can be a CBA promoter, a PGK promoter, a CMV promoter, or a CAG promoter. Preferably, the promoter can be a CMV promoter. In a specific example, the sequence of the promoter can be the sequence numbered 37.
[0341] For example, the pharmaceutical composition for treating spinal cord injury of this application may contain, promoter; GSTA4 protein or the nucleic acid sequence encoding this protein; The Lhx3 protein or the nucleic acid sequence encoding the protein; MNX1 (Hb9) protein or the nucleic acid sequence encoding this protein; and One or more pharmaceutically acceptable carriers, solvents, diluents, or preservatives.
[0342] In this case, the promoter, pharmaceutically acceptable carrier, solvent, diluent, preservative, etc., are the same as those described above.
[0343] In a specific example, the pharmaceutical composition for treating spinal cord injury according to this application may include, Serial number 37; Serial number 2; Serial number 14; Serial number 16; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and poloxamer 188.
[0344] In another specific example, the pharmaceutical composition of this application for treating spinal cord injury may include, Serial number 37; Serial number 12; Serial number 14; Serial number 16; and A buffer solution containing one or more of the following: sodium chloride, potassium chloride, potassium dihydrogen phosphate, disodium hydrogen phosphate, and poloxamer 188.
[0345] In this case, the above-mentioned pharmaceutical composition can be formulated into an injectable form.
[0346] Application (2): Reagent kit As another embodiment of this application, a kit comprising a composition for treating spinal cord injury is disclosed.
[0347] The kit may include one or more containers containing instructions for use prepared in accordance with methods known in the art. Typically, the instructions for use contain instructions on administering the pharmaceutical composition for the treatment, diagnosis, or prevention of a disease.
[0348] The instruction manual may include information regarding the intended treatment dosage, dosing schedule, and route of administration.
[0349] As an example, the instruction manual may include information such as dosage, dosing schedule, and route of administration when using the composition for treating spinal cord injury of this application to treat spinal cord injury.
[0350] The kit may further include one or more containers. For example, the containers may be vials, bottled containers, etc.
[0351] The container may contain the composition of this application for treating spinal cord injury, and the type of container may be determined according to the form of the composition for treating spinal cord injury.
[0352] 2. Methods for treating spinal cord injuries This section will outline methods used to treat spinal cord injuries. Another aspect of this application relates to a method for treating spinal cord injury diseases.
[0353] The spinal cord injury disease is the same as described above.
[0354] The method for treating spinal cord injury utilizes the aforementioned pharmaceutical composition.
[0355] As described above, the pharmaceutical composition of this application for treating spinal cord injury diseases contains a direct transdifferentiation factor.
[0356] In particular, the method for treating spinal cord injury diseases of this application has the advantage of being able to be directly administered to the site of the injured spinal cord. This allows it to function as an in vivo therapeutic drug because the pharmaceutical composition for treating spinal cord injury diseases of this application has the following characteristics: Feature (1): The direct transdifferentiation factor contained in the pharmaceutical composition for treating spinal cord injury can directly transdifferentiate somatic cells into motor neurons.
[0357] Feature (2): The nucleic acid sequence encoding the direct transdifferentiation factor can be delivered to target cells via an AAV vector.
[0358] Therefore, the treatment method for spinal cord injury described in this application can serve as an alternative to overcome the limitations of existing treatment methods for spinal cord diseases.
[0359] The following will explain the treatment methods and dosages for spinal cord injury.
[0360] Treatment The treatment methods for spinal cord injury diseases described in this application include: The drug composition (therapeutic agent) for treating spinal cord injury is administered to the test subject.
[0361] The pharmaceutical composition may be in the form of a carrier, a cellular form containing a carrier, a protein form, or a cellular form containing a protein, but is not limited thereto. Preferably, the pharmaceutical composition may be in the form of a carrier. More preferably, the pharmaceutical composition may be in the form of an AAV carrier (AAV particles).
[0362] As an example, a method of treating traumatic spinal cord injury may include administering a drug to a subject, said administration comprising a pharmaceutical composition comprising an AAV vector encoding a nucleic acid sequence encoding a direct transdifferentiation factor.
[0363] As a specific example, a method for treating spinal cord injury may include administering a drug to a subject, said administration comprising a pharmaceutical composition containing an AAV vector encoding a nucleic acid sequence encoding the Gsta4 protein. Preferably, the AAV vector may be an AAV2 vector.
[0364] As another specific example, a method of treating spinal cord injury may include administering a drug to a subject, said administration comprising a pharmaceutical composition containing an AAV vector encoding a nucleic acid sequence encoding a Gsta4 protein and a nucleic acid sequence encoding an Lhx3 protein. Preferably, the AAV vector may be an AAV2 vector.
[0365] As another specific example, a method for treating traumatic spinal cord injury may include administering a drug to a subject, said administration comprising a pharmaceutical composition containing an AAV vector comprising a nucleic acid sequence encoding a Gsta4 protein and a nucleic acid sequence encoding an Hb9 (MNX1) protein. Preferably, the AAV vector may be an AAV2 vector.
[0366] As another specific example, a method for treating traumatic spinal cord injury may include administering a drug to a subject, said administration comprising a pharmaceutical composition containing an AAV vector encoding a nucleic acid sequence encoding a Gsta4 protein; a nucleic acid sequence encoding an Hb9 (MNX1) protein; and a nucleic acid sequence encoding an Lhx3 protein. Preferably, the AAV vector may be an AAV2 vector.
[0367] Drug recipients The treatment methods for spinal cord injury diseases are applicable to individuals with spinal cord injury, or individuals with impaired motor neuron function or a reduced number of motor neurons, but are not limited to these.
[0368] The subjects may be mammals that require treatment or prevention of spinal cord injury diseases.
[0369] For example, the mammal may be a human, dog, horse, cat, mouse, rat, pig, rabbit, sheep, monkey, chimpanzee, etc. Preferably, the object is a human.
[0370] Administration method The spinal cord injury treatment agent of this application can be administered to subjects through various routes as needed in clinical practice.
[0371] Administration may be by oral or non-oral administration. In this case, non-oral administration may be by injection.
[0372] In the aforementioned injection administration, the administration site can be the injured spinal cord, muscle, intradermal, subcutaneous, vein, abdominal cavity, artery, mucosa, spinal cord, bone marrow, intrathecal, percutaneous, etc. Preferably, it is directly injected into the injured spinal cord site.
[0373] For example, when the administration site is the damaged spinal cord, it can be L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), T8 (thoracic 8), T9 (thoracic 9), T10 (thoracic 10), T11 (thoracic 11), T12 (thoracic 12), T13 (thoracic 13), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 (cervical 4), C5 (cervical 5), C6 (cervical 6), C7 ... 7), C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3) or S4 (sacrum 4), etc.
[0374] In subjects with L4 spinal cord injury, an AAV vector (AAV particle) containing a nucleic acid sequence encoding the GSTA4 protein or a pharmaceutical composition containing the vector can be delivered to the L4 site of the spinal cord.
[0375] In subjects with L5 spinal cord injury, an AAV vector (AAV particle) containing a nucleic acid sequence encoding the GSTA4 protein or a pharmaceutical composition containing the vector can be delivered to the L5 site of the spinal cord.
[0376] In subjects with spinal cord injury between L4 and L5, an AAV vector (AAV particle) containing a nucleic acid sequence encoding the GSTA4 protein or a pharmaceutical composition containing the vector can be administered to the L4-L5 region of the spinal cord.
[0377] As a specific example, methods for treating spinal cord injuries may include: In subjects with spinal cord injury between L4 and L5, an AAV vector (AAV particle) or a pharmaceutical composition containing a nucleic acid sequence encoding the GSTA4 protein is administered between L4 and L5 of the spinal cord.
[0378] As another specific example, methods for treating spinal cord injuries may include: In subjects with spinal cord L4-L5 lesions, an AAV vector (AAV particle) or a pharmaceutical composition containing the same is administered to the L4-L5 region of the spinal cord.
[0379] As another specific example, methods for treating spinal cord injuries may include: In subjects with spinal cord L4-L5 lesions, an AAV vector (AAV particle) or a pharmaceutical composition containing the same is administered to the L4-L5 region of the spinal cord.
[0380] As another specific example, methods for treating spinal cord injuries may include: In subjects with spinal cord L4-L5 lesions, AAV vectors (AAV particles) or drug compositions containing the following are administered to the L4-L5 region of the spinal cord. These particles contain nucleic acid sequences encoding GSTA4 protein, MNX1 (Hb9) protein, and Lhx3 protein.
[0381] Administration dose The dosage of the pharmaceutical composition of this application may be determined based on factors such as the disease type, administration site, weight, age, and degree of disease progression of the test subject, but is not limited thereto.
[0382] Furthermore, the dosage can be determined within a range that provides a reasonable benefit / risk ratio for the pharmaceutical composition within the scope of medical judgment, and without causing excessive toxicity, irritation, allergic reactions, or other problems.
[0383] As an example, when the pharmaceutical composition of this application is prepared in a form containing an AAV carrier (AAV particles), it may contain the following dosage range.
[0384] For example, when the test subjects are humans, The dosage of AAV particles that can be administered is selected from 1x10 5 GC (genome copy) / kg, 1x10 6 GC / kg, 1x10 7 GC / kg, 1x10 8 GC / kg, 1x10 9 GC / kg, 1x10 10 GC / kg, 1x10 11 GC / kg, 1x10 12 GC / kg, 1x10 13 GC / kg, 1x10 14GC / kg, 1x10 15 GC / kg, 1x10 16 GC / kg, 1x10 17 GC / kg, 1x10 18 GC / kg, 1x10 19 GC / kg, 1x10 20 Dosage within two numerical ranges in GC / kg.
