Double-stranded siRNA targeting AGT, conjugate thereof and application of double-stranded siRNA

Abstract

The invention provides double-stranded siRNA (small interfering ribonucleic acid) targeting AGT (angiotensinogen), a conjugate of the double-stranded siRNA and application of the double-stranded siRNA, and the double-stranded siRNA and the conjugate of the double-stranded siRNA can inhibit expression of AGT (angiotensinogen) and can be used for preparing medicines for treating and / or preventing AGT-related diseases.

Description

Technical Field

[0001] This invention belongs to the field of small nucleic acid drugs, and its purpose is to provide a novel double-stranded siRNA, its conjugates, and their uses. The double-stranded siRNA and its conjugates described in this invention can be used to prepare drugs for the treatment and / or prevention of angiotensinogen (AGT)-related diseases. Background Technology

[0002] The renin-angiotensin-aldosterone system (RAAS) plays a crucial role in blood pressure regulation. The RAAS cascade begins in the glomerular cells near the kidney, where renin is secreted into the circulation. Renin secretion is stimulated by several factors, including sodium in the distal tubules. + Overload, β-sympathetic stimulation, and / or reduced renal perfusion. Active renin in plasma breaks down angiotensinogen (produced by the liver) into angiotensin I, which is subsequently converted to angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Angiotensin II exerts most of its effect on the RAAS through its binding to the angiotensin II type 1 receptor (AT1R), leading to arterial vasoconstriction, tubular and glomerular effects, such as enhanced Na+. + Regulation of reabsorption or glomerular filtration rate. In addition, it is influenced by other stimuli (such as adrenocorticotropic hormone, antidiuretic hormone, catecholamines, endothelin, serotonin) and Mg. 2+ and K + At the same level, AT1R stimulation leads to aldosterone release, which subsequently promotes Na+ release in the distal convoluted tubule of the kidney. + and K + excretion.

[0003] Hypertension caused by RAAS dysregulation due to excessive angiotensin II production and / or AT1R stimulation can lead to, for example, increased oxidative stress, promotion of inflammation, hypertrophy and fibrosis in the heart, kidneys and arteries, and results in, for example, left ventricular fibrosis, arterial remodeling and renal glomerulosclerosis.

[0004] Angiotensinogen (AGT) is a common precursor to all angiotensinogens, and the liver is the main source of blood AGT. Multiple studies have confirmed a significant positive correlation between elevated blood AGT concentration and hypertension. Lowering blood AGT concentration can inhibit the activity of the RAAS pathway and lead to a decrease in blood pressure. Intravenous infusion of AGT into rats increases blood pressure, which can be reversed by treatment with anti-AGT antibodies. AGT-knockout mice show decreased blood pressure, while AGT overexpression leads to increased blood pressure. Regulating AGT levels to treat hypertension is a promising research target; however, targeting AGT using traditional methods encounters many difficulties.

[0005] RNA interference (RNAi) refers to the highly conserved phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded small interfering RNA (siRNA) during evolution. Therefore, the research and development of siRNAs targeting AGT is of great significance. Summary of the Invention

[0006] This invention provides a novel double-stranded siRNA, its conjugates, and their uses. The double-stranded siRNA and its conjugates can inhibit angiotensinogen (AGT) expression and can be used to prepare drugs for the treatment and / or prevention of AGT-related diseases. The double-stranded siRNA and its conjugates exhibit high in vivo delivery efficiency, good stability, high AGT gene expression inhibitory activity, and / or low toxicity.

[0007] On one hand, the present invention provides a double-stranded siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises one of the nucleotide sequences shown in SEQ ID NO:4, SEQ ID NO:1-3 and SEQ ID NO:5-13 (i.e., one of the sense strands in Table 1 of the present invention specification) or a nucleotide sequence differing therefrom by no more than 5 nucleotides, and detailed information on the nucleotide sequences of SEQ ID NO:4, SEQ ID NO:1-3 and SEQ ID NO:5-13 is given in Table 1 of the present invention specification;

[0008] The antisense strand comprises one of the nucleotide sequences shown in SEQ ID NO:17, SEQ ID NO:14-16 and SEQ ID NO:18-26 (i.e., one of the antisense strands in Table 1 of this specification), or a nucleotide sequence that differs from it by no more than 5 nucleotides. Detailed information on the nucleotide sequences of SEQ ID NO:17, SEQ ID NO:14-16 and SEQ ID NO:18-26 can be found in Table 1 of this specification.

[0009] All nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are independently selected from at least one of the following:

[0010] 2'-Methoxy modified nucleotides, 2'-Fluoro modified nucleotides, 2'-Methoxyethyl modified nucleotides, phosphate thioester linked modified nucleotides, 2'-Deoxy modified nucleotides, 2'-Amino modified nucleotides, 2'-Hydroxy modified nucleotides, locked nucleic acid modified nucleotides, unlocked nucleic acid modified nucleotides, glycol nucleic acids, 5'-vinyl phosphate modified nucleotides, 5'-(E)-VP modified nucleic acids, cEt, D-substituted nucleotides, and InvB modified nucleotides.

[0011] In some embodiments of the double-stranded siRNA of the present invention, the sense strand comprises CUCCCACCUUUUCUUCUAA, or a nucleotide sequence differing from it by no more than 5 nucleotides; the antisense strand comprises UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence differing from it by no more than 5 nucleotides. In some embodiments of the double-stranded siRNA of the present invention, the double-stranded region is 14-23 nucleotide pairs long.

[0012] In some embodiments of the double-stranded siRNA described in this invention, the modified nucleotides are each independently located at one or more of the following positions: the nucleotides at the 5' end of the positive strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point.

[0013] In some embodiments of the double-stranded siRNA described in this invention, the modified nucleotides are each independently located at one or more positions selected from the following: the nucleotides at the 5' end of the antisense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23 of the start point.

[0014] In some embodiments of the double-stranded siRNA described in this invention, the thiophosphate linkage modification is present at one or more of the following positions:

[0015] The nucleotides at the 5' end of the positive strand are between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, and 20-21 of the start point.

[0016] In some embodiments of the double-stranded siRNA described in this invention, the thiophosphate linkage modification is independently present at one or more of the following positions:

[0017] The nucleotides at the 5' end of the antisense strand are between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 of the start site.

[0018] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0019] The nucleotides at the 5' end of the positive strand are the 5th, 7th, 8th, 9th, 10th, and 11th positions of the start point.

[0020] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0021] The nucleotides at the 5' end of the positive strand are the 8th, 10th, 11th, and 12th positions of the start point, and optionally also include the 5th position.

[0022] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0023] The nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions of the start point.

[0024] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0025] The 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16, which are the starting points of the nucleotides at the 5' end of the antisense strand.

[0026] In some embodiments of the double-stranded siRNA described in this invention, the InvB modification is performed by linking it to the 5' or 3' end of the positive strand via a thiophosphate group or a phosphate group.

[0027] In some embodiments of the double-stranded siRNA described in this invention, the InvB modification is performed via a phosphate thioester group at the 5' end of the positive strand.

[0028] In some embodiments of the double-stranded siRNA described in this invention, the antisense strand comprises two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate modifications at the 5' end.

[0029] In some embodiments of the double-stranded siRNA described in this invention, the positive strand contains two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate modifications at the 5' end.

[0030] The phrase "each independently and optionally existing in one or more of the following positions" or "each independently existing in one or more of the following positions" in this invention refers to the presence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 positions of modification. "Optional" means that there may be modifications or no modifications, i.e., 0 modifications.

[0031] In some embodiments of the double-stranded siRNA described in this invention, the sense strand comprises one of the nucleotide sequences shown in SEQ ID NO:41, SEQ ID NO:27-40, and SEQ ID NO:42-43 (i.e., one of the sense strands in Table 1-A of this specification); the antisense strand comprises one of the nucleotide sequences shown in SEQ ID NO:48, SEQ ID NO:45-47, and SEQ ID NO:49-583 (i.e., one of the antisense strands in Table 1-A of this specification);

[0032] Detailed information on the nucleotide sequences of SEQ ID NO:41, SEQ ID NO:27-40, SEQ ID NO:42-43, SEQ ID NO:45-47, SEQ ID NO:48 and SEQ ID NO:49-583 can be found in Table 1-A of this specification.

[0033] In some embodiments of the double-stranded siRNA described in this invention, the positive strand comprises one of the nucleotide sequences shown in SEQ ID NO:73, SEQ ID NO:59-72, and SEQ ID NO:74-75; detailed information on the nucleotide sequences of SEQ ID NO:73, SEQ ID NO:59-72, and SEQ ID NO:74-75 can be found in Table 1-B of this specification.

[0034] In some embodiments of the double-stranded siRNA described in this invention, the length of the sense strand does not exceed 23 nucleotides, and the length of the antisense strand does not exceed 23 nucleotides.

[0035] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0036] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucusasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0037] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3', and the antisense strand contains a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0038] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaasgsa-3', and the antisense strand contains the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'. In another aspect, this invention relates to a double-stranded siRNA conjugate comprising the double-stranded siRNA described in this invention and a conjugating group conjugated to the siRNA.

[0039] In some embodiments of the double-stranded siRNA conjugates of the present invention, the 3' or 5' end of the sense or antisense strand of the double-stranded siRNA is conjugated to a conjugating group. Preferably, the 3' end of the sense strand of the double-stranded siRNA is conjugated to the conjugating group. The 3' or 5' end of the sense strand of the double-stranded siRNA is conjugated to the conjugating group via a phosphate ester group, a thiophosphate ester group, or a phosphate group.

[0040] In some embodiments of the double-stranded siRNA conjugates described in this invention, the conjugating group includes GalNAc or a derivative thereof.

[0041] In some embodiments of the double-stranded siRNA conjugates described in this invention, the conjugating group is GalNAc or a derivative thereof linked by a divalent, trivalent, or tetravalent branching linker.

[0042] In some embodiments of the double-stranded siRNA conjugate described in this invention, the conjugating group is L-96 or DAW40007-4, wherein the structures of the conjugating groups L-96 and DAW40007-4 are as follows:

[0043]

[0044] In some embodiments of the double-stranded siRNA conjugate described in this invention, the sense strand contains the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsasL96-3', and the antisense strand contains the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0045] In some embodiments of the double-stranded siRNA conjugate described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasasL96-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0046] In another aspect, the present invention relates to a pharmaceutical composition comprising the double-stranded siRNA or double-stranded siRNA conjugate described herein, and a pharmaceutically acceptable carrier.

