A method for constructing and applying an animal obesity model

Abstract

This invention discloses a method for constructing an animal obesity model and its application, belonging to the field of biotechnology. This invention reveals for the first time... Ttbk2 The function of genes in animal energy metabolism and body weight regulation is reduced or inhibited. Ttbk2 Expression of this substance can lead to reduced energy expenditure and subsequently significant obesity and lipid metabolism abnormalities. Based on this, the present invention addresses this by knocking out [the substance]. Ttbk2 An animal obesity model was constructed using genetic engineering. This model exhibited significant weight gain, an elevated fat / muscle ratio, elevated blood lipids, decreased energy metabolism, and fatty liver characteristics, demonstrating clear obesity features. This obesity model has extremely high application value in studying the pathogenesis of obesity, identifying obesity-related genes and targets, and screening and validating the efficacy of lipid-lowering drugs or weight-loss products.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing and applying an animal obesity model. Background Technology

[0002] Obesity and its complications, such as fatty liver, insulin resistance, and hyperlipidemia, have become a core challenge of global public health. Existing animal models of obesity mainly include diet-induced obesity (DIO) models and known gene knockout models (such as ob / ob and db / db). However, these models have the following limitations:

[0003] (1) The DIO model has poor reproducibility: it depends on the fat ratio in the feed, the feeding environment and the genetic background, and the results are difficult to reproduce between different laboratories.

[0004] (2) Classic single-gene obesity models differ greatly from human disease course: For example, the leptin pathway defect in ob / ob mice is not common in human obesity, so it cannot well simulate the natural process of common obesity or metabolic disorders.

[0005] (3) Lack of tissue-specific knockout models for studying gene function in adulthood: Most whole-body knockout models are unusable for studying the mechanisms of metabolic diseases in adulthood due to embryonic lethality.

[0006] Tau tubulin kinase 2 (TTBK2) is a serine / threonine protein kinase. Currently, the academic understanding of TTBK2 function mainly focuses on its role in neurological diseases, particularly neurodegenerative diseases. Numerous studies have confirmed that TTBK2 specifically phosphorylates the microtubule-associated protein Tau, and its overexpression or increased activity is closely related to tau protein pathologies such as Alzheimer's disease and frontotemporal dementia. Loss of function of this gene is also associated with the hereditary disease spinocerebellar ataxia type 11 (SCA11).

[0007] However, the function of TTBK2 in regulating systemic energy metabolism homeostasis remains a blank area. Although sporadic bioinformatics analyses suggest that TTBK2 may be expressed in certain metabolic tissues, to date, no studies have directly revealed the specific role of TTBK2 in adipose tissue development, lipid storage and breakdown, hepatic lipid metabolism, or energy expenditure regulation. Furthermore, no patents or published literature have reported that Ttbk2 gene defects lead to obesity or any form of metabolic syndrome. Summary of the Invention

[0008] The purpose of this invention is to provide a method for constructing and applying an animal obesity model to address the problems existing in the prior art. This invention reveals for the first time the function of the Ttbk2 gene in animal energy metabolism and weight regulation. Reducing or inhibiting Ttbk2 expression can lead to decreased energy expenditure and subsequently significant obesity and abnormal lipid metabolism. Based on this, this invention constructs an animal obesity model with Ttbk2 knockout. This obesity model exhibits obvious obesity characteristics and can be used for screening and efficacy verification of lipid-lowering drugs or weight-loss products.

[0009] To achieve the above objectives, the present invention provides the following solution:

[0010] This invention provides a method for constructing an animal obesity model, including the step of knocking out the Ttbk2 gene in the animal using gene editing technology.

[0011] Optionally, the gene editing technology includes Cre-loxP gene editing technology, CRISPR-Cas9 gene editing technology, or FLP / FRT gene editing technology.

[0012] Furthermore, when using Cre-loxP gene editing technology to knock out the Ttbk2 gene in animals, the following steps are included:

[0013] (1) The LoxP allele was targeted to the exon of the Ttbk2 gene to construct the Ttbk2 gene. fl / fl animal;

[0014] (2) The Ttbk2 fl / fl Animals and Rosa26-Cre ERT2 + / + Animal mating yields Ttbk2 fl / fl -Rosa26-Cre ERT2 + / - animal;

[0015] (3) For the Ttbk2 fl / fl -Rosa26-Cre ERT2 + / - The animals were treated with tamoxifen to establish the animal obesity model.

[0016] Optionally, the animal includes a mouse.

[0017] This invention also provides the application of the animal obesity model constructed by the above method in screening lipid-lowering drugs.