[0385] The content of AAV contained in the above-mentioned pharmaceutical composition can be appropriately determined by those skilled in the art based on the dosage of the AAV.
[0386] In a specific example, the method for treating spinal cord injury according to this application may include: using 1x10 5 GC / kg to 1x10 15 AAV particles containing a nucleic acid sequence encoding the GSTA4 protein are administered to test subjects at a dose of GC / kg. Preferably, the AAV particles can be administered at a rate of 1 x 10⁻⁶. 6 GC / kg to 1x10 12 Administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6 x 10⁻⁶. 8 GC / kg up to 5x10 11 The AAV particles are administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6.7 x 10⁻⁶. 8 GC / kg up to 3.3x10 11 The AAV particles are administered at a dose of GC / kg. In one embodiment, the AAV particles may be administered at a dose of 2.5 x 10⁻⁶. 9 The AAV particles are administered at a dose of GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7 x 10⁻⁶. 8 Administer at a dose of GC / kg.
[0387] In another specific example, the method for treating spinal cord injury according to this application may include: using 1x10 5 GC / kg to 1x10 15 AAV particles containing the nucleic acid sequence encoding the GSTA4 protein and the nucleic acid sequence encoding the Lhx3 protein were administered to the test subjects at a dose of GC / kg. Preferably, the AAV particles can be administered at a concentration of 1x10⁻¹⁰. 6 GC / kg to 1x10 12 Administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6 x 10⁻⁶. 8 GC / kg up to 5x10 11 The AAV particles are administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6.7 x 10⁻⁶. 8 GC / kg up to 3.3x10 11The AAV particles are administered at a dose of GC / kg. In one embodiment, the AAV particles may be administered at a dose of 2.5 x 10⁻⁶. 9 The AAV particles are administered at a dose of GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7 x 10⁻⁶. 8 Administer at a dose of GC / kg.
[0388] In another specific example, the method for treating spinal cord injury according to this application may include: using 1x10 5 GC / kg to 1x10 15 AAV particles containing the nucleic acid sequence encoding the Gsta4 protein and the nucleic acid sequence encoding the Hb9 (MNX1) protein were administered to the test subjects at a dose of GC / kg. Preferably, the AAV particles could be administered at a concentration of 1x10. 6 GC / kg to 1x10 12 Administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6 x 10⁻⁶. 8 GC / kg up to 5x10 11 The AAV particles are administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6.7 x 10⁻⁶. 8 GC / kg up to 3.3x10 11 The AAV particles are administered at a dose of GC / kg. In one embodiment, the AAV particles may be administered at a dose of 2.5 x 10⁻⁶. 9 The AAV particles are administered at a dose of GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7 x 10⁻⁶. 8 Administer at a dose of GC / kg.
[0389] In another specific example, the method for treating spinal cord injury according to this application may include: using 1x10 5 GC / kg to 1x10 15 AAV particles encoding the Gsta4 protein nucleic acid sequence, the Hb9 (MNX1) protein nucleic acid sequence, and the Lhx3 (LIM homeobox 3) protein nucleic acid sequence were administered to the test subjects at a dose of GC / kg. Preferably, the AAV particles can be administered at a concentration of 1x10. 6 GC / kg to 1x10 12 Administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6 x 10⁻⁶. 8 GC / kg up to 5x10 11 The AAV particles are administered at a dose of GC / kg. More preferably, the AAV particles can be administered at a dose of 6.7 x 10⁻⁶. 8 GC / kg up to 3.3x10 11 The AAV particles are administered at a dose of GC / kg. In one embodiment, the AAV particles may be administered at a dose of 2.5 x 10⁻⁶. 9The AAV particles are administered at a dose of GC / kg. In another embodiment, the AAV particles may be administered at a dose of 6.7 x 10⁻⁶. 8 Administer at a dose of GC / kg.
[0390] In another example, when the subjects were non-human animals, It can be contained in 1x10 5 GC (genome copy) / head, 1x10 6 GC / head, 1x10 7 GC / head, 1x10 8 GC / head, 1x10 9 GC / head, 1x10 10 GC / head, 1x10 11 GC / head, 1x10 12 GC / head, 1x10 13 GC / head, 1x10 14 GC / head, 1x10 15 GC / head, 1x10 16 GC / head, 1x10 17 GC / head, 1x10 18 GC / head, 1x10 19 GC / head, 1x10 20 The dose of AAV particles selected within two numerical ranges in GC / head. Here, GC / head refers to the dose of genome copy (GC) administered to each test animal.
[0391] In a specific example, the method for treating spinal cord injury of this application can deliver AAV particles containing a nucleic acid sequence encoding the GSTA4 protein at a density of 1x102 5 GC / head up to 1x10 15 The GC / head is administered to the test subject at a dose. Preferably, the dose of the AAV particles can be 1 x 10⁻⁶. 6 GC / head up to 1x10 12 GC / head. More preferably, the dose of the AAV particles can be 2x10⁻¹⁰. 7 GC / head up to 1x10 10 GC / head.
[0392] In another specific example, the method for treating spinal cord injury of this application can deliver AAV particles containing a nucleic acid sequence encoding a GSTA4 protein and a nucleic acid sequence encoding an Lhx3 protein at a density of 1x102 5 GC / head up to 1x1015 The AAV particles are administered to the test subjects at a GC / head dose. Preferably, the AAV particles can be administered at a dose of 1x10. 6 GC / head up to 1x10 12 GC / head dosage. More preferably, the AAV particles can be administered at 2x10... 7 GC / head up to 1x10 10 Dosage administration of GC / head.
[0393] In another specific example, the method for treating spinal cord injury of this application can deliver AAV particles containing a nucleic acid sequence encoding GSTA4 protein and a nucleic acid sequence encoding Hb9 (MNX1) protein at a density of 1x10⁻¹⁰. 5 GC / head up to 1x10 15 The AAV particles are administered to the test subjects at a GC / head dose. Preferably, the AAV particles can be administered at a dose of 1x10. 6 GC / head up to 1x10 12 GC / head dosage. More preferably, the AAV particles can be administered at 2x10... 7 GC / head up to 1x10 10 Dosage administration of GC / head.
[0394] In another specific example, the method for treating spinal cord injury of this application can deliver AAV particles containing nucleic acid sequences encoding GSTA4 protein, Hb9 (MNX1) protein, and Lhx3 protein at a density of 1x10-1. 5 GC / head up to 1x10 15 The AAV particles are administered to the test subjects at a GC / head dose. Preferably, the AAV particles can be administered at a dose of 1x10. 6 GC / head up to 1x10 12 GC / head dosage. More preferably, the AAV particles can be administered at 2x10... 7 GC / head up to 1x10 10 Dosage administration of GC / head.
[0395] The dosage can be determined based on data obtained from cell culture and / or animal studies and / or human clinical trials. Here, methods known in the art can be used to determine the range of dosages for human use based on dosages obtained from animal studies or preclinical trials.
[0396] For example, the following formula can be used to estimate the dosage range for human administration: HED (Human Equivalent Dose) = animal NOAEL x (Wanimal / W human ) (1-b) The NOAEL (No Observed Adverse Effect Level) refers to the non-toxic dose.
[0397] In another example, the dosage range for human administration can be determined using a formula and can be selected to be lower than the MRSD (Maximum Recommended Starting Dose). The MRSD value can be calculated using the following formula: MRSD = HED / SF Here, each 1 μL of the pharmaceutical composition may contain 1 x 10 5 GC (genome copy), 1x10 6 GC, 1x10 7 GC, 1x10 8 GC, 1x10 9 GC, 1x10 10 GC, 1x10 11 GC, 1x10 12 GC, 1x10 13 GC, 1x10 14 GC, 1x10 15 GC, 1x10 16 GC, 1x10 17 GC, 1x10 18 AAV doses selected from two numerical ranges in GC.
[0398] In one example, each 1 μL of the pharmaceutical composition of this application may contain 1 x 10 5 GC to 1x10 16 GC's AAV. Preferably, each 1 μL of pharmaceutical composition may contain 1 x 10 5 GC to 1x10 14 GC's AAV. More preferably, each 1 μL of pharmaceutical composition may contain 2 x 10 5 GC up to 3.0x10 13 GC's AAV.
[0399] In one specific example, each 1 μL of the pharmaceutical composition of this application may contain 1 x 10 5 GC to 1x10 16 AGC-containing AAV (Analogous Antigen Array) containing a nucleic acid sequence encoding the GSTA4 protein. Preferably, the AAV can be 1x10⁻⁶. 5 GC to 1x10 14GC. More preferably, the AAV can be 2x10. 5 GC up to 3.0x10 13 GC.
[0400] In another specific example, each 1 μL of the pharmaceutical composition of this application may contain 1 x 10 5 GC to 1x10 16 AGC-encoded AAV containing a nucleic acid sequence encoding the GSTA4 protein and a nucleic acid sequence encoding the Lhx3 protein. Preferably, the AAV can be 1x10^6. 5 GC to 1x10 14 GC. More preferably, the AAV can be 2x10. 5 GC up to 3.0x10 13 GC.
[0401] In another specific example, each 1 μL of the pharmaceutical composition of this application may contain 1 x 10 5 GC to 1x10 16 AGC-encoded AAV containing a nucleic acid sequence encoding the GSTA4 protein and a nucleic acid sequence encoding the Hb9 (MNX1) protein. Preferably, the AAV can be 1x10⁻⁶. 5 GC to 1x10 14 GC. More preferably, the AAV can be 2x10. 5 GC up to 3.0x10 13 GC.