[0047] In another aspect, the present invention relates to the use of the double-stranded siRNA and siRNA conjugates or pharmaceutical compositions described herein in the preparation of medicaments for the treatment and / or prevention of AGT-related diseases.

[0048] In some embodiments of the uses described in this invention, the AGT-related disease is hypertension.

[0049] In some embodiments of the uses described in this invention, the hypertension is selected from borderline hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension. Attached Figure Description

[0050] Appendix Figure 1 The relative residual level of serum AGT protein in humanized mice treated with the double-stranded siRNA* conjugate ID NO 2 of this invention, where PC is control 2.

[0051] Detailed Description of the Invention

[0052] Definitions and general terms

[0053] In this invention, the terms "comprising" or "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0054] In this invention, the term "small interfering RNA (siRNA)" refers to a double-stranded RNA of 17 to 30 nucleotides in length, comprising a sense strand and an antisense strand. siRNA mediates targeted cleavage of RNA transcripts via the RISC pathway by forming an RNA-induced silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences through known RNA interference (RNAi) processes, inhibiting the translation of mRNA into amino acids and its conversion into proteins.

[0055] The sense and antisense strands typically form a double-stranded siRNA (“dsRNA”), also referred to herein as an “RNAi agent”. The double-stranded region of the RNAi agent can be 12–30 nucleotide pairs long. For example, the double-stranded region can be 14–30 nucleotide pairs long, 17–30 nucleotide pairs long, 27–30 nucleotide pairs long, 17–23 nucleotide pairs long, 17–21 nucleotide pairs long, 17–19 nucleotide pairs long, 19–25 nucleotide pairs long, 19–23 nucleotide pairs long, 19–21 nucleotide pairs long, 21–25 nucleotide pairs long, or 21–23 nucleotide pairs long. In another embodiment, the double-stranded region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides long.

[0056] The terms “iRNA,” “RNAi agent,” “iRNA agent,” and “RNA interference agent” are used interchangeably herein and refer to terms defined herein that include RNA agents and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates, for example, the expression of AGT in cells, such as in the cells of a subject, as in mammalian subjects.

[0057] In this invention, the term "antisense strand (or guide strand)" includes a region substantially complementary to a target sequence. "Sense strand (or follower strand)" refers to an RNAi strand containing a strand substantially complementary to the antisense strand. The term "substantially complementary" means fully complementary or at least partially complementary, for example, the antisense strand being fully complementary or at least partially complementary to the target sequence. In the case of partial complementarity, mismatches can exist within the molecule or in terminal regions, wherein the most tolerant mismatches are located in terminal regions, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends of the RNAi.

[0058] It should be noted that "at least partially complementary" to mRNA means that the antisense strand has a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest.

[0059] The term "nucleotide overhang" or "protrusion" refers to at least one unpaired nucleotide that is overhanged from the double-stranded structure of iRNA (e.g., dsRNA). A nucleotide overhang exists, for example, when the 3′ end of one strand of dsRNA extends beyond the 5′ end of the other strand, or vice versa. dsRNA may include an overhang of at least one nucleotide; alternatively, the overhang may include at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five or more nucleotides. The nucleotide overhang may include or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). One or more overhangs may be located on the sense strand, antisense strand, or any combination thereof. Additionally, one or more nucleotides of the overhang may be present at the 5′ end, 3′ end, or both ends of the antisense or sense strand of the dsRNA.

[0060] The conjugation groups described in this invention include pharmaceutically acceptable conjugation groups. Generally, pharmaceutically acceptable conjugation groups comprise pharmaceutically acceptable targeting molecules (or targeting ligands) and optional linkers. In some embodiments of this invention, the conjugation group is GalNAc or a derivative thereof. Examples of exemplary conjugation groups, linkers, and targeting molecules can be found in the disclosure of WO2015006740A2. Exemplary conjugation groups include, but are not limited to, L96 or DAW40007-4.

[0061] Unless otherwise stated, “conjugation” means that two or more chemical parts, each having a specific function, are connected to each other by covalent linkage; correspondingly, “conjugated compound” means a compound formed by the covalent linkage of the chemical parts.

[0062] The double-stranded siRNA conjugate of this invention is a compound formed by linking double-stranded siRNA with a pharmaceutically acceptable conjugate group, and the double-stranded siRNA and the pharmaceutically acceptable conjugate group are covalently linked.

[0063] The term "angiotensinogen-related disease" or "AGT-related disease" refers to a disease or dysregulation caused by or associated with the renin-angiotensin-aldosterone system (RAAS), or a disease or dysregulation whose symptoms or progression correspond to RAAS inactivation. The term "angiotensinogen-related disease" includes diseases, dysregulations, or conditions that would benefit from reduced AGT expression. Such diseases are often associated with hypertension. Non-limiting examples of angiotensinogen-related disease include hypertension, such as borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), and secondary hypertension (also known as idiopathic hypertension). Hypertension (non-primary hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy. Membrane disease, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid hyperstatins (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid hyperstatins, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in a gestational setting), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementations, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction.

[0064] In this invention, "pharmaceutical composition" can refer to a drug for the treatment of a disease or for use in in vitro cell culture experiments. When used for the treatment of a disease, the term "pharmaceutical composition" generally refers to a unit dose form and can be prepared by any method well known in the pharmaceutical industry. All methods involve the step of combining the active ingredient with excipients constituting one or more adjunct components. Typically, the composition is prepared by uniformly and sufficiently combining the active siRNA with liquid excipients, finely pulverized solid excipients, or both.

[0065] In this invention, the term "pharmaceutical acceptable" means that a substance or composition must be chemically and / or toxicologically compatible with other components of the formulation and / or the mammals to which it is treated. Preferably, "pharmaceutical acceptable" as used herein means approved by federal regulatory agencies or national governments or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias for use in animals, particularly in humans.

[0066] In this invention, the term "pharmaceutically acceptable carrier" can include any solvent, solid excipient, diluent, or other liquid excipient, etc., suitable for a specific target dosage form. The use of any conventional carriers, except those incompatible with the RNAi (such as siRNA) of this invention, for example, any adverse biological effects produced or harmful interactions with any other component of the pharmaceutically acceptable composition, is also within the scope of this invention.

[0067] In some embodiments of the pharmaceutical composition according to the present invention, the pharmaceutically acceptable carrier may be any of the carriers conventionally used in the art, for example, it may include at least one of a pH buffer, a protectant, and an osmotic pressure regulator. The pH buffer may be acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. The pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. The protectant may be at least one of inositol, sorbitol, and sucrose. Based on the total weight of the pharmaceutical composition, the content of the protectant may be 0.01-30% by weight (e.g., 0.01% by weight, 0.05% by weight, 0.1% by weight, 0.5% by weight, 1% by weight, 5% by weight, 10% by weight, 15% by weight, 20% by weight, 25% by weight, 30% by weight, or any value between any two of the above). The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200-700 mOsmol / kg. The content of the osmotic pressure regulator can be determined by those skilled in the art based on the desired osmotic pressure.

[0068] In this invention, the term "treatment" refers to the use of drugs to achieve desired pharmacological and / or physiological effects. These effects may be preventative in terms of complete or partial prevention of disease or its symptoms, and / or therapeutic in terms of partial or complete cure of disease and / or adverse effects caused by disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) prevention of disease or the onset of disease in susceptible individuals who have not yet been diagnosed with the disease; (b) inhibition of disease, such as blocking disease progression; or (c) alleviation of disease, such as reducing disease-related symptoms. As used herein, "treatment" encompasses any administration of a drug, RNAi reagent, or siRNA to an individual to treat, cure, alleviate, improve, reduce, or inhibit the individual's disease, including but not limited to administration of a drug containing the RNAi reagent, siRNA, or siRNA conjugate described herein to an individual in need.

[0069] The "RNAi reagent" described in this invention refers to a reagent containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the transcription and translation of target messenger RNA (mRNA) in a sequence-specific manner. The RNAi reagent of this invention can be manipulated through RNA interference mechanisms (i.e., by inducing RNA interference through interaction with the RNA interference pathway building blocks of mammalian cells (RNA-induced silencing complexes or RISC)) or through any other mechanism or pathway. RNAi reagents include, but are not limited to: single-stranded oligonucleotides, single-stranded antisense oligonucleotides, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates.

[0070] Unless otherwise specified, in the context of this invention, uppercase letters C, G, U, and A represent bases of natural nucleotides; lowercase letters represent bases with a methoxy group modified at the 2-position of the ribose sugar of the nucleotide, such as c, g, u, and a representing 2'-OMe(2'-O-methyl)C, 2'-OMeG, 2'-OMeU, and 2'-OMeA, respectively; uppercase letters to the right of f represent bases with a fluorine group modified at the 2-position of the ribose sugar of the nucleotide, such as Cf, Gf, Uf, and Af representing 2'-F(2'-fluorine)C, 2'-FG, 2'-FU, and 2'-FA, respectively; "s" indicates that the two nucleotide residues adjacent to "s" are linked by a thiophosphate group, for example, "gsu" indicates that the g and u residues are linked by a thiophosphate group; Tgn represents a thymine diol nucleotide residue, the structure of which is... The Y in double-stranded siRNA or oligonucleotides represents

[0071] The TNA, PNA, D-FNA, ANA-5, HNA-5, FANA-5, ANA-6, HNA-6, FANA-6, bcDNA, tcDNA, S-MC, N-MC, 2'-F-NMC, cEt, D, and InvAb of this invention have the following structures:

[0072] Wherein, B is a base (including natural bases (A, U, G, C or T) or modified bases), and each of TNA, PNA, D-FNA, ANA-5, HNA-5, FANA-5, ANA-6, HNA-6, FANA-6, bcDNA, tcDNA, S-MC, N-MC, 2'-F-NMC is independently linked to the remaining nucleotides and / or conjugate groups via phosphate ester bonds or thiophosphate ester bonds. The present invention also includes their stereoisomers.

[0073] This invention unlocks the structure of nucleic acid-modified nucleosides (UNA) as follows: The structure of the ethylene glycol-modified nucleic acid (GNA) nucleoside is as follows: B is a base (including natural bases (A, U, G, C or T) or modified bases).

[0074] In this invention, the terms "phosphate ester group," "phosphate ester group," and "phosphate ester bond" are used interchangeably, including monophosphate, diephosphate, or triphosphate. The term "phosphate ester group" in "thiophosphate ester group" has the same meaning. Unless otherwise specified, the internucleotide phosphate ester group in natural nucleotides is a diephosphate group.

