KASP molecular marker primer combination for identifying soybean hundred kernel weight trait and application thereof
By developing a KASP molecular marker primer combo for the 100-seed weight trait in soybeans, the problem of identifying the 100-seed weight trait in soybean breeding was solved, enabling rapid and accurate screening and molecular marker-assisted breeding, thereby increasing soybean yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2026-03-24
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately identify and screen for the 100-seed weight trait in soybean breeding, which affects the improvement of soybean yield.
A primer combo based on KASP molecular markers was developed to screen for SNP mutation markers of the 100-seed weight trait in soybean, located at 7703524 bp on chromosome 6 of soybean genome Wm82.a2.v1. Forward primers F-FAM and F-HEX and reverse primer R were designed, and genotyping was performed by competitive allele-specific polymerase chain reaction (KASP).
This technology enables rapid and accurate screening of soybean 100-seed weight traits, reduces field workload, improves breeding efficiency and accuracy, and promotes the screening and breeding process of high 100-seed weight varieties.
Smart Images

Figure CN120796559B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker development for soybean agronomic traits and molecular marker-assisted breeding technology, and more specifically to a KASP molecular marker primer combination for identifying the 100-seed weight trait of soybean and its application. Background Technology
[0002] Soybeans, as a globally important food and oilseed crop, provide humanity with abundant plant protein and oil resources, occupying a key position in agricultural production and the food industry. In my country, soybean demand has long relied on imports. From 2020 to 2023, the average annual soybean import volume exceeded 90 million tons, with an external dependence rate exceeding 80%, posing a challenge to my country's food security. Consolidating the achievements in expanding soybean planting and supporting the research and promotion of high-oil, high-yield varieties highlight the urgency of improving soybean yield and quality.
[0003] Soybean 100-seed weight, a key indicator of soybean seed size and plumpness, is one of the important agronomic traits affecting soybean yield. Wild soybeans typically have a 100-seed weight of only about 5 grams, while cultivated soybeans, through long-term artificial selection, can have a 100-seed weight of around 20 grams. This significant phenotypic difference contains rich genetic and evolutionary information. From the perspective of yield components, 100-seed weight, along with the number of plants per unit area, the number of pods per plant, and the number of seeds per pod, jointly determine the final soybean yield. Under relatively stable conditions, an increase in 100-seed weight is often accompanied by an increase in yield.
[0004] In soybean breeding practices, in-depth analysis of the molecular genetic basis of 100-seed weight and the discovery of related major genetic loci and key candidate genes are of great significance for breeding high-yielding and high-quality new soybean varieties. In recent years, with the rapid development of molecular biology techniques, methods such as genome-wide association studies (GWAS) have been widely applied in the research field of soybean 100-seed weight. Through precise measurement of the 100-seed weight trait in a large number of soybean germplasm resources, combined with single nucleotide polymorphism (SNP) data discovered through population sequencing, researchers have achieved a series of important results. For example, the research of Professor Wang Zhenyu's team in collaboration with Professor Zhao Tuanjie's team successfully discovered six quantitative trait loci (QTLs) significantly associated with soybean 100-seed weight in a specific soybean population. Meanwhile, as an important trait that has undergone strong selection during domestication, the evolution of the genetic diversity of soybean 100-seed weight has attracted much attention. In addition to the above studies, researchers have successively identified several key genes regulating soybean 100-seed weight. For example, the GmPLATZ gene discovered by Zhang Jinsong's research group at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and its double mutant gmpla / b created through gene editing technology, exhibited phenotypes of smaller grains and reduced grain weight. The SW16.1 gene, obtained by map-based cloning by Academician Gai Junyi's team, encodes a protein containing a LIM domain. This protein regulates the transcriptional level of the MT4 gene by binding to the ABRE cis-acting element, thereby affecting the 100-grain weight of soybeans. Analysis of allelic variations in grain weight genes in soybean germplasm resource populations showed that during soybean domestication, some alleles with negative effects on 100-grain weight were gradually lost, leading to an increase in the frequency of alleles with positive effects. This may be one of the important genetic bases for the significant increase in 100-grain weight in cultivated soybeans. The GmSSS1 gene discovered by He Chaoying's research group at the Institute of Botany, Chinese Academy of Sciences, showed loss-of-function mutants with reduced 100-grain weight, while overexpression of this gene increased 100-grain weight. The study also revealed the origin, selection, and expansion patterns of superior allelic variations in the GmSSS1 gene during soybean domestication and improvement, providing new molecular modules and breeding ideas for increasing soybean yield.
[0005] In summary, significant progress has been made in the research of soybean 100-grain weight at both theoretical and practical levels. However, as 100-grain weight is a complex quantitative trait controlled by multiple genes and susceptible to environmental factors, its genetic regulatory network still needs further refinement. In-depth exploration of the genetic mechanisms of 100-grain weight and the discovery of more gene resources with breeding value are of profound significance for promoting high-yield and high-quality soybean breeding and ensuring my country's food security.