[0402] In another specific example, each 1 μL of the pharmaceutical composition of this application may contain 1 x 10 5 GC to 1x10 16 AGC-encoded AAV containing nucleic acid sequences encoding GSTA4, Hb9 (MNX1) protein, and Lhx3 protein. Preferably, the AAV can be 1x10^6 nucleotides. 5 GC to 1x10 14 GC. More preferably, the AAV can be 2x10. 5 GC up to 3.0x10 13 GC.
[0403] The administration volume of the pharmaceutical composition can be selected according to factors such as the administration method and the test subject.
[0404] For example, the dosage volume can be from 1 μL to 20 mL each time, but is not limited to this.
[0405] In one example, when the test subject is a human being, when the pharmaceutical composition of this application is directly administered to the spinal cord of the affected human being, it can be 1μL, 2μL, 3μL, 4μL, 5μL, 6μL, 7μL, 8μL, 9μL, 10μL, 11μL, 12μL、13μL、14μL、15μL、16μL、17μL、18μL、19μL、20μL、21μL、22μL、23μL、24μL、25μL、26μL、27μL、28μL、29μL、30μL μL, 31μL, 32μL, 33μL, 34μL, 35μL, 36μL, 37μL, 38μL, 39μL, 40μL, 41μL, 42μL, 43μL, 44μL, 45μL, 46μL, 47μL, 48μL, 49μL, 50μL, 51μL, 52μL, 53μL, 54μL, 55μL, 56μL, 57μL, 58μL, 59μL, 60μL, 61μL, 62μL, 63μL, 64μL, 65μL, 66μL, 6 7μL, 68μL, 69μL, 70μL, 71μL, 72μL, 73μL, 74μL, 75μL, 76μL, 77μL, 78μL, 79μL, 80μL, 81μL, 82μL, 83μL, 84μL, 85μL, 86μL, 87μL, 88μL, 89μL, 90μL, 91μL, 92μL, 93μL, 94μL, 95μL, 96μL, 97μL, 98μL, 99μL, 100μL, 110μL, 120μL, 13 0μL、140μL、150μL、200μL、250μL、300μL、350μL、400μL、450μL、200μL、250μL、300μL、350μL、400μL、450μL、500μ L, 600μL, 700μL, 800μL, 900μL, 950μL, 1mL, 2mL, 3mL, 4mL, 5mL, 6mL, 7mL, 8mL, 9mL, 10mL, the dose volume of the selected two values is administered.
[0406] In one specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 10 μL to 200 μL per dose. In another specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 10 μL to 100 μL per dose. In another specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 10 μL to 90 μL per dose. In another specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 20 μL to 80 μL per dose. In another specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 20 μL to 70 μL per dose. In another specific example, when the pharmaceutical composition is administered directly to a damaged human spinal cord, it can be administered in a volume of 20 μL to 60 μL per dose. In another specific embodiment, when the pharmaceutical composition is administered directly to the damaged spinal cord of a human, it can be administered in a volume of 30 μL to 60 μL per administration. In any embodiment, when the pharmaceutical composition is administered directly to the damaged spinal cord of a human, it can be administered in a volume of 40 μL to 60 μL per administration. Most preferably, when the pharmaceutical composition is administered directly to the damaged spinal cord of a human, it can be administered in a volume of 50 μL per administration.
[0407] In another example, when the test subject is a non-human animal, the pharmaceutical composition of this application can be directly administered to the damaged spinal cord of a human at doses of 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, 6 μL, 7 μL, 8 μL, 9 μL, 10 μL, 11 μL, 12 μL, 13 μL, 14 μL, 15 μL, 16 μL, 17 μL, 18 μL, 19 μL, 20 μL, 21 μL, 22 μL, 23 μL, 24 μL, 25 μL, 26 μL, 27 μL, 28 μL, 29 μL, etc. 30μL, 31μL, 32μL, 33μL, 34μL, 35μL, 36μL, 37μL, 38μL, 39μL, 40μL, 41μL, 42μL, 43μL, 44μL, 45μL, 46μL, 47μL, 48 μL, 49μL, 50μL, 51μL, 52μL, 53μL, 54μL, 55μL, 56μL, 57μL, 58μL, 59μL, 60μL, 61μL, 62μL, 63μL, 64μL, 65μL, 66μL , 67μL, 68μL, 69μL, 70μL, 71μL, 72μL, 73μL, 74μL, 75μL, 76μL, 77μL, 78μL, 79μL, 80μL, 81μL, 82μL, 83μL, 84μL, 8 5μL, 86μL, 87μL, 88μL, 89μL, 90μL, 91μL, 92μL, 93μL, 94μL, 95μL, 96μL, 97μL, 98μL, 99μL, 100μL, 110μL, 120μL, The drug can be administered in volumes selected from two numerical ranges: 130 μL, 140 μL, 150 μL, 200 μL, 250 μL, 300 μL, 350 μL, 400 μL, 450 μL, 200 μL, 250 μL, 300 μL, 350 μL, 400 μL, 450 μL, 500 μL, 600 μL, 700 μL, 800 μL, 900 μL, 950 μL, 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL, 7 mL, 8 mL, 9 mL, and 10 mL. The non-human animal referred to here can be a mouse, rat, chimpanzee, monkey, dog, pig, etc., but is not limited to these.
[0408] In one specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 100 μL per administration. In another specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 80 μL per administration. In another specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 70 μL per administration. In another specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 60 μL per administration. In another specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 50 μL per administration. In another specific example, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 30 μL per administration. In another specific embodiment, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 20 μL per administration. In another specific embodiment, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 10 μL per administration. In any embodiment, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 1 μL to 5 μL per administration. Most preferably, when the pharmaceutical composition is administered directly to the damaged spinal cord of a non-human animal, it can be administered in a volume of 2 μL per administration.
[0409] Dosage cycle The administration period of the pharmaceutical composition of this application to the test subjects can be determined based on factors such as the disease and severity of the disease in the test subjects.
[0410] The dosage can be once or multiple times daily, or it can be administered multiple times over a longer period of time. Alternatively, it can be administered at intervals.
[0411] The dosing interval can be from 1 to 30 days, etc. In this case, it can be continuous or non-continuous dosing.
[0412] Confirmation of treatment effect After the method for treating the spinal cord injury disease is applied to the subject, it can be confirmed in a variety of ways whether the spinal cord injury disease is relieved, improved or treated.
[0413] For example, it can be confirmed by reducing scar tissue, changes in the expression of neuronal markers, BBB scores, action potentials, and spontaneous responses.
[0414] In one example, when using the method described for treating spinal cord injury, scarring can be reduced by approximately 2 to 50 times.
[0415] In another example, when using the method described for treating spinal cord injury, the expression of neural cell markers can increase by approximately 2 to 50 times.
[0416] In another example, when using the aforementioned method for treating spinal cord injury, the BBB score can increase by approximately 2 to 50 times.
[0417] In another example, when using the method described for treating spinal cord injury, the action potentials or spontaneous responses can exhibit similar behavior to those of a normal individual.
[0418] The concentration, dosage, and administration cycle used in the method for treating the aforementioned spinal cord injury can be easily determined and prescribed by doctors, veterinarians, and other technical personnel in the art based on the effective therapeutic amount.
[0419] For example, doctors or veterinarians can gradually increase or decrease the dosage if the desired therapeutic effect is not achieved until it is reached. Furthermore, doctors or veterinarians can determine the effective dosage and duration of administration based on the subject's condition.
[0420] Furthermore, the method for treating spinal cord injury of this application can be used in conjunction with adjuvant therapies to achieve rapid recovery and / or treatment of spinal cord injury. The adjuvant therapies may include physical therapy, rehabilitation therapy, and the administration of anticonvulsant drugs and / or antidepressants.
[0421] Treatment or recovery of damaged spinal cord In this application, treatment or recovery of the damaged spinal cord refers to the treatment of spinal cord injury diseases. In particular, since the composition of this application for treating said spinal cord injury diseases contains the direct transdifferentiation factor GSTA4, it refers to "treatment of spinal cord injury diseases through the generation of motor neurons".
[0422] Specifically, the mechanism by which motor neurons are generated due to GSTA4 can be expected to include the following three scenarios; however, the treatment of the damaged spinal cord described in this application is not limited to the following three scenarios, but also includes all possible mechanism hypotheses that can be foreseen by those skilled in the art.
[0423] GSTA4-mediated generation of motor neurons (1): Direct transdifferentiation of abnormally increased astrocytes into motor neurons Motor neurons.
[0424] Compositions containing GSTA4 can generate motor neurons by directly transdifferentiating somatic cells within the damaged spinal cord into motor neurons. In one example, in the damaged spinal cord, there is an abnormal increase in astrocytes, while motor neurons are lost. In this case, the composition containing GSTA4 acts on the astrocytes, causing them to directly transdifferentiate into motor neurons, from which the generated motor neurons can achieve treatment or recovery of the damaged spinal cord.
[0425] GSTA4-mediated generation of motor neurons (2): Repair of apoptotic motor neurons.
[0426] When the spinal cord is damaged, motor neurons within it may undergo apoptosis. When a composition containing GSTA4 acts on the damaged spinal cord, it can directly transdifferentiate apoptotic motor neurons into new motor neurons, thereby generating new motor neurons. For example, motor neurons in the damaged spinal cord may undergo apoptosis due to the apoptotic program, but they may not be degraded and remain intact. In this case, the composition containing GSTA4 can act on these apoptotic motor neurons, causing them to directly transdifferentiate into normal motor neurons. The resulting new motor neurons can achieve the treatment or recovery of the damaged spinal cord.
[0427] GSTA4-mediated generation of motor neurons (3): recovery of motor neurons that have not apoptosis but whose function has declined (or degenerated). The function of neurons.