[0075] In this invention, "deoxynucleotide" refers to a nucleotide after the hydroxyl group in the pentose nucleotide is deoxygenated, and the deoxygenation position can be 2'-OH or 3'-OH.

[0076] In some alternative embodiments of the present invention, the deoxynucleotide includes 3'-deoxy modified nucleotides and 2'-deoxy modified nucleotides.

[0077] In this invention, "2'-deoxygenation modification" refers to the deoxygenation of the hydroxyl group (2'-OH) in the pentose nucleotide to hydrogen (2'-H), and "3'-deoxygenation modification" refers to the deoxygenation of the hydroxyl group (3'-OH) in the pentose nucleotide to hydrogen (3'-H).

[0078] In this invention, "2'-X modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose nucleotide by X (2'-X). For example: "2'-fluorine modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by fluorine (2'-F); "2'-amino modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by fluorine (2'-NH2); "2'-O-allyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by allyloxy (2'-OCH2CH=CH2); "2'-alkyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by alkyl (2'-alkyl); "2'-O-alkyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by alkoxy (2'-alkoxy); "2'-methoxy modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a nucleotide by methoxy (2'-OCH3); and "2'-methoxyethyl modification" refers to the substitution of the hydroxyl group (2'-OH) in the pentose of a pentose of a nucleotide by methoxyethyl (2'-CH2CH2OCH3).

[0079] In this invention, "locked nucleotide" refers to a nucleotide obtained by modifying the 2' and 4' carbons on the pentose sugar of a nucleotide by linking them together.

[0080] In this invention, "5'-X modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by X (5'-X). For example, "5'-aminophosphate modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by an aminophosphate group; "5'-thiophosphate modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by a thiophosphate group; "5'-methylphosphonate modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by a methylphosphate group; and "5'-phosphate mimicry modification" refers to the substitution of the phosphate group (5'-PO(OH)2) in the pentose sugar of a nucleotide by a phosphate mimicry.

[0081] In this invention, "5'-methylated cytosine modification" or "5-methylcytosine modification" refers to methylation of the 5th carbon atom of cytosine; "5'-methylated uracil modification" or "5-methyluracil modification" refers to methylation of the 5th carbon atom of uracil.

[0082] In this invention, the "2'" in 2'-fluorinated nucleotides, 2'-amino nucleotides, 2'-O-allyl nucleotides, 2'-alkyl nucleotides, 2'-O-alkyl nucleotides, 2'-methoxyethyl nucleotides, and 2'-allyl nucleotides refers to the modification of the 2-position of the ribose by the corresponding group.

[0083] As used in this invention, "chemical modification" or "modification" means a structure that is chemically different when compared with its naturally occurring counterpart, including all alterations made by chemical means, such as the addition or removal of a chemical part, or the substitution of one chemical part for another.

[0084] The compounds of this invention can be asymmetric, for example, having one or more stereoisomers. Unless otherwise stated, all stereoisomers include, for example, enantiomers and diastereomers. The compounds of this invention containing asymmetric carbon atoms can be isolated in optically active pure form or in racemic form. The optically active pure form can be resolved from racemic mixtures or synthesized using chiral starting materials or chiral reagents.

[0085] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound of the present invention, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase and optionally combined with chemical derivatization (e.g., from amines to carbamates).

[0086] This invention also includes compounds of the invention that are identical to those described herein, but in which one or more atoms are replaced by isotopes with atomic weights or mass numbers different from those commonly found in nature. Examples of isotopes that can be incorporated into the compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as... 2 H, 3 H, 11 C, 13C, 14 C 13 N、 15 N、 15 O、 17 O、 18 O、 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.

[0087] Unless otherwise stated, when a position is specifically designated as deuterium (D), that position should be understood as having a deuterium abundance of at least 1000 times greater than the natural abundance of deuterium (which is 0.015%) (i.e., at least 10% deuterium incorporation). The natural abundance of deuterium in the example compounds can be at least 1000 times, at least 2000 times, at least 3000 times, at least 4000 times, at least 5000 times, at least 6000 times, or even higher. The invention also includes various deuterated forms of compounds of formula (I). Each available hydrogen atom bonded to a carbon atom can be independently replaced by a deuterium atom. Those skilled in the art can synthesize the deuterated forms of compounds of formula (I) with reference to relevant literature. When preparing the deuterated form of compound (I), commercially available deuterated starting materials can be used, or conventional techniques can be used to synthesize it with deuterated reagents, including but not limited to deuterated borane, trideuterated borane tetrahydrofuran solution, deuterated lithium aluminum hydride, deuterated iodoethane and deuterated iodomethane, etc.

[0088] The conjugation groups described in this invention can enhance the delivery of therapeutic agents to specific target sites (e.g., specific organs or tissues) within an object, such as a human or animal. In some embodiments of this invention, the conjugation groups can enhance the targeted delivery of expressed repressive oligonucleotides. In some embodiments of this invention, the conjugation groups can enhance the delivery of expressed repressive oligonucleotides to the liver.

[0089] The conjugating groups described in this invention can be directly or indirectly attached to compounds, such as therapeutic agents, for example, expressing repressive oligonucleotides, for example, the 3' or 5' end of the expressing repressive oligonucleotide. In some embodiments of this invention, the expressing repressive oligonucleotide comprises one or more modified nucleotides. In some embodiments of this invention, the expressing repressive oligonucleotide is an RNAi reagent, such as a double-stranded RNAi reagent comprising a sense strand and an antisense strand. In some embodiments of this invention, the conjugating groups disclosed herein are attached to the 3' end of the sense strand of the double-stranded RNAi reagent. In some embodiments, the conjugating groups disclosed herein are attached to the expressing repressive oligonucleotide reagent at the 3' end of the sense strand of the double-stranded RNAi reagent via a phosphate ester, thiophosphate ester, or phosphonate group.

[0090] It should be specifically noted here that in the event of any conflict or inconsistency between the sequence information in this specification and the sequence information in the sequence list (ST26 sequence list), the sequence information recorded in the specification shall prevail.

[0091] The definitions and conventions of stereochemistry used in this invention are generally referenced in the following literature: S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984), McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of this invention may contain asymmetric or chiral centers, and therefore exist as different stereoisomers. All stereoisomers of the compounds of this invention, including, but not limited to, diastereomers, enantiomers, transisomers, and mixtures thereof, such as racemic mixtures, constitute a part of this invention. Many organic compounds exist in optically active forms, i.e., they are capable of rotating the plane of plane-polarized light. In describing optically active compounds, the prefixes D, L, or R, S are used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l, or (+), (-) are used to name compounds whose plane polarization is rotated. (-) or l indicates the compound is levorotatory, while (+) or d indicates it is dextrorotatory. These stereoisomers have the same chemical structure, but their stereostructures differ. Specific stereoisomers can be enantiomers, and mixtures of isomers are usually called enantiomeric mixtures. A 50:50 enantiomeric mixture is called a racemic mixture or racemate, which may result in a lack of stereoselectivity or stereodirection during chemical reactions. The terms "racemic mixture" and "racemate" refer to a mixture of two equimolar enantiomers that lack optical activity.

[0092] The term "tautomer" or "tautomer form" refers to isomers of structures with different energies that can interconvert through a low energy barrier. For example, proton tautomers (i.e., proton-transfer tautomers) include interconversions via proton migration, such as isomerization between keto-enols and imine-enamines.

[0093] The term "composition" refers to a mixture of a drug containing one or more of the compounds described herein or their physiologically pharmaceutically acceptable salts or prodrugs, along with other chemical components, such as physiologically pharmaceutically acceptable carriers and excipients. The purpose of the composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and its biological activity.

[0094] The terms “pharmaceutical-grade carrier” or “pharmaceutical-acceptable carrier” include, but are not limited to, any adjuvant, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier that has been approved by the U.S. Food and Drug Administration for use in humans or livestock.

[0095] Unless otherwise specified, the "compounds," "ligands," "nucleic acid conjugates," "double-stranded siRNA conjugates," "double-stranded siRNA," and "nucleic acids" of this invention may exist independently as salts, mixed salts, or non-salts (e.g., free acids or free bases). When present as salts or mixed salts, they may be pharmaceutically acceptable salts.

[0096] As described in this invention, the compounds of this invention may optionally be substituted with one or more substituents, such as the general formula compounds above, or the specific examples, subclasses, and classes of compounds included in this invention, as described in the embodiments. Generally, the term "substituted" means that one or more hydrogen atoms in the given structure are substituted by a specific substituent. Unless otherwise indicated, an optional substituent group may have one substituent substituted at each substituted position of the group. When more than one position in the given structural formula can be substituted by one or more substituents selected from a specific group, the substituents may be substituted at the same or different positions.

[0097] The term "hydroxyl protecting group" refers to an unstable chemical moiety that protects the hydroxyl group from unwanted reactions during one or more synthetic procedures. The hydroxyl protecting group can be selectively removed after the one or more synthetic procedures. Hydroxyl protecting groups known in the art are generally described in TH Greene and PGM Wuts, Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, New York (1999). Examples of hydroxyl protecting groups in this invention include, but are not limited to, C 1-10 Alkylmethyl, benzyloxycarbonyl, 4-nitrobenzyloxycarbonyl, 4-bromobenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, methoxycarbonyl, tert-butoxycarbonyl, isopropoxycarbonyl, biphenylmethoxycarbonyl, 2,2,2-trichloroethoxycarbonyl, 2-(trimethylsilyl)ethoxycarbonyl, 2-furfuryloxycarbonyl, allyloxycarbonyl, acetyl (Ac or -C(O)CH3), formyl, chloroacetyl, trifluoroacetyl, methoxyacetyl, phenoxyacetyl, benzoyl (Bz or -C(O)C6H5), C 1-10Alkyl (methyl, tert-butyl, etc.), 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 1,1-dimethyl-2-propenyl, 3-methyl-3-butenyl, allyl, C 6-10 Aryl C 1-4 Alkyl groups (such as benzyl, phenethyl, etc.), p-methoxybenzyl diphenylmethyl, triphenylmethyl (triphenylmethyl or trirityl), tetrahydrofuranyl, methoxymethyl, methylthiomethyl, benzyloxymethyl, 2,2,2-trichloroethoxymethyl, 2-(trimethylsilyl)ethoxymethyl, methanesulfonyl, p-toluenesulfonyl, C 1-10 Alkyl silyl (such as trimethylsilyl (TMS or -Si(CH3)3)), triethylsilyl, triisopropylsilyl, MMTr, DMTr or 4',4',4'-trimethoxytriphenylmethyl, etc.

