Application of corn Zm00001eb409950 gene and encoding protein thereof in improving or regulating corn kernel traits, breeding method and product

Abstract

The invention discloses an application of a corn Zm00001eb409950 gene and an encoding protein thereof in improving or regulating corn kernel traits, a breeding method and a product, and relates to an application of the Zm00001eb409950 gene related to the corn kernel traits in the aspect of high-yield corn breeding, and a breeding method for improving the corn kernel traits. In the gene breeding research process, it is found that the corn gene Zm00001eb409950 for coding the heat shock protein HSP70-22 is related to the characters of corn kernels, and the hundred-grain weight and the vitamin E content of the corn kernels can be increased by overexpressing the gene in corn. When the gene is used for high-yield corn breeding, the breeding period is short, the efficiency is high, and the nutrition of corn kernels can be improved while the corn yield can be accurately improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant breeding, and particularly relates to a maize Zm00001eb409950 gene and breeding application of a protein coded by the gene. BACKGROUND

[0002] Maize (Zea mays L.) is the world's largest food crop, an important source of feed and industrial raw materials, and its yield traits are directly related to agricultural economic benefits and industry chain stability. Among the three core elements of maize yield (effective panicle number per unit area, kernel number per ear, and 100-kernel weight), 100-kernel weight is a key indicator that is relatively stable under genetic regulation, and its value improvement can directly translate into yield increase per plant, and is one of the target traits for improvement in maize high-yield breeding.

[0003] In addition, with the rapid change of global climate, extreme high temperature events occur frequently, and maize yield is threatened by heat stress. Studies have shown that maize yield can be reduced by 20-40% during the filling stage under continuous high temperature (> 35°C). Under heat stress, the efficiency of the electron transport chain in mitochondria and chloroplasts in maize cells decreases, leading to excessive accumulation of reactive oxygen species (ROS), which is an important way for heat stress to affect maize productivity. Vitamin E (tocopherols and tocotrienols) is a non-enzymatic antioxidant, and the core component of lipid-soluble antioxidant defense, which can directly neutralize ROS in membrane lipids. Therefore, in maize kernels, the accumulation of vitamin E is not only related to nutritional quality, but also directly affects the oxidative stability of seeds during development and storage. Therefore, increasing the content of vitamin E in maize kernels is also one of the target traits for improvement in maize high-yield breeding.

[0004] Traditional breeding methods rely on phenotypic selection, which is long in cycle and low in efficiency, and has been difficult to meet the breeding goal of "high yield, stable yield, and high quality". How to excavate key functional genes that regulate maize productivity and cultivate high-yield maize varieties with high 100-kernel weight and high vitamin E content through genetic engineering has become an important direction to break through the current bottleneck of maize breeding. SUMMARY

[0005] Heat shock protein (Hsp) refers to a special protein induced by high temperature, cold, high salt, drought, and heavy metal ions and other abiotic stresses, which is widely distributed in various organisms. According to the size of molecular weight, heat shock proteins are generally divided into Hsp100, Hsp90, Hsp70, Hsp60, and sHsp, etc. Hsp70 is one of the important members of the heat shock protein family.

[0006] The present application is discovered in the process of genetic breeding research that the corn gene Zm00001eb409950 encoding heat shock protein HSP70-22 is related to the corn kernel traits, and overexpression of the gene in corn can increase the hundred kernel weight and the vitamin E content in the corn kernel. The use of the gene for high-yield corn breeding has short breeding cycle, high efficiency, and can improve the yield of corn and the nutrition of corn kernel.

[0007] The present application aims to provide the application of the Zm00001eb409950 gene related to the corn kernel traits in improving the corn kernel traits and the corresponding corn breeding method to solve the problems in the prior art. The technical problems to be solved by the present application are solved by the following technical solutions.

[0008] On the one hand, the present application provides the use of the corn Zm00001eb409950 gene and the encoded protein for improving or regulating the corn kernel traits, which is to increase the vitamin E content in the corn kernel.

[0009] Preferably, the use further includes increasing the hundred kernel weight of the corn kernel.

[0010] More preferably, the nucleotide sequence of the corn Zm00001eb409950 gene coding region is shown as SEQ ID NO. 1, and the amino acid sequence of the Zm00001eb409950 gene encoded protein is shown as SEQ ID NO. 2.