[0428] When the spinal cord is injured, the function of the motor neurons present in the spinal cord may decline. In other words, when the function of motor neurons declines, the muscles they stimulate may become weak and unable to function properly. For example, when a composition containing GSTA4 is applied to the damaged spinal cord, the declining motor neurons can be directly transdifferentiated into normally functioning motor neurons. The resulting normally functioning motor neurons can be used to treat or improve the damaged spinal cord.
[0429] The present invention will be described in more detail below through experimental examples.
[0430] These experimental examples are only used to illustrate the invention in more detail. The scope of the invention is not limited by these embodiments, as will be apparent to those skilled in the art to which this invention pertains.
[0431] Experimental materials ● Carrier Design In the following experiments, the vector used was the AAV vector (Cell Biolabs, INC., VPK-402). A schematic diagram of the AAV vector used to introduce differentiation factors is shown below. Figure 1 As shown.
[0432] Figure 1 The DNA sequences corresponding to the vector diagrams shown are as specific examples of the vectors used: Figure 1 (a) is sequence number 36; Figure 1 (b) is sequence number 3; Figure 1 (c) is sequence number 4; Figure 1 (d) is sequence number 5; Figure 1 (e) is sequence number 29.
[0433] Figure 1 (a) indicates a nucleic acid sequence encoding human GSTA4; Figure 1 (b) indicates a nucleic acid sequence containing the following: the nucleic acid sequence encoding human ASCL1; the nucleic acid sequence encoding human NEUROG2; the nucleic acid sequence encoding human ISL1; and the nucleic acid sequence encoding human LHX3. Figure 1 (c) indicates a nucleic acid sequence containing the following: the nucleic acid sequence encoding human BRN2; the nucleic acid sequence encoding human MNX1 (Motor neuron and pancreas homeobox 1; also known as Hb9); and the nucleic acid sequence encoding human NeuroD1. Figure 1 (d) indicates a nucleic acid sequence encoding human GSTA4; and a nucleic acid sequence encoding human MYT1L; Figure 1 (e) indicates a nucleic acid sequence containing the human GSTA4; the human MNX1; and the human LHX3.
[0434] ● Preparation of AAV AAVs were prepared using the 293T cell line. 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Thermo Fisher, #12430112) supplemented with 10% fetal bovine serum (Thermo Fisher, #26140079) and 1% antibiotic-antimyotic (Thermo Fisher, #15240096) at 37°C and 5% CO2. Figure 1The AAV vector, pHelper, and pRepCap were transfected into 293T cells and cultured for 48 hours. Subsequently, AAV Virus particles containing differentiation factors were extracted using the AAV Virus particle extraction process. The prepared AAV Virus particles may also be referred to as "AAV" or "AAV particles" below.
[0435] ● Cell culture and intracellular AAV delivery Culture and introduction of fibroblasts into AAV containing differentiation factors Human dermal fibroblasts (Sigma, 106-05A) were cultured in fibroblast growth medium (Sigma, 116-500) containing 10% fetal bovine serum (Thermo Fisher, #26140079) and 1% antibiotic-antimycotic (Thermo Fisher, #15240096) at 37°C and 5% CO2.
[0436] Human dermal fibroblasts were sampled at a concentration of 0.025 x 10⁻⁶. 6 Cells were seeded at a density of cells / well in 24-well plates. 24 hours after seeding, AAV containing transdifferentiation factor (hereinafter, for convenience, "AAV containing transdifferentiation factor" will be abbreviated as "transdifferentiation factor") was treated.
[0437] Twenty-four hours after treatment with the transdifferentiation factor, the medium was replaced with fibroblast growth medium. Twenty-four hours later, it was replaced with neural induction medium. The medium was then changed every two days. From days 14 to 17, the fixed cells were subjected to immunofluorescence staining.
[0438] Mouse embryonic fibroblasts were cultured in DMEM (Gibco) medium containing 10% fetal bovine serum (Thermo Fisher, #26140079) and 1% penicillin / streptomycin (Gibco) at 37°C and 5% CO2.
[0439] Mouse embryonic fibroblasts were used at a concentration of 0.025 x 10⁻⁶. 6 Cells were seeded at a density of [number] cells / well in 24-well plates. Twenty-four hours after seeding, cells were treated with transdifferentiation factor. Twenty-four hours after transdifferentiation factor treatment, the medium was replaced with DMEM. Twenty-four hours later, the medium was replaced with neural induction medium. The medium was then changed every two days. Immunofluorescence staining was performed on fixed cells between days 14 and 17.
[0440] Culture of mouse-derived primary astrocytes containing transdifferentiation factors AAV transduction The meninges of ICR P1 pups were dissected and removed, and then minced using sterile scissors or a razor. The tissue was transferred to 50 ml centrifuge tubes, and 3 ml of TrypLE™ Express Enzyme (Gibco) and 20 μl of 0.5 M ascorbic acid (Sigma) were added. The mixture was thoroughly mixed by tapping the 50 ml centrifuge tubes and then incubated at 37°C for 20 minutes. Subsequently, the mixture was diluted with 10 ml of glial medium (DMEM + 1% L-glu (Gibco) + 1% P / S). Fresh glial medium was then added every two days. On day 9, once the glial cells had reached confluence with T75 culture flasks, the flasks were placed on an orbital shaker in a 37°C incubator and shaken at 60 rpm for 30 minutes. The flasks were then equilibrated at 37°C for 4 hours. Next, the T75 culture flasks were shaken at 245 rpm for 18-20 hours in a 37°C incubator using an orbital shaker. Finally, the cells were passaged and dispensed according to the required cell volume for the experiment.
[0441] Primary astrocytes derived from mice were used at a concentration of 0.2–0.6 x 10⁻⁶. 6Cells were seeded at a density of [number] cells / well in 24-well plates. Twenty-four hours after seeding, cells were treated with transdifferentiation factor. Twenty-four hours after transdifferentiation factor treatment, the medium was replaced with DMEM. Twenty-four hours later, the medium was replaced with neural induction medium. The medium was then changed every two days. Immunofluorescence staining was performed on fixed cells between days 14 and 17.
[0442] ● Immunofluorescence staining To perform cell fixation, the cells were washed twice with PBS (Gibco) for 5 minutes each time.
[0443] Then add 4% paraformaldehyde (Thermo Fisher) and incubate at room temperature for 10 minutes.
[0444] To perform permeabilization, PBS containing 0.1% Triton X-100 was added, and the cells were incubated at room temperature for 10 minutes. The cells were then washed three times with PBS for 5 minutes each time.
[0445] For blocking and immunostaining, 1% BSA + PBST (PBS + 0.1% Tween 20) was added and incubated at room temperature for 30 minutes. Primary antibodies against ChAT (Invitrogen, 1:1000), Map2 (Millipore, 1:200), and Tuj1 (Beta III Tubulin) (Abcam, 1:1000) were used. The primary antibodies were diluted in 1% BSA + PBST and incubated overnight at 4°C. After washing three times with PBS (5 minutes each time), the secondary antibody Alexa Fluor™ 488 / 594 (Thermo Fisher, 1:1000) was diluted in 1% BSA + PBST and incubated at room temperature in the dark for 1 hour. Finally, after washing three times with PBS (5 minutes each time), DAPI staining was performed.
[0446] ● RNA extraction and cDNA synthesis Approximately 14–17 days after inoculation and culture of cells, transdifferentiation factor was applied, followed by digestion with trypsin (ThermoFisher) and collection of 2 x 10⁻⁶ cells. 6Centrifuge cells at 13,000 rpm for 10 seconds. After removing the supernatant, add 1 ml of easy-Blue™ (iNtRON) and vortex for 10 seconds, then add 200 μl of chloroform and vortex again. Centrifuge at 13,000 rpm for 10 minutes, then transfer 400 μl of upper fluid to a new 1.5 ml centrifuge tube. Add 400 μl of isopropanol (2-propanol; Sigma), invert 2-3 times, and incubate at room temperature (RT) for 10 minutes. Centrifuge at 13,000 rpm for 5 minutes, then remove the supernatant. Add 1 ml of 75% ethanol (EtOH; Sigma) and invert 2-3 times. Centrifuge at 10,000 rpm for 5 minutes at 4°C, then remove the supernatant. After drying at room temperature for 5 minutes, add 20 μl of distilled water to dissolve the RNA. The resulting RNA is stored at -70°C.
[0447] AccuPower® CycleScript™ RT PreMix & Master Mix (Bioneer) for cDNA synthesis.
[0448] ● Real-time quantitative reverse transcription PCR (qRT-PCR) To confirm whether fibroblasts or astrocytes differentiate into motor neurons, qPCR (SYBRGreen Real-time PCR Master Mix, TOYOBO) was used. To verify whether fibroblasts or astrocytes underwent transdifferentiation into motor neurons, the expression levels of Synapsin, Map2, and Hb9 in the cells were detected by qRT-PCR. The results confirmed that Synapsin, Map2, and Hb9 were highly expressed in cells induced to differentiate into motor neurons.
[0449] The primers used are shown in the table below.
[0450] Table 1
[0451] ● Cell Viability Assay In a 96-well plate, at 0.2 x 10⁻⁶ mm. 5Primary mouse astrocytes were seeded at a density of / well. After treatment with experimental materials, the cells were incubated at 37°C for 20 hours. MTS reagent (Promega, G3582) was added to the pre-prepared cells in 96-well plates, and the plates were incubated at 37°C for 30 minutes. After gentle shaking, absorbance was measured using a microplate reader (Allsheng, AMR-100) with an OD value set to 490 nm.