[0098] The term "amino protecting group" refers to an unstable chemical component that protects an amino group from unwanted reactions during a synthetic procedure. Following one or more synthetic procedures, the amino protecting group, as described herein, can be selectively removed. Amino protecting groups known in the art are generally described in TH Greene and PGM Wuts, Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, New York (1999). Examples of amino protecting groups include, but are not limited to, acetyl, tert-butoxycarbonyl, 9-fluorenylmethoxycarbonyl, and benzyloxycarbonyl.

[0099] The term "solid support" specifically refers to any particle, bead, or surface on which oligonucleotide synthesis can occur. For example, both inorganic and organic solid supports can be selected for use in embodiments of the invention. Inorganic solid supports are preferably selected from silica gel and controlled-pore glass (CPG). Organic solid supports are resins, preferably macroporous resins, more preferably highly cross-linked polystyrene, Tentagel (a graft copolymer of a low-crosslinked polystyrene matrix with polyethylene glycol (PEG or POE) grafted onto it), polyvinyl acetate (PVA), Poros-polystyrene / divinylbenzene copolymers, amino polyethylene glycol, and cellulose, etc. Preferred embodiments of the invention utilize CPG-based solid supports. Many other commercially available solid supports are also included in this invention.

[0100] Detailed description of the compounds of the present invention

[0101] This invention provides a novel double-stranded siRNA and its conjugates that enable RNA-induced silencing complex (RISC)-mediated cleavage of the angiotensinogen (AGT) gene RNA transcript. The AGT gene can be found intracellularly, for example, in the cells of a subject (e.g., a human). This invention also provides the use of the double-stranded siRNA and its conjugates in the preparation of medicaments for the treatment and / or prevention of AGT-related diseases (such as hypertension), wherein the double-stranded siRNA and its conjugates can inhibit or reduce AGT gene expression by means of RNA-induced silencing complex (RISC)-mediated cleavage of the AGT gene RNA transcript. The siRNA and its conjugates of this invention exhibit high in vivo delivery efficiency and good stability, and possess high gene expression inhibitory activity against AGT and / or low toxicity.

[0102] On one hand, the present invention provides a double-stranded siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises one of the nucleotide sequences shown in SEQ ID NO:4, SEQ ID NO:1-3 and SEQ ID NO:5-13 (i.e., one of the sense strands in Table 1 of the present invention specification), or a nucleotide sequence differing from it by 0, 1, 2, 3, 4 or 5 nucleotides. Detailed information on the nucleotide sequences of SEQ ID NO:4, SEQ ID NO:1-3 and SEQ ID NO:5-13 can be found in Table 1 of the present invention specification.

[0103] The antisense strand comprises one of the nucleotide sequences shown in SEQ ID NO:17, SEQ ID NO:14-16 and SEQ ID NO:18-26 (i.e., one of the antisense strands in Table 1 of this specification), or a nucleotide sequence that differs from it by 0, 1, 2, 3, 4 or 5 nucleotides. Detailed information on the nucleotide sequences of SEQ ID NO:17, SEQ ID NO:14-16 and SEQ ID NO:18-26 can be found in Table 1 of this specification.

[0104] All nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are independently selected from at least one of the following:

[0105] 2'-Methoxy modified nucleotides, 2'-Fluoro modified nucleotides, 2'-Methoxyethyl modified nucleotides, phosphate thioester linked modified nucleotides, 2'-Deoxy modified nucleotides, 2'-Amino modified nucleotides, 2'-Hydroxy modified nucleotides, locked nucleic acid modified nucleotides, unlocked nucleic acid modified nucleotides, glycol nucleic acids, 5'-vinyl phosphate modified nucleotides, 5'-(E)-VP modified nucleic acids, cEt, D-substituted nucleotides, and InvB.

[0106] In some embodiments of the double-stranded siRNA described in this invention, the double-stranded siRNA comprises one of double-stranded siRNA ID NO:1 to 14, wherein the length of the sense strand does not exceed 23 nucleotides, and the length of the antisense strand does not exceed 25 nucleotides. The sequence information of the double-stranded siRNA ID NO:1 to 14 is detailed in Table 1 of this specification.

[0107] In some embodiments of the double-stranded siRNA of the present invention, the sense strand comprises CUCCCACCUUUUCUUCUAA, or a nucleotide sequence differing from it by no more than 5 nucleotides; the antisense strand comprises UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence differing from it by no more than 5 nucleotides. In some embodiments of the double-stranded siRNA of the present invention, the double-stranded region is 14-23 nucleotide pairs long.

[0108] In some embodiments of the double-stranded siRNA described in this invention, the double-stranded region is 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotide pairs long.

[0109] In some embodiments of the double-stranded siRNA described in this invention, the modified nucleotides are each independently located at one or more of the following positions: the nucleotides at the 5' end of the positive strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the start point.

[0110] In some embodiments of the double-stranded siRNA described in this invention, the modified nucleotides are each independently located at one or more positions selected from the following: the nucleotides at the 5' end of the antisense strand are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23 of the start point.

[0111] In some embodiments of the double-stranded siRNA described in this invention, the thiophosphate linkage modification is present at one or more of the following positions:

[0112] The nucleotides at the 5' end of the positive strand are between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, and 20-21 of the start point.

[0113] In some embodiments of the double-stranded siRNA described in this invention, the thiophosphate linkage modification is present at one or more of the following positions:

[0114] The nucleotides at the 5' end of the antisense strand are located between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 of the start point.

[0115] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0116] The nucleotides at the 5' end of the positive strand are the 5th, 7th, 8th, 9th, 10th, and 11th positions of the start point.

[0117] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0118] The nucleotides at the 5' end of the positive strand are the 8th, 10th, 11th, and 12th positions of the start point, and optionally also include the 5th position.

[0119] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0120] The nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions of the start point.

[0121] In some embodiments of the double-stranded siRNA described in this invention, the 2'-fluoromodified nucleotide is present at one or more of the following positions:

[0122] The 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16, which are the starting points of the nucleotides at the 5' end of the antisense strand.

[0123] In some embodiments of the double-stranded siRNA described in this invention, the InvB modification is performed by linking it to the 5' or 3' end of the positive strand via a thiophosphate group or a phosphate group.

[0124] In some embodiments of the double-stranded siRNA described in this invention, the antisense strand comprises two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate modifications at the 5' end.

[0125] In some embodiments of the double-stranded siRNA described in this invention, the positive strand contains two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate modifications at the 5' end.

[0126] The phrase "each independently and optionally existing in one or more of the following positions" or "each independently existing in one or more of the following positions" in this invention refers to the presence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 positions of modification. "Optional" means that there may be modifications or no modifications, i.e., 0 modifications.

[0127] In some embodiments of the double-stranded siRNA described in this invention, the sense strand comprises one of the nucleotide sequences shown in SEQ ID NO:41, SEQ ID NO:27-40, and SEQ ID NO:42 (i.e., one of the sense strands in Table 1-A of this specification); the antisense strand comprises one of the nucleotide sequences shown in SEQ ID NO:48, SEQ ID NO:45-47, and SEQ ID NO:49-58 (i.e., one of the antisense strands in Table 1-A of this specification);

[0128] Detailed information on the nucleotide sequences of SEQ ID NO:41, SEQ ID NO:27-40, SEQ ID NO:42-43, SEQ ID NO:45-47, SEQ ID NO:48 and SEQ ID NO:49-583 can be found in Table 1-A of this specification.

[0129] In some embodiments of the double-stranded siRNA described in this invention, the positive strand comprises one of the nucleotide sequences shown in SEQ ID NO:73, SEQ ID NO:59-72, and SEQ ID NO:74-75; detailed information on the nucleotide sequences of SEQ ID NO:73, SEQ ID NO:59-72, and SEQ ID NO:74-75 can be found in Table 1-B of this specification.

[0130] In some embodiments of the double-stranded siRNA described in this invention, the double-stranded siRNA comprises one of double-stranded siRNA ID NO: B-1 to B-18, wherein the length of the sense strand does not exceed 23 nucleotides, and the length of the antisense strand does not exceed 25 nucleotides. The sequence information of the double-stranded siRNA ID NO B-1 to B-18 is detailed in Table 1-B of this specification.

[0131] In some embodiments of the double-stranded siRNA described in this invention, the length of the sense strand does not exceed 23 nucleotides, and the length of the antisense strand does not exceed 23 nucleotides.

[0132] In some embodiments of the double-stranded siRNA described in this invention, the length of the positive strand is 19, 20, 21, 22, or 23 nucleotides.

[0133] In some embodiments of the double-stranded siRNA described in this invention, the antisense strand is 19, 20, 21, 22, or 23 nucleotides in length.

[0134] In some embodiments of the double-stranded siRNA described in this invention, the length of the sense strand does not exceed 21 nucleotides, and the length of the antisense strand does not exceed 23 nucleotides.

[0135] In some embodiments of the double-stranded siRNA described in this invention, the antisense strand includes a 3' overhang and / or a 5' overhang, the 3' overhang or the 5' overhang comprising 1, 2 or 3 nucleotides.

[0136] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0137] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucusasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0138] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3', and the antisense strand contains a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0139] In some embodiments of the double-stranded siRNA described in this invention, the sense strand contains the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaasgsa-3', and the antisense strand contains the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'. In another aspect, this invention relates to a double-stranded siRNA conjugate comprising the double-stranded siRNA described in this invention and a conjugating group conjugated to the siRNA.

[0140] In some embodiments of the double-stranded siRNA conjugates of the present invention, the 3' or 5' end of the sense or antisense strand of the double-stranded siRNA is conjugated to a conjugating group. Preferably, the 3' end of the sense strand of the double-stranded siRNA is conjugated to the conjugating group. The 3' or 5' end of the sense strand of the double-stranded siRNA is conjugated to the conjugating group via a phosphate ester group, a thiophosphate ester group, or a phosphate group.

[0141] In some embodiments of the double-stranded siRNA conjugates described in this invention, the conjugating group includes GalNAc or a derivative thereof.

[0142] In some embodiments of the double-stranded siRNA conjugates described in this invention, the conjugating group is GalNAc or a derivative thereof linked by a divalent, trivalent, or tetravalent branching linker.

[0143] In some embodiments of the double-stranded siRNA conjugate described in this invention, the conjugating group is L-96 or DAW40007-4, wherein the structures of the conjugating groups L-96 and DAW40007-4 are as follows:

[0144]

[0145]

[0146] In some embodiments of the double-stranded siRNA conjugate described in this invention, the sense strand contains the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsasL96-3', and the antisense strand contains the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0147] In some embodiments of the double-stranded siRNA conjugate described in this invention, the sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasasL96-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0148] The double-stranded siRNA and siRNA conjugates described in this invention also include their (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.