[0018] This invention also provides the application of the animal obesity model constructed by the above method in screening drugs to improve lipid metabolism abnormalities.

[0019] The present invention also provides the application of the animal obesity model constructed by the above construction method in screening metabolic enhancers.

[0020] The present invention also provides the application of the animal obesity model constructed by the above construction method in screening weight loss products.

[0021] The present invention discloses the following technical effects:

[0022] (1) This invention reveals for the first time the function of the Ttbk2 gene in animal energy metabolism and body weight regulation. Reducing or inhibiting Ttbk2 expression can lead to reduced energy consumption and subsequent significant obesity and lipid metabolism abnormalities.

[0023] (2) This invention employs a conditional induced knockout strategy (Cre ERT). + / - Tamoxifen enables spatiotemporally controlled knockout of the Ttbk2 gene in adult animals, avoiding embryonic lethality or early developmental impacts, and facilitating the study of metabolic disease processes in adulthood. In addition, it can be used to construct different types of models (systemic, tissue-specific, or period-specific) by replacing the Cre system, induction dose, and induction window, thereby expanding its application scope.

[0024] (3) The obesity model constructed in this invention has a complete phenotype, including significant weight gain, increased body fat / muscle ratio, fatty liver, increased blood lipids and decreased energy metabolism, and has good simulation and reproducibility.

[0025] (4) The obesity model constructed in this invention has a clear response to the intervention of lipid-lowering drugs. For example, green tea extract can significantly reduce the fat / muscle ratio in Ttbk2 gene knockout mice (p<0.01), which proves that it is suitable for screening anti-obesity drugs, studying the pathogenesis of obesity, and mining obesity-related genes and targets, and has broad application prospects. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 A diagram illustrating the gene knockout strategy for Ttbk2 gene knockout mice;

[0028] Figure 2 This is a graph showing the results of mouse genotyping.

[0029] Figure 3 Figure showing the results of Ttbk2 mRNA expression detection in different organs of Ttbk2 knockout mice;

[0030] Figure 4 The graph shows the results of weight and fat content detection in Ttbk2 gene knockout mice; where A is the mouse weight monitoring results; and B is the mouse fat / muscle ratio.

[0031] Figure 5 HE staining images of major organs in Ttbk2 gene knockout mice; where A is HE staining image of mouse heart, liver and kidney; B is the percentage of fat vacuoles in mouse liver.

[0032] Figure 6 The image shows the blood lipid test results of Ttbk2 gene knockout mice;

[0033] Figure 7 The graph shows the results of energy metabolism and body temperature changes in Ttbk2 gene knockout mice; where A represents the results of energy consumption in mice; and B represents the results of body temperature in mice.

[0034] Figure 8 The fat / muscle ratio of Ttbk2 gene knockout mice after intervention with green tea extract. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0041] Example 1: Construction of Ttbk2 gene knockout mice

[0042] This embodiment provides a method for constructing a mouse obesity model based on Ttbk2 gene knockout. This method is based on Cre-loxP gene editing technology, and the Cre-loxP gene editing was carried out by Southern Model (Shanghai) Biomedical Technology Co., Ltd.

[0043] Ttbk2 gene knockout strategies such as Figure 1 As shown, the experimental mice were of the C57BL / 6N strain, with the Ttbk2 gene knocked out (Gene ID: 140810). First, mice with LoxP sequences inserted flanking the 5th exon of the Ttbk2 gene were constructed. These mice were then compared with Rosa26-Cre ERT. + / + Mice were hybridized, and then the stably inherited Ttbk2 variant was obtained through two consecutive generations of selection. fl / fl -Rosa26-Cre ERT + / - Mice.

[0044] The genotypes of the selected mice were tested, and the testing process is as follows:

[0045] 1. Experimental sample: Fresh mouse tail.

[0046] 2. Main reagents: Beyotime rat tail genotype identification rapid kit, DNA Extraction Solution, Enzyme Mix, Stop Solution, Easy-Load™ PCR Master Mix (Green, 2×), specific upstream and downstream primers (prepared as a 10 μM mixture), sterile Milli-Q ultrapure water, DNA molecular weight standard (DL Marker), agarose 10×TBE electrophoresis buffer (diluted to 1× working solution), nucleic acid dyes.

[0047] 3. Instruments and Consumables:

[0048] PCR thermal cycler, constant temperature metal bath, vortex mixer, micro centrifuge, agarose gel electrophoresis system and power supply, ultraviolet gel imaging system, 0.2 mL PCR tubes, 1.5 mL centrifuge tubes, pipettes, sterile pipette tips, ophthalmic scissors, and forceps.