[0452] ● Spinal cord injury disease mouse - SCI mouse model creation To create a mouse model of lower body paralysis due to spinal cord injury (SCI), ICR mice were anesthetized via intraperitoneal injection of avertin (125–250 mg / kg). After anesthesia, the animals were fixed on the operating table. The surgical site (back) was disinfected with povidone-iodine and 70% ethanol and allowed to dry thoroughly. After confirming the effectiveness of the anesthesia, the skin around the spine was disinfected again with povidone-iodine solution and incised. After removing the T13 portion of the vertebra, the spinal cord nerve bundles were injured using forceps equipped with a digital caliper (Cixi Duxan) to a thickness of 0.35 mm for 30 seconds. Following the spinal cord injury, the surgical site was sutured with surgical sutures. Postoperatively, the mice were placed on a preheated heating pad (37°C) and observed until they regained consciousness. Upon awakening from anesthesia, an analgesic (Ketoprofen 1 mg / kg) was administered subcutaneously to alleviate severe pain. After regaining consciousness, the mice were housed in a rearing room and observed for 3 weeks. For a period after surgery, an infrared irradiator was used to maintain a warm environment to prevent a drop in body temperature. The above-mentioned SCI mouse model, after injury to the L4-L5 region of the spinal cord (corresponding to T13-L1 vertebrae), was finally used for experiments 5 weeks later.
[0453] ● Administration of test substances in SCI mouse models Surgical procedures were performed on all experimental groups using sterilized instruments to avoid contamination during the procedure. Animals were anesthetized via intraperitoneal injection of the anesthetic avertin (125-250 mg / kg) before administration. After anesthesia, the animals were secured to the operating table. The surgical site (back) was disinfected with povidone-iodine and 70% ethanol and then thoroughly dried. To expose the spine, a vertical incision was made in the muscles adjacent to the administration site using a scalpel blade. Care was taken to avoid damaging nerves and blood vessels. After confirming the administration site under a stereomicroscope, the needle of a Hamilton syringe (needle gauge 33) was tilted approximately 20-30° towards the lumbar spine and inserted into the administration site, the L4-L5 region of the SCI mouse model injury. 2 μl of the prepared test substance was microinjected using an infusion pump at a rate of approximately 1 μl / min. After approximately 2 minutes, the needle was slowly withdrawn from the spinal cord. Following administration, the incised muscles and skin were sutured shut.
[0454] ● Behavioral testing The behavioral test included the measurable motor function of the Basso Beattie and Bresnahan (BBB) score test. The BBB score test was conducted in accordance with the Standard Operating Procedure EXP-SOP-012 (Basso, Beattie, and Bresnahan (BBB) score test).
[0455] The BBB score of the prepared AAV was measured weekly before and after administration, and from 1 week to 8 weeks after administration. At this time, the prepared AAV was a composition containing Gsta4, Mnx1, and Lhx3 (hereinafter referred to as STUP-001).
[0456] If the score is statistically significantly higher than that of the control group, the treated active substance (denoted as STUP-001 in this experimental example) is considered to have an effective therapeutic effect. The analysis rules are as follows: the BBB scores of all animals are expressed as measured values in the table below, and the graphs use corrected BBB scores. To perform inter-individual correction, the following formula is used for evaluation, with the baseline being the average BBB score of each animal from week 1 to week 4 post-surgery.
[0457] Corrected BBB score = BBB score (weeks) BBB score (benchmark) ● Physiological testing Electrical responses of motor neurons were recorded using patch clamp in ex vivo spinal cord sections according to the method described by Shim HS et al. (2019). The biopsied lumbar spinal cord sections were refrigerated (4°C) and transversely sectioned to a thickness of 350 μm in a mixed gas (95% oxygen, 5% carbon dioxide) saturated NMDG (N-methyl-D-glucamine) aqueous solution (mM: 93 NMDG, 2.5 KCl, 1.2 NaH2PO4, 30 NaHCO3, 20 HEPES, 25 glucose, 5 sodium ascorbate, 2 thiourea, 3 sodium pyruvate, 10 MgSO4 and 0.5 CaCl2, pH 7.4). Whole-cell electroreactivity (ECR) of motor neurons in the ventral horn of the spinal cord was recorded in artificial cerebrospinal fluid (aCSF in mM: 124 NaCl, 2.5 KCl, 1.2 NaH2PO4, 24 NaHCO3, 5 HEPES, 12.5 glucose, 2 MgSO4, and 2 CaCl2, pH 7.4). ECR measurements were acquired using a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA), DigiDATA (Molecular Devices, Sunnyvale, CA), and pClamp software (version 10.6, Molecular Devices). Patch pipettes were measured using a resistance of 4–8 MΩ and filled with an internal solution (in mM: 120 K-gluconate, 10 KCl, 2 Mg-ATP, 0.5 Na-GTP, 0.5 EGTA, 20 HEPES, and 10 phosphocreatine, pH 7.3). Action potentials of motor neurons were measured using a current step (from 0 pA to 140 pA, 20 pA per step).
[0458] ● Protein Quantitative Detection Protein quantification at the drug administration site was performed using an ELISA kit. The levels of MAP2 and CHAT protein, neuronal markers, at the drug administration site were examined in all experimental animals, and the results are presented in tables and graphs. Information on the ELISA kits used is shown in Table 2 below.
[0459] Table 2
[0460] ● Weight measurement The body weight of the mouse model was measured before administration of the test substance, and thereafter weekly and on the day of dissection. Fasting body weight was measured on the day of dissection.
[0461] ● Functional observation and testing All surviving animals were assessed during the final week of the observation period (approximately week 13 after drug administration). The assessment included: auditory responses, positive reflexes, pain responses, auricular reflexes, and threat reflexes in stimulus responsiveness tests; gripping tests to assess neurological and muscular status; and assessment of the animals' locomotor activity outside their cages.
[0462] Experiment 1: Verifying the direct transdifferentiation effect of Gsta4 into motor neurons within cells. Experiment 1-1: Introducing GSTA4 into mouse fibroblasts Introducing AAV containing GSTA4 into mouse-derived fibroblasts ( Figure 1 (a)). From approximately day 14 to 17 post-AAV introduction, Gsta4-induced direct transdifferentiation from fibroblasts to neurons was confirmed by immunofluorescence staining and qPCR. Figure 3 ).
[0463] In differentiated cells, high levels of expression of the motor neuron marker ChAT and the mature neuron marker Map2 were confirmed by immunofluorescence staining. Furthermore, changes in the expression of the synapse formation marker Synapsin, the mature neuron marker Map2, and the mature neuron marker Hb9 were detected by qPCR, thus verifying the direct transdifferentiation of fibroblasts into neurons.
[0464] The results showed that, when Gsta4 was treated alone, the expression levels of Synapsin were confirmed to be approximately 4-fold higher than those of the control group (labeled as control), Map2 was approximately 5-fold higher than those of the control group (labeled as control), and Hb9 was approximately 2-fold higher than those of the control group (labeled as control).
[0465] This means that the Gsta4 factor has the function of directly transdifferentiating fibroblasts into nerve cells.
[0466] Experimental Example 1-2: Introducing GSTA4 into primary mouse astrocytes The Gsta4-containing AAV used in 1-1 above was introduced into primary astrocytes derived from mice. Immunofluorescence staining confirmed the differentiation of Gsta4-induced astrocytes into neural cells (see [link to original text]). Figure 5 and Figure 6 ).
[0467] High levels of expression of the neuronal marker Tuj1 and the mature neuronal marker Map2 were confirmed in differentiated cells using immunofluorescence staining.
[0468] In the control group (labeled as control), neither Tuj1 nor Map2 was expressed. However, when Gsta4 was treated alone, both Tuj1 and Map2 showed significantly increased expression of neuronal cell markers compared to the control group, with the number of immunostaining positive cells increasing by approximately 40-50 times and 20-30 times, respectively.
[0469] This means that the Gsta4 factor has the function of directly transdifferentiating mouse-derived primary astrocytes into nerve cells.
[0470] The results of Experiment Example 1 above show that Gsta4 has the function of effectively converting somatic cells into motor neurons (direct transdifferentiation).
[0471] Experiment Example 2: Verifying the direct transdifferentiation effect of known differentiation factors into motor neurons within cells. In Example 1, it was confirmed that Gsta4 can directly transdifferentiate somatic cells into motor neurons on its own. Furthermore, the direct transdifferentiation efficiency of Gsta4 was compared with existing known direct transdifferentiation efficiencies. To this end, known direct transdifferentiation factors were introduced into cells, and the degree of their direct transdifferentiation into motor neurons was verified.
[0472] Experimental Example 2-1: Comparison with the effects of known direct transdifferentiation factors Conventional differentiation factors were introduced into mouse-derived fibroblasts, and the expression levels of neuronal markers Synapsin and Map2 were detected by qPCR to confirm their differentiation into motor neurons (see [link to relevant documentation]). Figure 4 (a)).
[0473] When the representative conventional differentiation factors Ascl1 and Brn2 were treated separately, the expression level of Synapsin increased by about 1.5 to 2 times compared with the control group (labeled as control), while the expression level of Map2 was almost the same as that of the control group (labeled as control), with basically no increase.
[0474] The above results were compared with those of Gsta4 alone in this application (Experimental Example 1). As previously stated, Gsta4 in this application increased the expression level of Synapsin by approximately 4 times compared to the control group (labeled as control), and the expression level of Map2 by approximately 5 times compared to the control group (labeled as control). That is, compared with the effects of conventionally known differentiation factors, Gsta4 in this application has a significantly higher differentiation efficiency in directly transdifferentiating somatic cells into motor neurons.