[0011] On the other hand, the present application also provides a method for improving the corn kernel traits by using the corn Zm00001eb409950 gene. After the Zm00001d028750 gene is transformed into the corn young embryo, the transgenic line overexpressing the Zm00001eb409950 gene is obtained after culture.

[0012] In some embodiments, the method for improving the corn kernel traits further includes the following steps: obtaining the stable homozygous offspring overexpressing the Zm00001eb409950 gene by continuous selfing or crossing of the obtained transgenic line overexpressing the corn gene Zm00001eb409950.

[0013] On the other hand, the present application also provides the use of the corn Zm00001eb409950 gene and the encoded protein for corn breeding or assisted breeding. The corn varieties bred by the present application have the traits of high vitamin E content in the kernel and / or high hundred kernel weight.

[0014] In another aspect, the present application also provides an application of a maize Zm00001eb409950 gene and its coding protein for identifying or selecting or assisting in selecting a maize single plant or line or variety with excellent kernel traits, wherein the identified or selected or assisted in selecting maize has the traits of high vitamin E content in kernels and / or high 100-kernel weight.

[0015] In another aspect, the present application also provides a product for improving maize kernel traits, wherein the product comprises a maize Zm00001eb409950 gene, and the product can make the maize overexpress the Zm00001eb409950 gene.

[0016] Preferably, the product is selected from one or more of the following: an expression cassette containing a maize Zm00001eb409950 gene; a recombinant expression vector containing a maize Zm00001eb409950 gene; a genetically engineered bacterium containing a maize Zm00001eb409950 gene.

[0017] In another aspect, the present application also provides a high-vitamin-E maize, wherein the maize overexpresses a Zm00001eb409950 gene.

[0018] In another aspect, the present application also provides a high-100-kernel-weight maize, wherein the maize overexpresses a Zm00001eb409950 gene.

[0019] The present application has the following beneficial effects: The present application first discovers that overexpression of a maize gene Zm00001eb409950 encoding heat shock protein HSP70-22 can increase the vitamin E content in maize kernels, thereby enhancing the heat stress resistance of maize and increasing the 100-kernel weight of maize kernels, and improving the yield and nutritional value of maize.

[0020] The present application clones an exon fragment of a maize gene Zm00001eb409950, and after transforming the specific fragment gene into maize young embryos through genetic engineering, maize overexpressing heat shock protein HSP70-22 can be bred, and the breeding of high-vitamin-E-content and high-100-kernel-weight maize can be realized. The method of the present application can be used for breeding high-yield and high-nutrition maize, and can realize a short-cycle and high-precision breeding process, and can breed a stable high-yield maize line, wherein the 100-kernel weight of the bred maize variety can be increased by 12.3%, and the vitamin E content can be increased by 60%. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The structure of the expression vector constructed for Example 1 of the present application is shown in the figure.

[0022] Figure 2 The figure is a comparison of the hundred-grain weight of the overexpression corn line and the wild-type corn line in the test example 1 of the present application. Among them, HSP-OE is the Zm00001eb409950 gene overexpression corn line, and CK is the wild-type B104 line.

[0023] Figure 3 The figure is a comparison of the vitamin E content of the overexpression corn line and the wild-type corn line in the test example 2 of the present application. Among them, HSP-OE is the Zm00001eb409950 gene overexpression corn line, and CK is the wild-type B104 line. DETAILED DESCRIPTION

[0024] It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0025] The present application provides a Zm00001eb409950 gene related to corn kernel traits and its encoded protein for use in high-yield and high-nutrition corn breeding. The present application verifies through experiments that overexpression of a specific fragment of the Zm00001eb409950 gene in corn can breed a corn line with significantly improved hundred-grain weight and significantly increased vitamin E content, providing a good theoretical basis and direction for corn yield and quality improvement. The present application is applied to the corn biological breeding process to realize commercial breeding, which has very high economic value.

[0026] In the specific embodiment, the present application provides a use of a corn Zm00001eb409950 gene and its encoded protein for improving or regulating corn kernel traits, which is to increase the content of vitamin E in corn kernels and / or increase the hundred-grain weight of corn kernels.

[0027] The Zm00001eb409950 gene has a coding region nucleotide sequence as shown in SEQ ID NO. 1, and the amino acid sequence of its encoded protein is as shown in SEQ ID NO. 2.