[0049] 4. Method:

[0050] (1) Genomic DNA extraction (rapid digestion method)

[0051] S1. Preparation of digestion solution: Calculate the required amount of DNA Extraction Solution and Enzyme Mix per sample based on the number of samples to be processed. Prepare a total volume of 100 μL / sample digestion solution in a sterile centrifuge tube, using 96 μL of DNA Extraction Solution and 4 μL of Enzyme Mix per sample. This digestion solution should be prepared fresh for each use. After preparation, vortex or gently pipette to ensure thorough mixing.

[0052] S2. Sample processing: Cut off a tail tip or small piece of tissue weighing no more than 15 mg (approximately 1 cm in length) and place it in an empty 1.5 mL tube. Start digestion within 30 minutes of cutting; otherwise, freeze immediately.

[0053] S3. Digestion and Inactivation Reaction: Place the PCR tube containing the sample and digestion solution in a 55°C water bath, metal bath, or PCR thermal cycler and incubate for 15 minutes. Then, without opening the tube cap, directly transfer the sample to a 95°C environment and continue incubation for 5 minutes to completely inactivate the digestive enzymes.

[0054] S4. Termination of Reaction and Product Preservation: Add 100 μL of Stop Solution to each tube of reaction solution, cap the tube, and mix thoroughly using a vortex mixer. The resulting solution is a crude extract containing genomic DNA, which can be used directly as a template for subsequent PCR reactions.

[0055] (2) PCR amplification

[0056] Genotyping of knockout mice was performed using three pairs of specific primers targeting the Ttbk2 flox allele and Cre ERT2. The primer sequences are as follows:

[0057] Ttbk2 flox F: ACTCCAAGTTCTTCCCCTTTTC, SEQ ID NO.1;

[0058] Ttbk2 flox R: GTTTTCTCATTCTCCCATCGTC, SEQ ID NO.2;

[0059] Rosa26-Cre ERT2 WT F: TCAGATTCTTTTATAGGGGACACA, SEQ ID NO.3;

[0060] Rosa26-Cre ERT2 WT R: TAAAGGCCACTCAATGCTCACTAA, SEQ ID NO.4;

[0061] Rosa26-Cre ERT2 Mutant F: TCCGGGCTGCCACGACCAA, SEQ ID NO.5;

[0062] Rosa26-Cre ERT2 Mutant R: GGCGCGGCAACACCATTTTT, SEQ ID NO. 6.

[0063] The PCR reaction system is shown in Table 1.

[0064] Table 1 PCR reaction system

[0065]

[0066] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30-35 cycles; 72℃ extension for 10 min; and storage at 4℃.

[0067] The expected size of the Ttbk2 flox amplification product homozygous is 267 bp, and the expected size of the wild-type is 204 bp. The expected size of the Rosa26-Cre ERT2 amplification product homozygous is 446 bp, and the expected size of the wild-type is 967 bp; mice showing bands at both 446 bp and 967 bp are Rosa26-Cre ERT2 heterozygous mice.

[0068] (3) Agarose gel electrophoresis detection

[0069] S1. Gel preparation: Prepare a 1.5% agarose gel according to the size of the target DNA fragment, and add nucleic acid dye.

[0070] S2. Sample loading and electrophoresis: After the PCR reaction, mix 5 μL of product with the sample loading buffer and load the mixture into the gel wells. Add DNA molecular weight standards simultaneously. Perform electrophoresis at 80V.

[0071] S3. Imaging and Analysis: After electrophoresis, observe and photograph under ultraviolet or blue light, and analyze the PCR results based on the position and size of the bands.

[0072] The results are as follows Figure 2 As shown, the genotypes of mice numbered TTBK2-1, TTBK2-2, and TTBK2-3 were analyzed. The results showed that TTBK2-1, TTBK2-2, and TTBK2-3 exhibited a band at 267 bp, indicating they are Ttbk2 flox mice; TTBK2-1 and TTBK2-3 exhibited a band at 967 bp, indicating they are Cre ERT2 mice. - / - In mice, a band appeared at 446 bp for TTBK2-2, indicating CreERT2. + / + Mice. This indicates that the method can screen for experimental mice that simultaneously carry the flux allele and the Cre ERT2 gene, which can be used for subsequent hybridization experiments.