[0475] In addition, conventional differentiation factors MNX1 and Lhx3 were introduced into primary astrocytes derived from mice, and the expression of neural cell markers Tuj1 and Map2 was detected by immunofluorescence staining, thereby comparing them with Gsta4 of this application.
[0476] like Figure 5 and Figure 6 As shown, when conventional differentiation factors MNX1 and Lhx3 were treated alone, the expression levels of Tuj1 and Map2 were almost no different from those in the control group. In contrast, when treated with GSTA4 alone, the number of cells with positive immunostaining neuronal cell markers Tuj1 and Map2 increased by about 10 to 15 times compared with the MNX1 and Lhx3 treatment groups alone.
[0477] The experimental results above show that, compared with the conventional known differentiation factors (Ascl1, Brn2, MNX1, Lhx3) in their ability to induce somatic cells to directly transdifferentiate into motor neurons, Gsta4 of the present invention has a significantly higher differentiation ability in directly transdifferentiating somatic cells into motor neurons.
[0478] This indicates that the Gsta4 of the present invention may have great application value in the regeneration and generation of motor neurons.
[0479] Experimental Example 2-2: Combination of Conventional Direct Transdifferentiation Factors Although the above-mentioned Experiment 2-1 has confirmed that Gsta4 alone can exhibit excellent direct transdifferentiation effect of somatic cells into motor neurons, the inventors further wish to compare its differentiation effect with that of two or more conventionally known differentiation factors used in combination.
[0480] To this end, human fibroblasts were treated with a combination of various conventional differentiation factors, and their differentiation into motor neurons was detected by qPCR. The expression of neuronal markers Synapsin, Map2, and Hb9 was then confirmed. Figure 4 (b)).
[0481] Combine the first group: Ascl1, Brn2, and Myt1l (labeled as ABM); Combination 2: Hb9, Isl1, Lhx3 combination (marked as HIL); They were processed into human fibroblasts.
[0482] At this point, both the first and second combinations increased the expression level of Synapsin by approximately 1.5 to 3 times compared to the control group (labeled as control), the expression level of Map2 by approximately 1 to 4 times compared to the control group, and the expression level of Hb9 by approximately 1 to 1.5 times compared to the control group.
[0483] In Example 1, when Gsta4 was treated alone, Synapsin expression increased approximately 4-fold and Map2 expression increased approximately 5-fold compared to their respective control groups. Even when the three conventional differentiation factors were combined, the direct transdifferentiation efficiency to motor neurons was lower than that of Gsta4 alone in this invention. These results indicate that Gsta4 of this invention has a superior direct transdifferentiation effect compared to partial combinations of conventional differentiation factors.
[0484] The results of Experiment Example 2 show that Gsta4 has a very high direct transdifferentiation efficiency compared to conventionally known factors, and is a novel "direct transdifferentiation factor that induces motor neurons".
[0485] Experimental Example 3: Confirmation of the enhanced direct transdifferentiation effect caused by Gsta4 combination therapy The inventors wish to further confirm the effects of combining Gsta4 with known direct transdifferentiation factors.
[0486] Experimental Example 3-1: Comparison of MNX1 and Gsta4+MNX1 In primary astrocytes derived from mice, the effects of direct transdifferentiation were compared between groups that received MNX1 alone via AAV and groups that received Gsta4+MNX1 co-introduction.
[0487] The degree of differentiation was detected by immunofluorescence staining, confirming the expression of the neural cell marker Tuj1 and the mature neural cell marker Map2 (see [link to original text]). Figure 5 and Figure 6 ).
[0488] The results showed that the number of Tuj1-expressing cells was slightly increased compared to the control group (labeled as control) when the conventional differentiation factor MNX1 was treated alone; however, when the combination of Gsta4 and MNX1 was treated (labeled as Gsta4+MNX1), the number of Tuj1-expressing cells was confirmed to increase by about 8 to 20 times or more.
[0489] The number of cells expressing Map2 was almost undetectable when treated alone with the conventional differentiation factor MNX1; however, when treated with the combination of Gsta4 and MNX1 (labeled as Gsta4+MNX1), the number of cells expressing Map2 was confirmed to increase by more than 50-fold.
[0490] These results confirm that when the highly efficient somatic cell-to-motor neuron direct transdifferentiation factor GSTA4 of this application is used in conjunction with the conventional differentiation factor MNX1, the direct transdifferentiation efficiency is further increased.
[0491] That is, in the case of Gsta4+MNX1, an unexpected and significant direct transdifferentiation effect can be observed.
[0492] Experimental Example 3-2: Comparison of Lhx3 and Gsta4+Lhx3 In primary astrocytes derived from mice, the effects of direct transdifferentiation were compared between the Lhx3-only group and the Gsta4+Lhx3 co-introduction group introduced with AAV.
[0493] The degree of differentiation was detected by immunofluorescence staining, confirming the expression of the neural cell marker Tuj1 and the mature neural cell marker Map2 (see [link to original text]). Figure 5 and Figure 6 ).
[0494] The results showed that the number of Tuj1-expressing cells was slightly increased compared to the control group (labeled as control) when the conventional differentiation factor Lhx3 was treated alone; however, when the combination of Gsta4 and Lhx3 was treated (labeled as Gsta4+Lhx3), the number of Tuj1-expressing cells was confirmed to increase by about 8 to 20 times or more.
[0495] The number of cells expressing Map2 was almost undetectable when treated alone with the conventional differentiation factor Lhx3; however, when treated with the combination of Gsta4 and Lhx3 (labeled as Gsta4+Lhx3), the number of cells expressing Map2 was confirmed to increase by more than 20-fold.
[0496] These results confirm that when the highly efficient somatic cell-to-motor neuron direct transdifferentiation factor GSTA4 of this application is used in conjunction with the conventional differentiation factor Lhx3, the direct transdifferentiation efficiency is further increased.
[0497] That is, in the case of treating Gsta4+Lhx3, an unexpected and significant direct transdifferentiation effect can be observed.
[0498] Experimental Example 3-3: Comparison of Mnx1 + Lhx3 and Gsta4 + Mnx1 + Lhx3 3-3-1. Direct transdifferentiation of mouse-derived fibroblasts In mouse-derived fibroblasts, the effects of direct transdifferentiation were compared between the Mnx1+Lhx3 group and the Gsta4+Mnx1+Lhx3 co-introduction group, respectively, by introducing AAV.
[0499] To confirm and compare the degree of differentiation, the expression levels of neural cell markers were detected using immunofluorescence staining and qPCR (see [link to study]). Figure 7 and Figure 8 For reference, the case of processing Gsta4 alone (labeled as Gsta4) is also shown in the figure.
[0500] First, analysis of immunofluorescence staining revealed that, compared to the conventional combination of differentiation factors Mnx1 and Lhx3 (labeled as Mnx1+Lhx3), the number of cells positive for neuronal markers increased by approximately 40-fold when treated with the combination of Gsta4 and Mnx1, Lhx3 (labeled as Gsta4+Mnx1+Lhx3) (see [link to original text]). Figure 7 ).
[0501] In addition, the expression levels of neural cell markers (Synapsin, Map2) were detected by qPCR (see [link to qPCR]). Figure 8 ).
[0502] The results showed that, compared with the treatment of the combination of conventional differentiation factors Mnx1 and Lhx3 (labeled as Mnx1+Lhx3), the treatment of the combination of Gsta4 and Mnx1 and Lhx3 (labeled as Gsta4+Mnx1+Lhx3) increased the mRNA expression level of neuronal cell markers by about 2 to 4 times.
[0503] Specifically, compared with the control group, the Gsta4+Mnx1+Lhx3 group showed approximately 8-fold increase in Synapsin expression, approximately 7-fold increase in Map2 expression, and approximately 4-fold increase in Hb9 expression. Furthermore, compared with the Mnx1+Lhx3 group, Synapsin expression increased approximately 4-fold, Map2 expression increased approximately 4-fold, and Hb9 expression increased approximately 2.5-fold.
[0504] That is, compared with the combination of conventional differentiation factor Mnx1+Lhx3 alone, the addition of Gsta4 to form "Gsta4+Mnx1+Lhx3" showed a more significant direct transdifferentiation effect.
[0505] As observed in the aforementioned experiments, the administration of Gsta4 alone (labeled as Gsta4) also showed a superior direct transdifferentiation effect compared to the conventional factor combination (Mnx1+Lhx3); however, when Gsta4 was added to the conventional factor combination, a very significant direct transdifferentiation into motor neurons was confirmed.
[0506] 3-3-2. Direct transdifferentiation of mouse-derived primary astrocytes In addition, the inventors treated mouse-derived primary astrocytes with the "Gsta4+Mnx1+Lhx3" combination in the form of the STUP-001 composition containing Gsta4, Mnx1, and Lhx3 at different concentrations, and detected the expression of neuronal markers (Tuj1, Map2) by immunofluorescence staining to confirm the degree of differentiation into motor neurons (see [link to article]). Figure 9 ).
[0507] At this point, the concentration of Gsta4+Mnx1+Lhx3 (labeled STUP-001) is 1×10 10 GC / well was used for treatment. Naive was the control group, which was not treated with any substances; control was the solvent control group treated with AAV2 buffer (containing 13.84 g / L sodium chloride, 0.2 g / L potassium chloride, 0.24 g / L potassium dihydrogen phosphate, 1.44 g / L dibasic sodium phosphate, and 0.01 g / L poloxamer 188).
[0508] like Figure 9 As shown, in the group treated with Gsta4+Mnx1+Lhx3 (labeled STUP-001) in mouse-derived astrocytes, the expression intensity of the neural cell markers was confirmed to be increased by approximately 3 to 5 times or more.