[0149] In another aspect, the present invention relates to a pharmaceutical composition comprising the double-stranded siRNA or double-stranded siRNA conjugate described herein, and a pharmaceutically acceptable carrier.

[0150] In some embodiments, the pharmaceutical composition of the present invention may be an injection solution.

[0151] In some embodiments, the injection solution of the present invention can be used for subcutaneous, intramuscular, or intravenous injection.

[0152] In some embodiments, the pharmaceutical composition of the present invention further includes other therapeutic agents selected from diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists, beta-blockers, vasodilators, calcium channel blockers, aldosterone antagonists, α2-agonists, renin inhibitors, α-blockers, peripherally acting adrenergic agents, selective D1 receptor partial agonists, non-selective α-adrenergic antagonists, synthetic steroidal anti-mineralocorticoid agents, or any combination thereof, as well as hypertension therapeutic agents formulated into pharmaceutical compositions.

[0153] On the other hand, the present invention also provides a method for inhibiting the expression of the AGT gene in a patient, comprising administering to the patient the double-stranded siRNA and the double-stranded siRNA conjugate or a combination thereof (i.e., a double-stranded RNAi agent), wherein the nucleic acid ligand conjugate or the combination thereof may be in a therapeutically effective amount.

[0154] In some embodiments, the double-stranded RNAi agent is administered at a dose of 0.01 mg / kg to 10 mg / kg or 0.5 mg / kg to 50 mg / kg, or at a dose of 10 mg / kg to 30 mg / kg, or at a dose of 3 mg / kg, or at a dose of 10 mg / kg.

[0155] In some embodiments, the double-stranded RNAi agent is administered twice weekly at a dose of 0.5 mg / kg, or every other week at a dose of 10 mg / kg, or once weekly at a dose of 0.5-1 mg / kg.

[0156] In some embodiments, the double-stranded RNAi agent is administered subcutaneously or intravenously.

[0157] In some embodiments, the double-stranded RNAi agent is administered in two or more doses.

[0158] In another aspect, the present invention relates to the use of the double-stranded siRNA and siRNA conjugates or pharmaceutical compositions described herein in the preparation of medicaments for the treatment and / or prevention of AGT-related diseases.

[0159] In some embodiments of the uses described in this invention, the AGT-related disease is hypertension.

[0160] In some embodiments of the uses described in this invention, the hypertension is selected from borderline hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

[0161] The present invention relates to nucleic acid conjugates, compositions, formulations, administration methods, and methods for treating diseases.

[0162] The effective amount of the nucleic acid conjugates (such as siRNA conjugates or pharmaceutical compositions) described in this invention can vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.

[0163] In some embodiments, the present invention provides pharmaceutical compositions comprising an iRNA as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing iRNA can be used to treat diseases or conditions associated with the expression or activity of the AGT gene. Such pharmaceutical compositions are formulated based on the delivery modality. One example is a composition formulated for systemic administration via parenteral delivery, such as subcutaneous (SC) or intravenous (IV). Another example is a composition formulated for direct delivery to the brain parenchyma, such as by infusion into the brain, for example by continuous pump infusion. The pharmaceutical compositions of the present invention can be administered at a dose sufficient to inhibit the expression of the AGT gene. Typically, a suitable dose of the iRNA of the present invention is in the range of about 0.001 to about 200.0 mg per kilogram of body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered at single doses of approximately 0.01 mg / kg, approximately 0.05 mg / kg, approximately 0.5 mg / kg, approximately 1 mg / kg, approximately 1.5 mg / kg, approximately 2 mg / kg, approximately 3 mg / kg, approximately 10 mg / kg, approximately 20 mg / kg, approximately 30 mg / kg, approximately 40 mg / kg, or approximately 50 mg / kg.

[0164] For example, dsRNA can be administered at the following doses: approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4 9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or approximately 10 mg / kg. Intermediate values ​​and ranges of these referenced values ​​are also intended to be part of this invention.

[0165] In other embodiments, the dsRNA was administered at the following doses: about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg. mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / kg, about 1.5 to about 45 mg / kg, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4 0.5 to 45 mg / kg, about 5 to 45 mg / kg, about 7.5 to 45 mg / kg, about 10 to 45 mg / kg, about 15 to 45 mg / kg, about 20 to 45 mg / kg, about 20 to 45 mg / kg, about 25 to 45 mg / kg, about 25 to 45 mg / kg, about 30 to 45 mg / kg, about 35 to 45 mg / kg, about 40 to 45 mg / kg, about 0.1 to 40 mg / kg, about 0.25 to 40 mg / kg, about 0.5 to 40 mg / kg, about 0.75 to 40 mg / kg, about 1 to 40 mg / kg, about 1.5 to 40 mg / kg, about 2 to 40 mg / kg g / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / kg, about 1.5 to about 30 mg / kg, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 The values ​​range from about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Intermediate values ​​and ranges of these referenced values ​​are also intended to be part of this invention.

[0166] The medication may be administered to the subject via any suitable route known in the art, including but not limited to: oral or parenteral routes, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (including oral and sublingual administration), preferably intravenous administration.

[0167] In some embodiments, the pharmaceutical composition may be administered via intravenous infusion over a period of time, such as within time intervals of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21, 22, 23, 24 or approximately 25 minutes. For example, it may be administered regularly, such as weekly, bi-weekly (i.e., every two weeks), for one month, two months, three months, four months or longer. After the initial treatment regimen, treatment may be given at a lower frequency. For example, after three months of weekly or bi-weekly administration, administration may be repeated monthly for six months or one year or longer.

[0168] In some embodiments, the pharmaceutical composition may be administered subcutaneously. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-dose at suitable intervals throughout the day, or even delivered using continuous infusion or a controlled-release formulation. In this case, each sub-dose must contain a correspondingly smaller amount of iRNA to obtain the total daily dose. Dosage units may also be combined for delivery over several days, for example, using conventional sustained-release formulations that provide sustained iRNA release over a period of several days. Sustained-release formulations are well known in the art and are particularly useful for delivering agents in specific portions, as can be used with the pharmaceuticals of the present invention. In this embodiment, the dosage unit contains a corresponding plurality of daily doses. A higher dose (i.e., a loading dose) may be administered initially, followed by lower doses over a duration.

[0169] In some embodiments, a single dose of the pharmaceutical composition may be long-acting, such that subsequent doses are administered at intervals not exceeding 3, 4, or 5 days, or at intervals not exceeding 1, 2, 3, or 4 weeks. In some embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered once weekly. In other embodiments of the invention, a single dose of the pharmaceutical composition of the invention is administered every two months. In a particular embodiment, iRNA is administered about once a month to about once a quarter (i.e., about once every three months).

[0170] The pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be derived from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. Particularly preferred are formulations targeting the liver when treating liver conditions (e.g., liver cancer).

[0171] The pharmaceutical formulations of the present invention (which can be conveniently present in unit dosage forms) can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include steps such as combining the active ingredients with the drug carrier or excipient(s). Generally, these formulations are prepared by the following steps: uniformly and finely combining the active ingredients with a liquid carrier or a finely dispersed solid carrier, or both, and, if necessary, shaping the product.

[0172] The compositions of the present invention can be formulated into any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.

[0173] The pharmaceutical compositions disclosed in this invention comprise formulations suitable for parenteral administration. The formulations can be conveniently available in unit dosage forms and can be prepared by any method known in the pharmaceutical field. The amount of active ingredient that can be combined with excipients to prepare a single-dose form is generally the amount of siRNA that produces the therapeutic effect. Generally, this amount, expressed in percent, is from about 1% to about 99% of the active ingredient, preferably from about 5% to about 70%, and most preferably from about 10% to about 30%.

[0174] In one aspect, the present invention provides a method for treating a subject with an dysregulation that would benefit from reduced AGT expression, said dysregulation being, for example, an AGT-related disease, such as hypertension, including borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-primary hypertension)), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; high blood pressure Hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other hyperglycemic states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other hypermineralocorticoid states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in pregnancy), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementations, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction. The treatment methods (and uses) of the present invention include administering a therapeutically effective amount of an iRNA agent targeting the AGT gene or a pharmaceutical composition containing an iRNA agent targeting the AGT gene to a subject, for example, a human, thereby treating a subject suffering from a dysregulation that would benefit from reduced AGT expression.

[0175] In another aspect, the present invention provides the use of a therapeutically effective amount of the iRNA agent of the present invention for treating subjects, for example, subjects who would benefit from reduced and / or suppressed AGT expression.

[0176] In a further aspect, the present invention provides the use of the iRNA agent (e.g., dsRNA) of the present invention targeting the AGT gene or a pharmaceutical composition comprising an iRNA agent targeting the AGT gene in the manufacture of a medicament for treating a subject, for example, a subject who would benefit from reduced and / or inhibited AGT expression, such as a subject suffering from a dysregulation that would benefit from reduced AGT expression, said dysregulation being, for example, an AGT-related disease, such as hypertension, for example, borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-primary hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, and ocular hypertension. Hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid hyperfunction states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid hyperfunction states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in a pregnant setting), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementation schemes, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction.

[0177] In another aspect, the present invention provides the use of the iRNA (e.g., dsRNA) of the present invention for the prevention of at least one symptom in subjects suffering from an dysregulation that would benefit from reduced and / or suppressed AGT expression, said dysregulation being, for example, AGT-related diseases, such as hypertension, including borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-primary hypertension)), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, and systemic venous hypertension. Systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other hyperglycemic states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other hypermineralocorticoid states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in a gestational setting), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementations, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction.

[0178] In a further aspect, the present invention provides the use of the iRNA agent of the present invention in the manufacture of a medicament for preventing at least one symptom in a subject suffering from an dysregulation that would benefit from reduced and / or suppressed AGT expression, said dysregulation being, for example, AGT-related diseases, such as hypertension, including borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-primary hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, etc. Systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid hyperglycemia (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other mineralocorticoid hyperglycemia, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in a gestational setting), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementations, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction.

[0179] The general synthetic method of the compounds, double-stranded siRNA, and double-stranded siRNA conjugates described in this invention

[0180] Generally, the compounds and nucleic acid conjugates of the present invention can be prepared by the methods described in the present invention. The following reaction schemes and examples are used to further illustrate the content of the present invention.