[0073] The identified Ttbk2 flox mice and Cre ERT2 + / + Mouse hybridization yielded Ttbk2 fl / fl -Rosa26-CreERT2 + / - Mice were selected, and their genotypes were confirmed using the methods described above. The Ttbk2 mice, after two generations of selection... fl / fl -Rosa26-Cre ERT2 + / - Six-week-old mice were induced with tamoxifen. Tamoxifen was first dissolved in corn oil to a final concentration of 10 mg / mL, and then injected intraperitoneally at a dose of 120 mg / kg body weight, once every other day for a total of 5 times. After induction, the mice were left to rest for 4 weeks. Quantitative PCR (qPCR) was then performed on Ttbk2 mRNA in mouse fat, heart, muscle, hypothalamus, and liver using a Roche real-time quantitative PCR kit (mRNA extracted using the Trizol method). Specific procedures were described in the kit instructions. The GAPDH gene was used as an internal control. Results are as follows: Figure 3 As shown, compared with wild-type mice (WT), Ttbk2 knockout mice (Ttbk2) fl / fl The Ttbk2 mRNA level in the sample was significantly reduced, proving that the Ttbk2 gene knockout was successful.

[0074] Example 2: Detection of obesity phenotype in Ttbk2 gene knockout mice

[0075] Two groups of mice were set up, with 8 mice in each group. One group consisted of male Ttbk2 gene knockout mice constructed according to the method in Example 1. fl / fl The other group consisted of wild-type male mice of the C57BL / 6N strain (WT). All mice were breastfed for 4 weeks and then fed a normal diet. In addition, Ttbk2 knockout female mice were induced to develop tamoxifen by injection according to the method in Example 1, while wild-type female mice were injected with the same amount of tamoxifen.

[0076] (1) Mouse weight monitoring

[0077] Starting from the first injection of tamoxifen into the mice, their weight was measured weekly, specifically once a week from weeks 6 to 16. A small plastic bucket was placed on a dynamic electronic balance, and the mice were gently placed into the bucket. The weight was recorded after the reading stabilized.

[0078] The results are as follows Figure 4 As shown in Figure A, Ttbk2 knockout mice exhibit a significantly obese body type. Ttbk2 knockout mice begin to gain weight rapidly from approximately 8 weeks of age, reaching about 240% of the weight of wild-type mice by 12 weeks of age.

[0079] (2) Analysis of mouse body composition

[0080] To investigate the primary histological origin of weight gain in Ttbk2 gene knockout mice, body composition analysis was performed on 6-week-old and 16-week-old mice using a nuclear magnetic resonance body composition analyzer. Mice were anesthetized and placed in a specialized restraint device before being scanned by the instrument. After measurement, the system automatically output data such as body fat percentage and muscle mass, and further calculated the fat / muscle ratio.

[0081] The results are as follows Figure 4 As shown in Figure B, at 6 weeks of age, there was no significant difference in body composition between Ttbk2 knockout mice and wild-type mice; however, at 16 weeks of age, the fat / muscle ratio of Ttbk2 knockout mice was significantly higher than that of wild-type mice of the same age, approximately four times that of the latter.

[0082] To assess whether fatty degeneration occurred in the major internal organs (heart, liver, and kidneys) of mice, 20-week-old mice were sacrificed, and tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned. Cell morphology was observed under a light microscope after hematoxylin-eosin (HE) staining. Results are as follows: Figure 5 As shown in Figures A and B, Ttbk2 gene knockout mice exhibit large areas of fat vacuoles in the cytoplasm of their hepatocytes, presenting typical fatty liver changes.

[0083] The above results indicate that Ttbk2 gene knockout can induce a severe obesity phenotype in mice.

[0084] (3) Detection of blood lipids in mice

[0085] To verify whether Ttbk2 gene knockout mice have dyslipidemia, serum biochemical analysis was performed on 16-week-old Ttbk2 gene knockout mice and wild-type mice.

[0086] Whole blood was collected from the tail vein of mice after fasting for 4 hours. After being incubated at room temperature for 20 minutes, the blood was centrifuged at 3000 rpm for 10 minutes, and the serum was collected for indicator detection. Triglyceride, total cholesterol, and fasting blood glucose levels were measured using a fully automated biochemical analyzer.

[0087] The results are as follows Figure 6 As shown, compared with wild-type mice, Ttbk2 knockout mice had significantly higher levels of triglycerides and total cholesterol (p<0.001), while fasting blood glucose levels did not change significantly (p>0.05).

[0088] The above results indicate that Ttbk2 gene knockout can lead to significant lipid metabolism abnormalities, which is one of the key pathological features of obesity-related metabolic diseases.