[0006] Therefore, providing a KASP molecular marker primer combination for identifying the 100-seed weight trait of soybeans and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0007] In view of this, the present invention provides a KASP molecular marker primer combination for identifying the 100-seed weight trait of soybean and its application.
[0008] The molecular markers obtained in this invention are closely linked to the soybean 100-seed weight trait and can be used for assisted selection breeding to screen soybean materials with different 100-seed weights and their offspring.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] To achieve the screening function, this invention provides a KASP molecular marker based on BSA pooled sequencing to locate the soybean 100-seed weight trait gene for identifying different soybean 100-seed weights. The molecular marker is an SNP mutation marker located at 7703524bp on chromosome 6 of soybean genome Wm82.a2.v1, and the sequence before and after 50bp is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0011] The KASP molecular marker genotype is C or T; the sequence of the C genotype 50 bp before and after is shown in SEQ ID NO.1, and the corresponding phenotype is low 100-grain weight; the sequence of the T genotype 50 bp before and after is shown in SEQ ID NO.2, and the corresponding phenotype is high 100-grain weight.
[0012] ATCTGTTGCCATAGCTGATGAGAATTCAAATCCCCCAAAGCCTAA GAAAG C GCGGTTAAGAGGAAGTCTTCCAAGAGGAAACCCTCTAGAG ACAAGATGG; SEQ ID NO. 1.
[0013] ATCTGTTGCCATAGCTGATGAGAATTCAAATCCCCCAAAGCCTAA GAAAG T GCGGTTAAGAGGAAGTCTTCCAAGAGGAAACCCTCTAGAG ACAAGATGG; SEQ ID NO. 2.
[0014] In addition, this invention also provides a KASP molecular marker primer set for identifying the 100-seed weight trait of soybeans, the primer sequences of which are as follows:
[0015] Forward primer F-FAM:
[0016] 5'-GAAGGTGACCAAGTTCATGCTCCCCCAAAGCCTAAGAAAGC-3'; SEQ ID NO.3;
[0017] Forward primer F-HEX:
[0018] 5'-GAAGGTCGGAGTCAACGGATTTCCCCCAAAGCCTAAGAAAGT-3'; SEQ ID NO.4;
[0019] Reverse primer R:
[0020] 5'-CAGTATGAATTTGGCCCATCTTG-3'; SEQ ID NO. 5.
[0021] The present invention also provides a kit for identifying the 100-seed weight trait of soybeans, containing the aforementioned KASP molecular marker primer combination.
[0022] The application of the KASP molecular marker primer combination or the kit described herein in the identification or auxiliary identification of the 100-seed weight trait of soybean.
[0023] This invention also provides the use of a KASP molecular marker for the 100-seed weight trait in soybeans for molecular-assisted selection breeding of soybean materials with different 100-seed weights or their offspring.
[0024] This invention also provides a method for developing KASP molecular markers for the 100-seed weight trait of soybean, comprising the following steps:
[0025] (1) The soybean material Qihuang 34, which has a high 100-kernel weight, and the soybean material Dongsheng 16, which has a low 100-kernel weight, were used as parents for hybridization, and then self-pollinated to obtain the F1 generation. 2:5 Recombinant inbred lines (RIL).
[0026] (2) DNA was extracted from the large recombinant inbred line population by CTAB (hexadecyl trimethyl ammonium bromide) method; a genetic map was constructed using SLAF tags.
[0027] (3) This population was planted in Minzhu Town, Daowai District, Harbin City, Heilongjiang Province (longitude 126.78934° (N), latitude 45.85749 (E)) from May 2023 to October 2023, and in Hainan Experimental Base, Yazhou District, Sanya (latitude 18.359129° (N), longitude 109.167372° (E)) from October 2023 to May 2024. After harvest, the weight of 100 seeds was collected, and QTL analysis was performed using QTL Icimapping V4.2 software developed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences.
[0028] (4) Identify SNP variants and InDel insertion / deletion variants that are closely linked to the soybean 100-seed weight trait.
[0029] (5) Primers were designed using the SNP locus information of the parents and the selected SNP loci, and molecular markers for the 100-seed weight trait of soybean were screened using the KASP (Kompetitive Allele Specific Polymerase Chain Reaction) method.
[0030] (6) A KASP molecular marker closely linked to the 100-seed weight trait of soybean was developed.
[0031] The specific method for identifying different weights of 100 soybeans using the above molecular markers is as follows:
[0032] (1) Polymorphism analysis of molecular markers in the high-grain-weight material Qihuang 34 and the low-grain-weight material Dongsheng 16 and their progeny populations:
[0033] KASP molecular markers were designed and developed to detect genotypic polymorphisms in parental materials with different 100-grain weights and their progeny. The KASP molecular marker primer set consists of forward primers F-HEX and F-FAM and a reverse primer R. Note: The primers (molecular markers) were synthesized by Shanghai Sangon Biotech Co., Ltd., and amplified using an ABI Step One PCR instrument.