[0181] Unless otherwise specified, all temperatures described in the examples below are in degrees Celsius (°C). Silica gel columns were used; silica gel (200-300 mesh) was purchased from Qingdao Ocean Chemical Plant, and NH2CPG was purchased from Hebei Dina Xingke. Nuclear magnetic resonance spectroscopy was performed using CDCl3, DMSO-d6, CD3OD, or acetone-d6 as solvents (in ppm), with TMS (0 ppm) or chloroform (7.25 ppm) as reference standards. When multiplets are observed, the following abbreviations will be used: s (singlet), d (doublet), t (triplet), m (multiplet), br (broadened), dd (doublet of doublets), dt (doublet of triplets), br.s (broadened singlet), q (quartet). The coupling constant J is expressed in Hertz (Hz).

[0182] Low-resolution mass spectrometry (MS) data were determined using an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature maintained at 30°C). A G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was used in the LC-MS spectrometer.

[0183] High-resolution mass spectrometry (MS) data were determined using an Agilent 6130 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature maintained at 30°C). A G1329A autosampler and a G1315D DAD detector were used for analysis, and an ESI source was used in the HR-MS spectrometer.

[0184] The following abbreviations are used throughout this invention:

[0185] DCM dichloromethane DMTrCl 4,4'-bismethoxytriphenylmethyl chloride TFA (trifluoroacetic acid) Pyridine i-Pr isopropyl PE, petroleum ether, EA, ethyl acetate TBAF tetrabutylammonium fluoride tetrahydrofuran solution HOBT 1-hydroxybenzotriazole ACN Acetonitrile DMAP 4-Dimethylaminopyridine Ac₂O, acetic anhydride, MsCl, methanesulfonyl chloride Boc tert-ButyloxycarbonylTMSOTf trimethylsilyl trifluoromethanesulfonate MeOH, Methanol, THF, Tetrahydrofuran DMSO (dimethyl sulfoxide) mL DMF N,N-dimethylformamide (min) DCM (dichloromethane, M, N, mol / L) DIPEA N,N-diisopropylethylamine h hours TiPDSCl2 1,3-Dichloro-1,1,3,3-Tetraisopropyldisiloxane RT,rt Room temperature HBTU Benzotriazole-N,N,N',N'-Tetramethylurea hexafluorophosphate Detailed Implementation

[0186] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. In particular, the synthesis of small nucleic acids and nucleic acid conjugates can be obtained by adjusting the synthesis methods according to the embodiments of the present invention or conventional methods in the art. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0187] Preparation Examples

[0188] In the following preparation examples, the inventors have described in detail the preparation process of the compounds of the present invention using some of the compounds as examples, wherein, For CPG.

[0189] Example 1: Synthesis of compound DAW40007-3

[0190]

[0191]

[0192]

[0193] Step 1: Synthesis of Compound 2-2

[0194] Compound 2-1 (2.50 g, 28.05 mmol) and triethylamine (7.8 mL, 56.1 mmol) were dissolved in DCM (120 mL), and benzyl chloroformate (9.57 g, 56.1 mmol) was added dropwise at 0 °C. After the addition was complete, the reaction mixture was heated to room temperature and stirred for 20 h. It was then diluted with saturated ammonium chloride solution (50 mL), separated, the aqueous phase was discarded, the organic phase was concentrated, and the residue was purified by silica gel column chromatography (MeOH / DCM (V / V) = 1 / 30) to give a white solid compound 2-2 (2.96 g, 47.2%).

[0195] MS(ESI,pos.ion)m / z:224.2[M+H] + ;

[0196] 1 H NMR(400MHz, CDCl3)δ7.37(d,J=4.2Hz,5H),5.11(s,2H),5.00(s,1H),4.19–4.14(m,1H),3.70–3.64(m, 2H), 3.24 (t, J=6.4Hz, 2H), 3.15 (q, J=4.6Hz, 1H), 1.90 (dq, J=14.2, 5.0, 4.3Hz, 2H), 1.77–1.71 (m, 1H).

[0197] Step 2: Synthesis of compounds 2-4

[0198] Compounds 2-3 (1.5 g, 4.56 mmol) and 2-2 (1.22 g, 5.47 mmol) were dissolved in 1,2-dichloroethane (30 mL), and 3A molecular sieve (2.0 g) was added. The mixture was stirred at room temperature for 10 min. TMSOTf (0.51 g, 2.28 mmol) was then added, and the reaction mixture was stirred at room temperature for 18 h. The reaction mixture was poured into a saturated sodium bicarbonate solution (100 mL), extracted with DCM (100 mL), washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 2 / 1 to 0 / 1) to give a light brown oily compound 2-4 (1.8 g, 71.51%). MS (ESI, pos.ion) m / z: 553.3 [M+H] + .

[0199] Step 3: Synthesis of compounds 2-5

[0200] Compound 2-4 (0.57 g, 1.03 mmol) and palladium on carbon (0.11 g, 0.1 mmol, 10%) were added to THF (10 mL), followed by TFA (0.12 g, 1.03 mmol). The mixture was then purged three times with hydrogen. The mixture was stirred at room temperature for 19 h under a hydrogen atmosphere. After the reaction was complete, the mixture was filtered through diatomaceous earth, and the solvent was evaporated under reduced pressure to obtain a light brown oily compound 2-5 (0.55 g, 100.32%). MS (ESI, pos.ion) m / z: 419.3 [M-TFA+H] + .

[0201] Step 4: Synthesis of compounds 2-7

[0202] Compound 2-6 (0.46 g, 2.29 mmol, purchased from Shanghai Bied Pharmaceutical Technology Co., Ltd.) and compound 2-5 (1.16 g, 2.18 mmol) were dissolved in DCM (30 mL). HOBT (0.46 g, 3.44 mmol), HBTU (1.30 g, 3.44 mmol), and DIPEA (2.66 mL, 16.03 mmol) were added sequentially. The reaction mixture was reacted at room temperature for 16 h. After the reaction was complete, water (20 mL) and DCM (50 mL × 2) were added sequentially. The organic phase was washed sequentially with saturated sodium bicarbonate solution (30 mL) and saturated brine (20 mL). The solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (MeOH / EA (v / v) = 1 / 20) to give a white solid 2-7 (1.0 g, yield 72.7%).

[0203] MS(ESI,pos.ion)m / z:602.3[M+H] + ;

[0204] 1 H NMR (400MHz, CD3OD) δ5.39–5.33(m,1H),5.07(dd,J=11.2,3.4Hz,1H),4.58(d,J= 8.4Hz,1H),4.21–4.09(m,3H),4.04(t,J=6.7Hz,1H),3.89(dt,J=10.4,5.1Hz,1H ),3.60–3.50(m,1H),3.30–3.13(m,2H),2.16(s,3H),2.04(s,3H),1.97(s,3H),1 .94(s,3H),1.67–1.56(m,4H),1.48(s,9H),1.41–1.37(m,2H),1.02–0.98(m,2H).

[0205] Step 5: Synthesis of compounds 2-8

[0206] Compound 2-7 (0.72 g, 1.17 mmol) was dissolved in DCM (8 mL), and then TFA (0.87 mL, 11.7 mmol) was added. The reaction mixture was stirred at 25 °C for 16 h. The solvent was concentrated to give a brown oily compound 2-8 (0.74 g, 103.1%).

[0207] MS(ESI,pos.ion)m / z:502.2[M+H] + ;

[0208] 1 H NMR (400MHz, CD3OD) δ5.36 (d, J=3.3Hz, 1H), 5.08 (dd, J=11.3, 3.3Hz, 1H), 4.5 8(d,J=8.4Hz,1H),4.16–4.10(m,3H),4.08–4.02(m,1H),3.92–3.85(m,1H),3 .58–3.50(m,1H),3.26–3.20(m,2H),2.16(s,3H),2.04(d,J=5.2Hz,6H),1.98 (s,3H),1.97(s,3H),1.61–1.56(m,4H),1.54–1.52(m,2H),1.42–1.38(m,2H).

[0209] Step 6: Synthesis of Compounds 2-10

[0210] Compounds 2-9 (0.19 g, 0.30 mmol) and 2-8 (0.50 g, 0.99 mmol) were dissolved in DCM (30 mL), followed by the addition of HOBT (0.17 g, 1.26 mmol), HBTU (0.48 g, 1.26 mmol), and DIPEA (0.5 mL, 3.0 mmol). The reaction mixture was stirred at 30 °C for 3 h. After the reaction was complete, water (20 mL) was added to quench the reaction, followed by extraction with DCM (100 mL × 2). The organic phases were combined and washed successively with saturated sodium bicarbonate solution (40 mL) and saturated sodium chloride solution (40 mL). The mixture was dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH (v / v) = 10 / 1) to give a white solid compound 2-10 (0.23 g, yield 37%). MS(ESI,pos.ion)m / z:1046.3[M / 2+H] + ;

[0211] 1H NMR (400MHz, CD3OD) δ7.78(t,J=5.8Hz,2H),7.38–7.36(m,3H),5.36(d,J=3.4Hz,3H),5.13(s,2H),5.08(dd,J=11.2, 3.4Hz,3H),4.58(d,J=8.4Hz,3H),4.21–4.08(m,9H),4.04(t,J=6.7Hz,3H),3.93–3.82(m,3H),3.73–3.66(m,12H),3. 60–3.52(m,3H),3.29–3.18(m,6H),2.52(t,J=6.0Hz,6H),2.38(t,J=7.4Hz,2H),2.20(t,J=7.7Hz,2H),2.16(s,9H), 2.04(s,9H),1.97(s,9H),1.95(s,9H),1.62–1.56(m,12H),1.50–1.42(m,6H),1.35–1.27(m,16H),1.04–0.97(m,6H).

[0212] Step 7: Synthesis of Compound 2-11

[0213] Compound 2-10 (0.20 g, 0.094 mmol) was dissolved in methanol (10 mL), and then Pd / C (10 mg, 10%) was added. The mixture was purged three times with hydrogen, and the reaction mixture was stirred at room temperature for 11 h under a hydrogen atmosphere. After the reaction was complete, the reaction mixture was filtered through diatomaceous earth, and the solvent in the filtrate was evaporated under reduced pressure to give a white solid compound 2-11 (0.19 g, 100%).

[0214] MS(ESI,pos.ion)m / z:1001.1[M / 2+H] + .