[0509] The results of Experiments 1 to 3 demonstrate that Gsta4 of this application is a differentiation factor capable of directly transdifferentiating somatic cells such as fibroblasts and astrocytes into inducible motor neurons. Furthermore, Gsta4 exhibits higher differentiation efficiency compared to conventional direct transdifferentiation factors. Moreover, when Gsta4 is used simultaneously with conventional differentiation factors, it can significantly enhance the differentiation effect of conventional differentiation factors with lower differentiation efficiency.
[0510] Furthermore, the inventors through In vivo Animal experiments have confirmed the "direct transdifferentiation effect of somatic cells into motor neurons" caused by the use of Gsta4 or Gsta4+Mnx1+Lhx3 of the present invention and its "therapeutic effect on spinal cord injury".
[0511] Experiment Example 4: Mouse Experiment to Verify the Therapeutic Effect of Gsta4 on Spinal Cord Injury The composition containing Gsta4 was administered to the SCI mouse model prepared by the aforementioned method. The administration site and dosage are as described in the "Experimental Materials" section.
[0512] In the group that received Gsta4 alone as a differentiation factor, immunofluorescence staining was performed to observe changes in the expression of motor neuron markers at the spinal cord injury site (between L4 and L5) (see [link to study]). Figure 10 ).
[0513] from Figure 10 As can be seen, compared with the SCI spinal cord injury model group (labeled SCI), the expression intensity of ChAT and Map2 was increased by about 4 times in the group treated with Gsta4 alone (labeled SCI+Gsta4).
[0514] The above results indicate that when Gsta4 is administered alone to the SCI mouse model, cells in the spinal cord injury site are directly transdifferentiated into motor neurons, resulting in an increase in the number of motor neurons in that site. In other words, administering Gsta4 alone can indirectly confirm its therapeutic effect on spinal cord injury in the SCI mouse model.
[0515] Experiment Example 5: Mouse experiment to verify the therapeutic effect of the Gsta4+Mnx1+Lhx3 combination on spinal cord injury. To confirm the therapeutic effect of the composition containing Gsta4, Mnx1 and Lhx3 (hereinafter referred to as STUP-001) on spinal cord injury, cytotoxicity evaluation and various analyses were performed on mice after administration.
[0516] Experimental Example 5-1: Confirmation of Cell Viability In Experiment 4, it was confirmed that the composition (STUP-001) containing Gsta4, Mnx1, and Lhx3 could induce fibroblasts or astrocytes to directly transdifferentiate into motor neurons (see [link to Experiment 4]). Figure 7 and Figure 9 Furthermore, to conduct the aforementioned toxicity tests on STUP-001, cell viability was also determined (see [link to STUP-001]). Figure 11 ).
[0517] After treating mouse-derived primary astrocytes with different concentrations of STUP-001, the survival rate of cells that were directly transdifferentiated into motor neurons was measured.
[0518] At this point, the concentration of STUP-001 is 1x10. 6 GC / well, 1x10 7 GC / well, 1x10 8 GC / well, 1x10 9 GC / well, 1x10 10 GC / well, 1x10 11GC / well was used for treatment. Naive was the control group without any treatment; control was the solvent control group treated with AAV2 buffer.
[0519] The results are as follows Figure 11 As shown, when the concentration of STUP-001 in primary astrocytes derived from mice increased, the cell survival rate remained similar to that of the control group and the solvent control group, indicating that STUP-001 has almost no cytotoxicity.
[0520] After confirming the toxicity of STUP-001 in vitro, the inventors treated different concentrations of STUP-001 into SCI mice, an animal model of spinal cord injury, and conducted behavioral, electrophysiological, and protein quantification tests.
[0521] At this time, each experimental group from E0 to E5 consisted of 3 female and 3 male mice, and the assay was performed for 8 weeks after drug administration.
[0522] E0 to E5 represent the following groups: E0: Control group consisting of normal ICR mice; E1: Solvent control group treated with AAV2 buffer in the SCI mouse model; E2: STUP-001 (2.0 × 10⁻⁶) was treated in the SCI mouse model. 8 The experimental group for GC / head; E3: STUP-001 (2.0 × 10⁻⁶) was treated in the SCI mouse model. 7 The experimental group for GC / head; E4: STUP-001 (2.0 × 10⁻⁶) was treated in the SCI mouse model. 6 The experimental group for GC / head; E5: STUP-001 (2.0 × 10⁻⁶) was treated in the SCI mouse model. 5 The experimental group of GC / head.
[0523] Experiment Example 5-2: Confirming the therapeutic effect of spinal cord injury through behavioral analysis In the SCI mouse model, BBB scores were measured after STUP-001 treatment at specific concentrations for behavioral analysis. Figure 12 (Tables 3-7).
[0524] The BBB scores in Tables 3-7, when plotted as charts, are as follows: Figure 12 As shown.
[0525] Table 3 shows the BBB scores for group E1, Table 4 shows the BBB scores for group E2, Table 5 shows the BBB scores for group E3, Table 6 shows the BBB scores for group E4, and Table 7 shows the BBB scores for group E5.
[0526] Table 3
[0527] Table 4
[0528] Table 5
[0529] Table 6
[0530] Table 7
[0531] As shown in Figure 12, at week 0 before drug administration, the scores of groups E0 to E5 were consistently at the highest value of 21 points. However, in the spinal cord injury model group E2, due to injury between L4 and L5 of the spinal cord, the BBB score decreased significantly, remaining below 4 points throughout the measurement period. This indicates that the spinal cord had been damaged.
[0532] On the other hand, it was observed that the scores of groups E2 to E5, who were given STUP-001 of the present invention, showed an overall increasing trend after administration compared with the solvent control group.
[0533] In the E2 group, from week 3 to week 8, the BBB score showed a statistically significant increase compared to the solvent control group (labeled E1). In particular, starting from around week 6, the BBB score in the E2 group was measured to be above 5.
[0534] In the E3 group, the BBB score increased significantly compared to the solvent control group from week 4 to week 8. Furthermore, around week 8, a statistically significant increase in the BBB score was also observed in the E3 group compared to the E4 and E5 groups.
[0535] In both groups E4 and E5, an upward trend in BBB scores was also observed.
[0536] This result can be explained as follows: after administration of STUP-001 of the present invention, the spinal cord injury in mice gradually recovered, leading to an increase in BBB scores. In particular, compared with the solvent control group (E1), a generally higher trend in BBB scores was observed in the E2 and E3 groups. Among them, the E2 group showed the highest tendency for BBB scores.
[0537] Experimental Example 5-3: Confirming the therapeutic effect of spinal cord injury through electrophysiological analysis STUP-001 was treated with different concentrations in the SCI mouse model, and the action potential (AP firing ratio) and resting membrane potential (RMP) were measured for electrophysiological analysis (see [link to study]). Figure 13 and Figure 14 ).
[0538] Figure 13 The results show the action potential firing ratio (AP firing ratio). The results indicate that the frequency of AP firing was significantly lower in the solvent control group (E1) compared to the normal group (E0). However, in the present invention, groups E2 and E3, under current conditions of 40, 60, and 100 pA, showed a significantly higher action potential firing ratio compared to group E1. Furthermore, groups E4 and E5 also showed a trend of increasing AP firing ratio. Therefore, it can be confirmed that the STUP-001 of the present invention has an overall trend of improving the AP firing ratio.
[0539] Figure 14 These are the results of the resting membrane potential (RMP) measurement. The results show that the average RMP in the normal group (E0 group) is approximately... 59.442 ± 4.948 mV, while the average value of the solvent control group E1 was approximately The resting membrane potential was 13.672 ± 9.995 mV, which was statistically significantly higher in group E1 than in group E0. This indicates that the resting membrane potential is elevated during spinal cord injury.
[0540] When STUP-001 of the present invention was administered to the SCI mouse model, the resting membrane potential of groups E2 to E5 showed a significant recovery compared to the solvent control group E1. In particular, the average value of group E2 was approximately 54.690 ±9.147 mV, E3 group is approximately 57.89 ± 7.382 mV, indicating that it has recovered to a level similar to that of the normal group E0.
[0541] Experimental Example 5-4: Determination of Expression Levels of Differentiation Efficacy-Related Proteins In groups E0 to E5, the expression levels of MAP2 and ChAT in the spinal cord tissue at the STUP-001 administration site of Sacrificed mice were measured using ELISA. The results are as follows: Figure 15 As shown.
[0542] MAP2 protein is a marker of mature nerve cells, while ChAT protein is a marker of motor nerve cells.
[0543] As confirmed in the aforementioned experimental examples (Experiments 3 and 4), the STUP-001 of the present invention can directly transdifferentiate astrocytes or fibroblasts into motor neurons. Therefore, in groups E2 to E5 of the SCI mouse model after administration of the STUP-001 of the present invention, an increase in the number of motor neurons was observed at the administration site (spinal cord injury site). Consequently, the expression levels of MAP2 and ChAT at this site also increased accordingly.
[0544] Compared to the normal group E0, the expression levels of MAP2 and ChAT proteins in the solvent control group E1 were statistically significantly decreased. This indicates that the expression of MAP2 and ChAT decreases when the spinal cord is injured.
[0545] Conversely, in groups E2 to E5 treated with STUP-001 of the present invention, the expression levels of MAP2 and ChAT proteins were statistically significantly increased compared to group E1 (see [link to STUP-001]). Figure 15 ).
[0546] As described above, Example 5 confirms that when STUP-001 was administered to the SCI mouse model, the BBB score, action potential firing rate, resting membrane potential, and efficacy-related protein levels all showed effects close to those of the normal group. This indicates that STUP-001 of the present invention can effectively transdifferentiate somatic cells at the site of spinal cord injury directly into motor neurons, thereby significantly increasing the number of motor neurons at that site (i.e., the regeneration and generation of motor neurons), and thus achieving a therapeutic effect on spinal cord injury.