[0028] In the specific embodiment, the present application further provides a method for improving corn kernel traits by using a corn Zm00001eb409950 gene. After the Zm00001d028750 gene is transformed into a corn young embryo, a corn transgenic line overexpressing the Zm00001eb409950 gene is obtained after culture. The bred corn line has significantly improved hundred-grain weight and significantly increased vitamin E content in kernels, which is a high-yield and high-nutrition corn line.

[0029] In the present application, the embodiments not specified specific conditions, according to the conventional experimental conditions or related experimental manual, the wild type corn strain, reagents and kits used as no special instructions, are conventional products can be obtained by commercial.

[0030] Example 1: Construction and identification of Zm00001eb409950 gene overexpression corn lines Step 1 Zm00001eb409950 gene overexpression vector construction A gene for improving the yield of corn is provided, which encodes heat shock protein HSP70-22, the Zm00001eb409950 gene CDS sequence (SEQ ID No. 1, 2112 bp) is cloned from corn B73 leaf, it is found that the gene encodes a protein composed of 488 amino acids (SEQ ID No. 2).

[0031] The gene CDS sequence is transferred into a plant overexpression vector to construct an overexpression vector, as shown in Figure 1 The recombinant vector is then transformed into Agrobacterium, and the corn B104 material is transformed by Agrobacterium infection to create transgenic material, and the T0 generation overexpression transgenic seedlings are obtained, the T0 generation transformed plant DNA is extracted and genotyped.

[0032] Step 2 Zm00001eb409950 gene overexpression line identification The DNA of Zm00001eb409950 transgenic corn plants is extracted by CTAB method, and the specific steps are as follows: (1) Take about 200 mg of fresh leaves into a 2 mL centrifuge tube, and grind into powder with a grinder.

[0033] (2) Add 600 μL of 65℃ preheated 2×CTAB, mix well and incubate at 65℃ water bath for 20 min, shake up and down 2-3 times during the incubation to fully lyse the cells.

[0034] (3) Add 600 μL of chloroform / isopentyl alcohol (24:1), mix well by inverting, then stand for 3-5 min to separate the layers.

[0035] (4) Centrifuge at 10000 r / min for 10 min, and carefully transfer the supernatant to a new 1.5 mL centrifuge tube.

[0036] (5) Add an equal volume of -20℃ pre-cooled isopropanol, mix well by inverting, and place in a -20℃ environment for 30 min to precipitate the DNA.

[0037] (6) 12000 r / min centrifugation for 10 min, pour off the supernatant, add 0.5 mL 70% ethanol solution, invert the DNA precipitate, then pour off the ethanol solution.

[0038] (7) After pouring off the ethanol, dry the DNA precipitate at room temperature.

[0039] (8) Add 200 μL pure water to dissolve the DNA, and store at 4°C for standby use.

[0040] The extracted genomic DNA is subjected to PCR amplification with detection primers, and the transgenic corn DNA is taken as a template to perform PCR amplification with the following detection primers: UBI-F: TTTAGCCCTGCCTTCATACG; HSP-R: TTAGCAATCTGCCCCACC; The PCR amplification conditions are as follows: 95°C preheating for 5 min; 30 amplification cycles (95°C denaturation for 20 sec, 60°C annealing for 30 sec, and 72°C extension for 30 sec / kb), and 72°C extension for 30 sec; The amplification system is as follows: 25 μL Mix, 1.5 μL primer, template (1 ng-1 μg), and ddH2O to make up to 50 μL.

[0041] The target fragment is amplified, and sequencing proves that the fragment is the recombinant vector HSP-Zm00001eb409950 fragment, proving that the recombinant vector has been transferred into corn, and a positive line is obtained, which is named HSP-OE.

[0042] Test Example 1: Verification of the effect of Zm00001eb409950 gene overexpression on regulating the hundred-grain weight of corn The identified Zm00001eb409950 gene overexpression positive line HSP-OE obtained by the method of Example 1 and the corn wild type B104 are planted, and after maturation, the grain hundred-grain weight phenotype is harvested and counted.

[0043] The results are shown in the following table: Figure 2 .

[0044] As shown in the following table: Figure 2 Compared with the wild type B104, the hundred-grain weight of the Zm00001eb409950 overexpression line HSP-OE is significantly increased by 12.3%, indicating that the Zm00001eb409950 gene plays an important role in regulating the hundred-grain weight of corn.

[0045] Test Example 2: Verification of the effect of Zm00001eb409950 gene overexpression on regulating the vitamin E of corn The identified Zm00001eb409950 gene overexpression positive line HSP-OE and wild line B104, obtained through the method in Example 1, were planted and harvested after maturity, and the vitamin E content phenotype of the grains was statistically analyzed.