[0215] Step 8: Synthesis of compound DAW40007-1

[0216] Compound 2-11 (0.28 g, 0.14 mmol) was dissolved in DCM (20 mL), followed by the addition of HOBT (0.038 g, 0.28 mmol), HBTU (0.080 g, 0.21 mmol), DIPEA (0.054 g, 0.42 mmol), and compound 13 (0.068 g, 0.16 mmol). The reaction mixture was stirred at room temperature for 13 h. After the reaction was complete, the reaction was quenched with water (10 mL), extracted with DCM (20 mL), and the organic phase was washed with saturated sodium bicarbonate solution (10 mL) under reduced pressure. The solvent was evaporated to dryness, and the residue was dissolved in acetonitrile (10 mL). The solution was then separated by a reverse-phase preparative column (acetonitrile / water solution (v / v) = 43% to 60%, 50 min). Salt was added to the separated solution containing the product to saturate the solution, and the organic phase was separated. The aqueous phase was extracted with acetonitrile (100 mL × 2). The organic phases were combined and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and the residue was added to acetonitrile (30 mL). The residue was dried over sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give a light yellow solid compound DAW40007-1 (0.080 g, yield 24%).

[0217] MS(ESI,neg.ion)m / z:2400.18[MH] - ;

[0218] 1H NMR (400MHz, DMSO-d6) δ8.31 (s, 3H), 7.81 (d, J = 9.2Hz, 3H), 7.57 (t, J = 6.0 Hz,3H),7.35–7.26(m,4H),7.20(td,J=8.9,3.0Hz,5H),6.95(s,1H),6.88( ddd,J=8.8,5.8,2.2Hz,4H),5.22(d,J=3.4Hz,3H),4.97(dd,J=11.2,3.5H z,4H),4.49(d,J=8.5Hz,3H),4.40(d,J=4.8Hz,1H),4.15(s,1H),4.07–4.0 0(m,9H),3.88(dt,J=11.2,8.8Hz,3H),3.74(s,9H),3.59–3.48(m,12H),3 .17(dd,J=8.8,5.0Hz,1H),3.10–2.95(m,8H),2.35(t,J=6.3Hz,6H),2.10( s,9H),2.08(s,3H),2.04(d,J=4.7Hz,2H),2.00(s,9H),1.89(s,9H),1.78( s,9H),1.40(d,J=12.2Hz,17H),1.31–1.16(m,18H),0.79(q,J=3.2Hz,6H).

[0219] Step 9: Synthesis of compound DAW40007-2

[0220] Compound DAW40007-1 (0.080 g, 0.033 mmol) was dissolved in DCM (10 mL), and DIPEA (0.029 mL, 0.17 mmol), succinic anhydride (0.008 g, 0.083 mmol), and DMAP (0.014 g, 0.12 mmol) were added. The mixture was stirred at 40 °C for 5 h, and succinic anhydride (10 mg) was added. The reaction was continued for 16 h, and then DCM (10 mL), succinic anhydride (10 mg), and DIPEA (0.05 mL) were added. The mixture was stirred for another 9 h, and then succinic anhydride (10 mg) was added. The reaction was continued for another 10 h, and then DCM (20 mL) was added to dilute the mixture. The mixture was washed with saturated sodium bicarbonate solution (10 mL), and the aqueous phase was discarded. The organic phase was dried over anhydrous sodium sulfate, and the solvent was concentrated under reduced pressure to obtain a white solid compound DAW40007-2 (0.08 g, 96.07%). MS(ESI,neg.ion)m / z:2500.12[MH] - .

[0221] Step 10: Synthesis of compound DAW40007-3

[0222] Compounds DAW40007-2 (0.08 g, 0.032 mmol), HBTU (0.015 g, 0.04 mmol), and DIPEA (0.011 mL, 0.064 mmol) were dissolved in ACN (5 mL) and stirred at room temperature for 5 min. The solution was then transferred to a solid-phase synthesizer containing 0.35 g H2N-CPG (purchased from Hebei Dina Xingke) and shaken for 22.5 h. The mixture was filtered, and the filter cake was washed with DCM / MeOH (V / V = 9 / 1, 10 mL) and DCM (10 mL), and then dried. The resulting filter cake was diluted in 25% Ac2O / Py solution (5 mL) and stirred for 3 h. After filtration, the filter cake was washed successively with DCM / MeOH (V / V = 9 / 1, 10 mL) and DCM (10 mL), and then dried under reduced pressure to obtain a white solid DAW40007-3 (0.357 g), with a loading of 14.95 μmol / g.

[0223] Synthesis of compound L96-DMTr-CPG

[0224]

[0225] Compound L96-DMTr-CPG was prepared according to the method described in patent application WO2014025805A1.

[0226] Compound L96-DMTr-CPG was conjugated with siRNA and then deprotected to obtain L96, and compound DAW40007-3 was conjugated with siRNA and then deprotected to obtain DAW40007-4.

[0227] Example 2: Synthesis of double-stranded siRNA and double-stranded siRNA conjugates

[0228] 1. Synthesis of double-stranded siRNA without conjugated groups

[0229] The synthesis steps of the siRNA sense and antisense strands described in this invention are as follows:

[0230] The synthesis was performed according to the theoretical yield of 1 μmol. All RNA phosphoramide monomers (i.e., nucleotide monomers) and auxiliary reagents for the 1 μmol solid-phase support CPG were commercially available. All phosphoramide monomers were provided in 0.1 M anhydrous acetonitrile solution. For phosphate backbone thiolated oligonucleotides, 0.1 M DDTT solution was used as the thioretin reagent. 5-Ethylthio-1H-tetrazole acetonitrile solution (0.25 M) was used as the activator, 0.02 M iodine in pyridine / water solution as the oxidant, and 3% trichloroacetic acid in dichloromethane solution as the deprotection reagent. These were placed in the designated reagent positions on the automated DNA / RNA synthesizer. The synthesis program was set and the specified oligonucleotide base sequence was entered. After verification, the oligonucleotide synthesis was started in cycles. Each coupling step lasted 6 minutes, and the thioretinization step lasted 6 minutes. After automated cycling, oligonucleotides containing the solid-phase support CPG were obtained.

[0231] Nucleotides containing CPG solid support were transferred to 2 mL EP tubes, and 1.8 mL of 28% ammonia solution was added. The mixture was heated at 55 °C for 5–18 hours. After filtration, the filter cake was washed with 0.5 mL of water. The filtrates were combined and concentrated under reduced pressure to obtain a white or yellow gel-like solid. After reverse-phase purification, the prepared solution was concentrated, passed through a gel column to remove excess salt, yielding oligonucleotides. The concentration of the obtained oligonucleotides was determined using a micro-UV spectrophotometer (SPECTRO stat Nano). Mass spectrometry analysis was performed on an Agilent 6530LC-MS Q-Tof system. The molecular weight of the nucleic acid was calculated after a single-stage scan and deconvolution.

[0232] Annealing steps:

[0233] The positive strand of the double-stranded siRNA synthesized above was mixed with the negative strand synthesized above in an equimolar amount, heated to 95°C, and kept at that temperature for 10 min before being slowly cooled to room temperature. The resulting double-stranded siRNA was then lyophilized to obtain the target double-stranded siRNA.

[0234] 2. Synthesis of siRNA conjugates:

[0235] The antisense strand was synthesized by referring to the above-described methods for synthesizing the sense and antisense strands without GalNac, and was purified through reverse-phase preparation.

[0236] Synthesis of the Justice Chain: Replacing the universal solid support CPG with a GalNAc solid support (e.g., compound L96-DMTr-CPG), referring to the antisense strand synthesis method, the sense strand of the double-stranded siRNA conjugate of this invention was obtained by reverse-phase preparation and purification.

[0237] Annealing steps:

[0238] The sense strand of the double-stranded siRNA conjugate obtained above was mixed with the antisense strand obtained above in an equimolar amount, heated to 95°C, and then slowly cooled to room temperature after 10 min. Subsequently, the target siRNA conjugate was obtained by freeze-drying.

[0239] The unmodified double-stranded siRNAs synthesized by the above method are shown in Table 1; the modified siRNAs synthesized by the above method are shown in Tables 1-A and 1-B; and the double-stranded siRNA conjugates synthesized by the above method are shown in Table 2.

[0240] Table 1: Unmodified double-stranded siRNA synthesized in this invention

[0241]

[0242] Table 1-A: Modified siRNAs synthesized in this invention

[0243]

[0244] In a preferred embodiment of the present invention, the positive strand of the double-stranded siRNA has two consecutive thioscenario modifications at its 3' and 5' ends. These thioscenario modifications are beneficial for improving drug stability. When ligands are attached to the 3' and 5' ends of the double-stranded siRNA, and the ligands are linked to the 3' and 5' ends via thiophosphate esters (as shown in Table 2, the ligands are linked to the 3' end via thiophosphate esters), the thiophosphate ester between the ligand and the nucleotide is considered one of the thioscenario modifications. Furthermore, it should be noted that in the present invention, when invB is linked to the 5' end via thiophosphate ester, the thiophosphate ester between invB and the nucleotide is also considered one of the thioscenario modifications. According to common knowledge in the art (and verified by the inventors in the pharmacological experiments described herein), when the positive strand of the double-stranded siRNA in Table 1-A is linked to a ligand via thiophosphate ester, such as double-stranded siRNA NO... The in vitro knockdown activity of siRNA 29 is essentially the same as that of siRNA conjugate 2 obtained by attaching a ligand. Therefore, those skilled in the art can select appropriate ligands for the double-stranded siRNAs in Table 1-A, such as GalNAc or its derivatives like L96 and DAW40007-4, to obtain double-stranded siRNA conjugates containing ligands with similar activities, based on their technical knowledge in the field. It should also be noted that when a ligand is attached to the 3' end of the positive strand in Table 1-A, the second thiophosphate ester at the 3' end that was not previously attached to a ligand is replaced with a phosphate ester. The purpose of this is to maintain only two thiophosphate backbone modifications at the 3' end of the positive strand.

[0245] Table 1-B: Double-stranded siRNA of the present invention

[0246]

[0247]

[0248] Table 2: Double-stranded siRNA conjugates synthesized in this invention

[0249]

[0250] Unless otherwise specified, in the context of this invention, uppercase letters C, G, U, A, and T represent the bases of natural nucleotides; lowercase letters c, g, u, and a represent the bases at the 2-position of the ribose sugar of nucleotides modified by a methoxy group, such as c, g, u, and a representing 2'-OMe(2'-O-methyl)C, 2'-OMeG, 2'-OMeU, and 2'-OMeA, respectively; uppercase letters with an f on the right represent the bases at the 2-position of the ribose sugar of nucleotides modified by a fluoride group, such as Cf, Gf, Uf, and Af representing 2'-F(2'-fluorine)C, 2'-FG, 2'-FU, and 2'-FA, respectively; "s" indicates that the two nucleotide residues adjacent to "s" are linked by a thiophosphate group, for example, "gsu" indicates that the g and u residues are linked by a thiophosphate group; if there is no "s" between nucleotides, it is assumed that the nucleotides are linked by a natural phosphate group; Tgn represents a thymine-diol nucleotide residue, the structure of which is The link in 5' InvB indicates D is

[0251] Example 3: Cellular activity and cytotoxicity test of the siRNA or its conjugates of the present invention

[0252] Test method:

[0253] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were transfected using transfection reagent. The cell concentration was adjusted to 2.5 × 10⁻⁶ cells / year. 5 / mL, seed 2×10⁶ mg / well in each well of a 96-well plate. 4 Cells were transfected with different concentrations of test siRNA and negative controls according to the instructions of the lipofectamine RNAiMAX transfection reagent.