[0547] In particular, at 2.0×10 8 STUP-001 in group E2 was treated with GC / head concentration, and at 2.0 × 10⁻⁶. 7 In the E3 group treated with GC / head concentration, STUP-001 showed extremely good therapeutic effects.
[0548] Experiment Example 6: Toxicity assessment of the agent as a treatment for spinal cord injury from multiple perspectives Subsequently, in order to investigate the toxicity of STUP-001 as a treatment for spinal cord injury and to validate it from a broader perspective, this study designed and carried out the experiments shown in Table 8 below.
[0549] The following are the definitions of groups G1 to G4: G1: Solvent control group of ICR mice treated with AAV2 buffer; G2: ICR mice were treated with STUP-001 (2.5 × 10⁻⁶). 9 GC / head) group; G3: ICR mice were treated with STUP-001 (5.0 × 10⁻⁶).9 GC / head) group; G4: Treatment of ICR mice with STUP-001 (1.0 × 10¹) 0 The group (GC / head).
[0550] Table 8
[0551] Example 6-1: Weight Measurement Tables 9 and 10 show the weight measurement results for groups G1 to G4.
[0552] Table 9 shows the body weight of male mice, and Table 10 shows the body weight of female mice.
[0553] Table 9
[0554]
[0555] Table 10
[0556]
[0557] Measurement results showed that there was no difference in body weight between males and females in groups G2-G4 and group G1. That is, STUP-001 of the present invention is not expected to cause adverse toxicological changes such as weight loss during post-administration follow-up observation.
[0558] Experiment Example 6-2: Functional Observation Test Tables 11 (Male Functional Assessment) and 12 (Female Functional Assessment) present the functional observation results for groups G1 through G4. This experiment aimed to verify the safety and pharmacological properties of the drug in the central nervous system. Functional observation included stimulus responsiveness tests (auditory response, positive reflex, pain response, auricular reflex, threat reflex); in addition, gripping tests were used to assess neurological and muscular status. Locomotor activity was also tested to confirm the animals' ability to move outside their cages.
[0559] The test results showed no difference between the male and female mice in groups G2-G4 and those in group G1 in terms of various functional indicators. That is, STUP-001 of the present invention is not expected to cause side effects on the central nervous system, such as impairing or weakening various physiological functions in patients.
[0560] Table 11
[0561] Table 12
[0562] Experimental Example 6-3: General Toxicity Assessment General toxicity assessment refers to the observation of toxic reactions in healthy mice over a period of 13 weeks after administration of STUP-001 to confirm its maximum non-toxic dose and potential target organs. This general toxicity assessment is confirmed through necropsy results.
[0563] Table 13 shows the necropsy results of the toxicity evaluation. The necropsy results showed that although multiple sites were observed, no abnormalities related to toxicity were found. In summary, STUP-001 of the present invention did not exhibit toxicity to various biological tissues of the patient, and therefore holds promise for use as a relatively safe therapeutic agent.
[0564] Table 13
[0565] Experimental Example 6 confirmed that the STUP-001 of the present invention performs well even when processing 1.0 × 10⁻⁶ ppm. 10 No changes in body weight or any toxicity were observed in the G4 group with the extremely high dose of GC / head.
[0566] These results demonstrate that STUP-001 of the present invention has extremely high applicability as a treatment agent for spinal cord injury.
[0567] The above experimental examples confirm that the novel differentiation factor Gsta4 discovered by the inventors of this application is an important factor for the direct transdifferentiation of somatic cells into motor neurons. Furthermore, Gsta4 has a higher differentiation efficiency than conventional differentiation factors, and even more so when used in conjunction with conventional differentiation factors, its differentiation efficiency is higher than when conventional differentiation factors are used alone.
[0568] Furthermore, the inventors also clearly confirmed the therapeutic effect in SCI mice, a model of lower body paralysis caused by spinal cord injury.
[0569] In particular, the therapeutic effect on spinal cord injury was confirmed when the AAV containing Gsta4 was directly administered to SCI mice. Furthermore, administration of the AAV containing Gsta4, Mnx1, and Lhx3 to SCI mice not only confirmed the therapeutic effect on spinal cord injury but also demonstrated its stability and toxicity, proving its suitability as a therapeutic agent.
[0570] Therefore, the technology of this application can not only be used as a therapeutic agent for spinal cord injury, but is also expected to have broad industrial application prospects in the treatment of a variety of neurological diseases in the future.
[0571] Industrial applicability This application provides compositions for treating spinal cord injury diseases and their uses.
[0572] [Introduction to Sequence Lists] This invention relates to the Gsta4 (glutathione S-transferase Alpha 4) protein, or the nucleic acid sequence encoding the protein.
Claims
1. A pharmaceutical composition for treating spinal cord injury, comprising: The nucleic acid sequence encoding the Gsta4 (Glutathione S-Transferase Alpha 4) protein; The nucleic acid sequence encoding the Lhx3 (LIM homeobox 3) protein; and Nucleic acid sequence encoding MNX1 (Motor neuron and pancreas homeobox 1) protein.
2. The pharmaceutical composition according to claim 1, characterized in that, The spinal cord injury diseases mentioned are selected from: lower body paralysis, total paralysis, amyotrophic lateral sclerosis (ALS), primary ALS, progressive pseudobulbar palsy, progressive muscular atrophy, progressive bulbar palsy, and post-poliomyelitis syndrome.
3. The pharmaceutical composition according to claim 1, characterized in that, The nucleic acid sequences encoding the Gsta4 protein, the Lhx3 protein, and the MNX1 protein are contained in the vector, either independently or in a combination of two or more nucleic acid sequences.
4. The pharmaceutical composition according to claim 3, wherein, The vector is adeno-associated virus (AAV).
5. The pharmaceutical composition according to claim 4, wherein, The adeno-associated virus (AAV) mentioned is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV... DJ, AAV DJ / 8、AAV Rh10, AAV retro, AAV PHP.B, AAV PHP.eB and AAV A type selected in PHP.S.
6. The pharmaceutical composition according to claim 5, characterized in that, The adeno-associated virus is AAV2.
7. The pharmaceutical composition according to claim 1, characterized in that, The nucleic acid sequence encoding the Gsta4 protein is sequence number 12.
8. The pharmaceutical composition according to claim 1, characterized in that, The nucleic acid sequence encoding the Lhx3 protein is sequence number 16.
9. The pharmaceutical composition according to claim 1, characterized in that, The nucleic acid sequence encoding the MNX1 protein is sequence number 14.
10. The pharmaceutical composition according to claim 3, characterized in that, The vector further includes one or more of the following: a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an ITR (inverted terminal repeat), an LTR (longterm terminal repeat), a terminator, an internal ribosome entry site (IRES), and 2A self-cleaving peptides.
11. The pharmaceutical composition according to claim 3, characterized in that, The vector further includes a promoter, a 2A self-cleaving peptide, and an ITR (inverted terminal repeat).
12. The pharmaceutical composition according to claim 11, characterized in that, The promoter is the CMV promoter, and the 2A self-cleaving peptide is P2A or T2A.
13. The pharmaceutical composition according to claim 1, characterized in that, The pharmaceutical composition is formulated as an injectable.
14. The pharmaceutical composition according to claim 4, characterized in that, The adeno-associated virus contained in the pharmaceutical composition is at a concentration of 1×10⁻⁶. 5 GC / kg up to 1×10 15 The subjects were administered the drug at a dose of GC / kg.
15. The pharmaceutical composition according to claim 14, characterized in that, The AAV is 1×10 6 GC / kg to 1×10 12 The subjects were administered the drug at a dose of GC / kg.
16. The pharmaceutical composition according to claim 1, characterized in that, The pharmaceutical composition is administered to the damaged spinal cord site in a subject suffering from spinal cord injury, wherein the damaged spinal cord site is selected from: L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), T8 (thoracic 8), T9 (thoracic 9), T10 (thoracic 10), T11 (thoracic 11), T12 (thoracic 12), T13 (thoracic 13), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 ... 4) One of C5 (cervical 5), C6 (cervical 6), C7 (cervical 7), C8 (cervical 8), S1 (sacrum 1), S2 (sacrum 2), S3 (sacrum 3) and S4 (sacrum 4).
17. The pharmaceutical composition according to claim 1, characterized in that, When administering the pharmaceutical composition to a test subject, it may be administered in volumes of 10 μL to 100 μL per administration.
18. A pharmaceutical composition for treating spinal cord injury, comprising: The nucleic acid sequence encoding the Gsta4 (Glutathione S-Transferase Alpha 4) protein.
19. The pharmaceutical composition according to claim 18, characterized in that, The spinal cord injury diseases mentioned are selected from: lower body paralysis, total paralysis, amyotrophic lateral sclerosis (ALS), primary ALS, progressive pseudobulbar palsy, progressive muscular atrophy, progressive bulbar palsy, and post-poliomyelitis syndrome.
20. The pharmaceutical composition according to claim 18, characterized in that, The nucleic acid sequence encoding the Gsta4 protein is contained in the vector.
21. The pharmaceutical composition according to claim 20, characterized in that, The vector is adeno-associated virus.
22. The pharmaceutical composition according to claim 21, characterized in that, The adeno-associated virus is AAV2.
23. The pharmaceutical composition according to claim 20, characterized in that, The nucleic acid sequence encoding the Gsta4 protein is sequence number 12.
24. The pharmaceutical composition according to claim 20, characterized in that, The vector further includes a promoter sequence.
25. The pharmaceutical composition according to claim 24, characterized in that, The promoter sequence is the sequence shown in sequence number 37.