[0046] The vitamin E content of the seeds was determined using a vitamin E (VE) content detection kit (Wuhan Nuomin Keda Co., Ltd., catalog number NMW0419). The specific steps are as follows: (1) Weigh about 0.1g of corn kernel tissue (about 0.5g of tissue for samples with sufficient moisture), add 200ul of distilled water, then add 300ul of reagent one and 500ul of reagent two, homogenize, and then vortex for 5min (for thorough extraction). Centrifuge at 5000g for 5min at 25℃, take 300µL of the upper n-heptane extract and add it to 900µL of anhydrous ethanol (upper extract: anhydrous ethanol = 1:3), mix well and test. (2) Preheat the microplate reader for 30 minutes, adjust the wavelength to 530 nm, and add the following ingredients to the centrifuge tube in sequence:

[0047] Mix thoroughly and measure the absorbance at 530 nm. Record these values ​​as A control tube, A test tube, A standard tube, and A blank tube. Calculate ΔA = A test tube - A control tube, ΔA standard = A standard tube - A blank tube. Each test tube requires one control tube.

[0048] Plot the concentration of the standard on the x-axis, and its corresponding... Using A as the ordinate (y), a standard curve is plotted, yielding the standard equation y = kx + b. A. Substitute the measured value into the formula to obtain x (ug / mL); calculate according to sample mass: Vitamin E content (ug / g mass) = x × 4 × total sample V ÷ W = 2x ÷ W (Vtotal: Volume of n-heptane added during extraction, 0.5 mL; W: Sample mass, g).

[0049] The results are attached. Figure 3 As shown.

[0050] According to the appendix Figure 3 The results showed that, compared with the wild-type B104, the vitamin E content of the positive strain HSP-OE, which overexpressed the Zm00001eb409950 gene, was significantly increased by 60%, and can be used to improve the quality of maize kernels.

[0051] In summary, combined with the positive identification results and field phenotypic identification results, it is shown that overexpression of the Zm00001eb409950 gene can significantly increase the 100-grain weight and vitamin E content of corn kernels, and can be used for genetic improvement of corn kernel yield and nutritional quality.

[0052] It should be noted that the above detailed description is exemplary and is intended to provide further explanation of the present application. Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs.

[0053] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a maize Zm00001eb409950 gene and the protein encoded thereby for improving or modulating grain traits in maize, characterized in that, The use is for increasing the content of vitamin E in corn kernels.

2. Use of a maize Zm00001eb409950 gene and its encoded protein for improving or modulating maize kernel traits according to claim 1, characterized in that, The use also includes increasing the kernel weight of corn kernels.

3. Use of a corn Zm00001eb409950 gene and its encoded protein for improving or regulating corn kernel traits according to claims 1-2, characterized in that, The coding region nucleotide sequence of the Zm00001eb409950 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the Zm00001eb409950 gene coding protein is shown as SEQ ID NO.

2.

4. A method for improving grain traits in maize using the maize Zm00001eb409950 gene, characterized by, The Zm00001d028750 gene is transformed into corn immature embryos, and after culture, a corn transgenic line overexpressing the Zm00001eb409950 gene is obtained.

5. Use of a maize Zm00001eb409950 gene and the protein encoded by the same for maize breeding or assisted breeding, characterized in that, The corn variety cultivated has the traits of high vitamin E content in kernels and / or high kernel weight.

6. The use of a maize Zm00001eb409950 gene and the protein encoded by the gene for identifying or selecting or assisting in the selection of a maize single plant or line or variety with excellent kernel traits, characterized in that, The corn identified or selected or assisted selection has the traits of high vitamin E content in kernels and / or high kernel weight.

7. A product for improving a maize kernel trait, characterized in that, The product contains the corn Zm00001eb409950 gene, and the product can make the corn overexpress the Zm00001eb409950 gene.

8. The product for improving the traits of corn kernels according to claim 7, wherein, The product is selected from one or more of the following: An expression cassette containing the corn Zm00001eb409950 gene; A recombinant expression vector containing the corn Zm00001eb409950 gene; A genetically engineered bacteria containing the corn Zm00001eb409950 gene.

9. A high vitamin E corn characterized by, The corn overexpresses the Zm00001eb409950 gene.

10. A high test weight corn, characterized by, The corn overexpresses the Zm00001eb409950 gene.

Images