[0254] 1) Cells were collected after incubation at 37℃ and 5% CO2 for 24 h. The mRNA expression levels of AGT and GAPDH were detected using the QuickEasy Cell Direct RT-qPCR kit (Taqman). The expression of AGT gene in each sample was calculated using a relative quantification method. Finally, the inhibition rate % was calculated as follows: (relative quantification of control - relative quantification of sample) / relative quantification of control × 100%, or the IC50 was calculated using a four-parameter fitting method.50 .

[0255] 2) After incubation at 37℃ and 5% CO2 for 72 h, the cell supernatant was collected and the AGT expression level was detected using the AGT ELISA kit, and cytotoxicity was detected using CCK8.

[0256] Experimental results show that the double-stranded siRNA and its conjugates of the present invention have a good knockdown effect on AGT mRNA. The experimental results of the AGT inhibition rate of some double-stranded siRNAs are shown in Table A.

[0257] Table A: Inhibition rate of some double-stranded siRNAs of the present invention on AGT

[0258]

[0259] Example 4: Evaluation of the knockdown activity of AGT double-stranded siRNA conjugates using hAGT transgenic mice

[0260] To evaluate the in vivo activity of the AGT double-stranded siRNA conjugate, an AGT humanized mouse model (Jicui Pharmaceutical Technology Co., Ltd., NO. T054372 or T058351) was used. Before the experiment, mice were randomly assigned to groups based on body weight, serum AGT, and serum ALT levels, ensuring no statistically significant difference in baseline levels between groups, with 4–5 mice per group. Mice were subcutaneously injected with 1 mg / kg GalNAc-siRNA or physiological saline solution in the neck and back, as a single dose. The day of administration was defined as day 0. After fasting overnight, blood samples were collected on day -1 (before administration) and on days 4, 7, 14, 21, 28, 35, and 42 after administration. Serum samples were prepared and human AGT protein levels were measured using the HumanAGT ELISA Kit (ab287170). The percentage change in serum AGT levels after administration was calculated by comparing it to the baseline level on day -1 (before administration), reflecting the inhibitory activity of the double-stranded siRNA conjugate on AGT protein expression. Among them, the double-stranded siRNA conjugates with ID NO of 2 in Table 2 (i.e., the corresponding double-stranded siRNA conjugates) Figure 1 The experimental results of the relative residual levels of serum AGT protein in humanized mice treated with compound 2) are shown in the appendix. Figure 1 ,in Figure 1 PC in the table represents control 2 (i.e., the double-stranded siRNA conjugate with ID NO of 1 in Table 1).

[0261] Experimental results show that the double-stranded siRNA conjugates of the present invention (especially the double-stranded siRNA conjugates with ID NO of 2) have good inhibitory activity against AGT protein expression in mice.

[0262] Example 5: Evaluation of the knockdown activity of AGT siRNA agent using cynomolgus monkeys

[0263] The in vivo activity of AGT siRNA conjugates was evaluated using healthy male cynomolgus monkeys (2.5–3 years old, weighing 3–5 kg). Before the experiment, monkeys were randomly assigned to groups based on their body weight, ensuring no statistically significant difference in weight between groups, with three monkeys per group. Animals received a single subcutaneous injection of 2 mg / kg GalNAc-siRNA, defined as day 1. After fasting overnight, blood samples were collected on days -7 (before administration), day 1 (before administration), and days 8, 15, 22, 29, 43, 57, 71, 85, 99, and 113 post-administration. Serum AGT protein levels were measured using the Human AGT ELISA Kit (IBL-Japan#27412, cross-reactive with rhesus monkeys). The percentage change in serum AGT levels after administration was calculated by comparing the values ​​on day -7 (before administration) and day 1 (before administration), reflecting the inhibitory activity of the double-stranded siRNA on AGT.

[0264] Experimental results show that the siRNA conjugate of the present invention has good inhibitory activity against AGT protein expression in cynomolgus monkeys.

[0265] As is known in the art, the siRNA conjugate of the present invention is obtained by conjugating an siRNA drug with a GalNAc or its derivative, wherein the conjugate mainly serves a delivery function. When the siRNA has good activity, the siRNA conjugate with the conjugate can be expected to have similar or better AGT inhibitory activity than the siRNA. Those skilled in the art can select appropriate conjugate groups based on their knowledge in the art, such as GalNAc or its derivatives, such as L96 and DAW40007-4.

[0266] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A double-stranded siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein, The positive strand comprises one of the nucleotide sequences shown in SEQ ID NO:4, SEQ ID NO:1~3 and SEQ ID NO:5~13, or a nucleotide sequence that differs from it by no more than 5 nucleotides; The antisense strand comprises one of the nucleotide sequences shown in SEQ ID NO:17, SEQ ID NO:14~16 and SEQ ID NO:18~26, or a nucleotide sequence that differs from it by no more than 5 nucleotides. Preferably, the sense strand contains CUCCCACCUUUUCUUCUAA, or a nucleotide sequence that differs from it by no more than 5 nucleotides; the antisense strand contains UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence that differs from it by no more than 5 nucleotides. All nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are independently selected from at least one of the following: 2'-Methoxy modified nucleotides, 2'-Fluoro modified nucleotides, 2'-Methoxyethyl modified nucleotides, phosphate thioester linked modified nucleotides, 2'-Deoxy modified nucleotides, 2'-Amino modified nucleotides, 2'-Hydroxy modified nucleotides, locked nucleic acid modified nucleotides, unlocked nucleic acid modified nucleotides, glycol nucleic acids, 5'-vinyl phosphate modified nucleotides, 5'-(E)-VP modified nucleic acids, cEt, D-substituted nucleotides, and InvB modified nucleotides.

2. The double-stranded siRNA according to claim 1, wherein each of the modified nucleotides is independently located at one or more positions selected from: The nucleotides at the 5' end of the positive strand are the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the start point; and / or The 5' terminal nucleotide of the antisense strand is at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23 of the start site; and / or The thiophosphate group linkage modification is independently located at one or more of the following positions: The nucleotides at the 5' end of the positive strand are between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, and 20-21 of the start point; and / or The nucleotides at the 5' end of the antisense strand are between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 of the start site.

3. The double-stranded siRNA according to claim 1 or 2, wherein the 2'-fluorinated nucleotide is present at one or more of the following positions: The nucleotides at the 5' end of the positive strand are at positions 5, 7, 8, 9, 10, and 11 of the start point; preferably, the 2'-fluorinated nucleotides are located at positions 8, 10, 11, and 12 of the 5' end of the positive strand, optionally also including position 5; and / or The nucleotides at the 5' end of the antisense strand are the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions of the start site; Preferably, the 2'-fluorinated nucleotides are located at positions 2, 6, 14, and 16 of the nucleotide at the 5' end of the antisense strand, which are the starting positions. Optionally, the InvB modification is attached to the 5' or 3' end of the positive chain via a thiophosphate group or a phosphate group; Optionally, the antisense chain comprises two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate modifications at the 5' end; The positive chain comprises two consecutive thiophosphate modifications at the 3' end and two consecutive thiophosphate esters at the 5' end.

4. The double-stranded siRNA according to any one of claims 1-3, wherein the positive strand comprises one of the nucleotide sequences shown in SEQ ID NO:41, SEQ ID NO:27-40 and SEQ ID NO:42-43; or, the positive strand comprises one of the nucleotide sequences shown in SEQ ID NO:73, SEQ ID NO:59-72 and SEQ ID NO:74-75; The antisense strand includes one of the nucleotide sequences shown in SEQ ID NO:48, SEQ ID NO:45~47 and SEQ ID NO:49~58; Optionally, the length of the sense strand does not exceed 23 nucleotides, and the length of the antisense strand does not exceed 23 nucleotides.

5. The double-stranded siRNA according to any one of claims 1-4, wherein, The sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'; or The sense strand contains the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucusasa-3', and the antisense strand contains the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'; or The sense strand contains the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3', and the antisense strand contains the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'; or The sense strand contains a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaasgsa-3', and the antisense strand contains a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

6. A double-stranded siRNA conjugate comprising the double-stranded siRNA as described in any one of claims 1-5 and a conjugating group conjugated to the siRNA.

7. The double-stranded siRNA conjugate according to claim 6, wherein the 3' or 5' end of the sense or antisense strand of the double-stranded siRNA is conjugated to a conjugating group, preferably, the 3' end of the sense strand of the double-stranded siRNA is conjugated to the conjugating group; wherein, The 3' or 5' end of the positive strand of the double-stranded siRNA is conjugated to the conjugating group via a phosphate ester group, a thiophosphate ester group, or a phosphate group.

8. The double-stranded siRNA conjugate according to claim 6 or 7, wherein the conjugating group comprises GalNAc or a derivative thereof; preferably, the conjugating group is GalNAc or a derivative thereof linked by a divalent, trivalent, or tetravalent branching linker; more preferably, the conjugating group is L-96 or DAW40007-4, wherein... The structures of the conjugation groups L-96 and DAW40007-4 are as follows: 。 9. The double-stranded siRNA conjugate according to any one of claims 6-8, wherein the sense strand comprises the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasasL96-3', and the antisense strand comprises the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'; or The sense strand contains a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsasL96-3', and the antisense strand contains a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

10. A pharmaceutical composition comprising the double-stranded siRNA of any one of claims 1-5 or the double-stranded siRNA conjugate of any one of claims 6-9, and a pharmaceutically acceptable carrier.

11. Use of the double-stranded siRNA of any one of claims 1-5, the siRNA conjugate of any one of claims 6-9, or the pharmaceutical composition of claim 10 in the preparation of a medicament for the treatment and / or prevention of AGT-related diseases.

12. The use according to claim 11, wherein, The AGT-related disease is hypertension, preferably selected from borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

Images