[0089] (4) Detection of energy metabolism and body temperature changes in mice

[0090] To investigate the effects of Ttbk2 gene knockout on energy metabolism, 20-week-old Ttbk2 gene knockout mice and wild-type mice were placed in metabolic cage systems (Oxylet, Panlab, Spain) and their oxygen consumption (VO2), carbon dioxide excretion (VCO2), and energy expenditure (EE) were continuously monitored for 24 h. Data were collected separately for daytime and nighttime periods. All animals were acclimatized to the metabolic cages for 24 h before testing to eliminate environmental stress.

[0091] The results are as follows Figure 7 As shown in Figure A, Ttbk2 knockout mice showed a significant decrease in energy expenditure at night (p<0.01), while there was no significant difference in energy expenditure during the day (p>0.05), suggesting that their basal metabolic activity was impaired.

[0092] Rectal temperature was measured using an infrared thermometer, and the results were as follows: Figure 7 As shown in Figure B, the body temperature of Ttbk2 gene knockout mice was 1-2℃ lower than that of wild-type mice, which was significant, indicating that their metabolic heat production capacity was reduced.

[0093] The above results indicate that Ttbk2 gene knockout leads to a decrease in energy expenditure, which is an important mechanism for the formation of a mouse obesity model.

[0094] Example 3: Intervention effect of green tea extract on Ttbk2 gene knockout mouse obesity model

[0095] To verify the application value of the Ttbk2 gene knockout mouse obesity model constructed in this invention in drug screening, green tea extract (hereinafter referred to as GTE, purchased from Nanjing Zhenweikang Biotechnology Co., Ltd.) was used as a candidate drug in the intervention experiment.

[0096] (1) Experimental animals and grouping

[0097] Twelve-week-old Ttbk2 gene knockout mice and wild-type mice of the same age were randomly divided into the following four groups, with n=8 in each group: wild-type control group, wild-type + GTE group, knockout control group and knockout + GTE group.

[0098] (2) GTE administration method

[0099] Green tea extract was dissolved in 0.5% CMC-Na solution and administered by gavage at a dose of 0.1 g / kg body weight once daily for 8 consecutive weeks; the control group was administered an equal volume of 0.5% CMC-Na by gavage.

[0100] (3) Fat / muscle ratio detection

[0101] Before the intervention and at the end of week 8, fat and muscle content were measured using a small animal body composition analyzer (NMR), and the fat / muscle ratio was calculated.

[0102] (4) Experimental results

[0103] The results are as follows Figure 8 As shown, the body fat / muscle ratio was significantly decreased in the wild-type + GTE group (p<0.01); the body fat / muscle ratio was also significantly decreased in the knockout + GTE group (p<0.01); green tea extract had a significant ameliorative effect on Ttbk2 gene knockout mice, indicating that Ttbk2 gene knockout mice responded to the intervention of lipid-lowering drugs.

[0104] The above results indicate that:

[0105] (1) The Ttbk2 gene knockout mouse obesity model showed good response to drug intervention;

[0106] (2) Green tea extract can significantly reduce body fat content in obese models and improve fatty liver;

[0107] (3) The mouse obesity model of the present invention can be used to screen fat-reducing drugs, drugs to improve lipid metabolism abnormalities, and metabolic enhancers.

[0108] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing an animal obesity model, characterized by, The method comprises the step of knocking out Ttbk2 gene in animals by using gene editing technology.

2. The construction method according to claim 1, characterized in that, The gene editing technology comprises Cre-loxP gene editing technology, CRISPR-Cas9 gene editing technology or FLP / FRT gene editing technology.

3. The construction method of claim 2, wherein, When the Ttbk2 gene in animals is knocked out by using Cre-loxP gene editing technology, the construction method comprises the following steps: (1) Targeting LoxP alleles to the exons of the Ttbk2 gene to construct Ttbk2 fl / fl animals; (2) The Ttbk2 fl / fl Animals with Rosa26-Cre ERT2 + / + Animals were mated to obtain Ttbk2 fl / fl - Rosa26-CreERT2 + / - Animals; (3) the Ttbk2 fl / fl Rosa26-Cre ERT2 + / - The animals were subjected to tamoxifen induction treatment, thereby constructing an obesity model of the animals.

4. The construction method according to any one of claims 1 to 3, characterized in that, The animals comprise mice.

5. Use of the animal obesity model constructed by the method of any one of claims 1-4 in screening lipid-lowering drugs.

6. Use of the animal obesity model constructed by the method of any one of claims 1-4 in screening drugs for improving abnormal lipid metabolism.

7. Use of the animal obesity model constructed by the method of any one of claims 1-4 in screening metabolic enhancers.

8. Use of the animal obesity model constructed by the method of any one of claims 1-4 in screening weight loss products.

Images