[0034] The PCR reaction system consisted of: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP MasterMix, and 0.14 μl of KASP MasterMix (F-HEX:F-FAM:R = 2:2:5 molar ratio, primer concentration 10 ng / μl), for a total volume of 10.14 μl.
[0035] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).
[0036] After amplification, fluorescence signals are detected and genotyping is analyzed. If genotyping is insufficient, amplification can continue, with fluorescence signals read every three cycles to check genotyping results, until complete genotyping is achieved.
[0037] Genotyping results as follows Figure 1As shown, this molecular marker can clearly differentiate soybean materials with different 100-grain weights. The low 100-grain weight materials in the population (including the parent Dongsheng 16) have an average grain weight of 24.36g and are homozygous CC genotype, which is shown in red in the figure; the high 100-grain weight materials in the population (including the parent Qihuang 34) have an average grain weight of 25.27g and are homozygous TT genotype, which is shown in blue in the figure; the heterozygous materials are green and have the CT genotype.
[0038] (2) The above molecular markers can be used to carry out molecular-assisted selection breeding for the high 100-seed weight trait in soybeans:
[0039] The KASP molecular marker, designed and developed and closely linked to the high 100-seed weight trait, can be used for preliminary screening of soybean varieties with high 100-seed weight, thereby achieving marker-assisted breeding and accelerating the breeding process. In production, this molecular marker can also be used to detect high 100-seed weight during the seedling stage, screening plants with high 100-seed weight, improving soybean photosynthetic efficiency, promoting dry matter accumulation, and thus increasing soybean yield per unit area.
[0040] A method for identifying the 100-seed weight trait of soybeans includes the following steps:
[0041] (1) Extract genomic DNA from soybean samples to be tested; perform PCR amplification of soybean sample genomic DNA using the KASP molecular marker primer combination described above on an ABI Stepone PCR instrument; detect fluorescence signals using an ABI Stepone PCR instrument and analyze genotyping;
[0042] (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype TT of the high 100-grain weight soybean material, the soybean sample being identified exhibits the high 100-grain weight trait; when the genotype result of the sample is consistent with the genotype CC of the low 100-grain weight material, the soybean sample being identified exhibits the low 100-grain weight trait.
[0043] As can be seen from the above technical solution, compared with the prior art, this invention discloses a KASP molecular marker primer combination for identifying the 100-seed weight trait in soybeans and its application. Based on the obtained KASP markers of soybean genes regulating the 100-seed weight trait, a novel and simple molecular marker and marker-assisted selection method is provided, suitable for rapid screening of soybeans with relatively high or low 100-seed weight and for marker-assisted breeding. This molecular marker can detect the genotypes of materials with different 100-seed weights in natural populations and can also be used for molecular-assisted selection breeding of soybean materials with different 100-seed weights, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. Attached Figure Description
[0044] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0045] Figure 1 The results of molecular marker genotyping and phenotypic association verification of the parental materials Qihuang 34 and Dongsheng 16 and their offspring in this invention;
[0046] Figure 2 The results of molecular marker gene typing and phenotypic association verification for different 100-grain soybean natural populations of this invention are presented. Detailed Implementation
[0047] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0048] Example 1: QTL mapping of the major effect of soybean 100-seed weight trait
[0049] Using Qihuang 34 and Dongsheng 16 as parents, which have significant differences in the 100-seed weight trait, a recombinant inbred line population F1 was constructed by self-pollination after hybridization of the above parents. 2:5 The crops were planted in Harbin and Sanya, and the weight of 100 grains was analyzed after harvest.
[0050] Genomic DNA was extracted from RIL population seedlings using the CTAB method, and QTL analysis was performed. A QTL associated with 100-seed weight was located in the interval 6958449-7672612 on chromosome 6.
[0051] Example 2: Development and Validation of KASP Molecular Markers for the 100-Seed Weight Trait in Soybeans
[0052] Based on the gene mapping results in Example 1, SNPs and InDel mutations in the parental material within the chromosome 6 region were extracted and analyzed, and molecular markers were developed using KASP technology for fine mapping.
[0053] Specifically as follows:
[0054] (1) DNA extraction
[0055] Genomic DNA was extracted from the parents and the RIL population using the CTAB method.
[0056] (2) PCR amplification
[0057] The PCR reaction system consisted of: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP MasterMix, and 0.14 μl of KASP MasterMix (primer concentrations were all 10 ng / μl and met the molar ratio of F-HEX:F-FAM:R = 2:2:5), for a total volume of 10.14 μl.
[0058] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).
[0059] PCR amplification was performed on the ABI Step One PCR instrument. Genotyping information was directly obtained after the instrument detected the fluorescence signal. Results are shown below. Figure 1 Table 1 shows that Qihuang 34 has the genotype TT and is represented by blue; Dongsheng 16 has the genotype CC and is represented by red; and black crosses represent negative controls with no fluorescent signal.
[0060] The forward primers F-FAM and F-HEX each have their own fluorescent adapters (displayed as different colors on the genotyping map, e.g., red for CC genotype, blue for TT genotype, and green for CT genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous CC or TT genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus enabling the differentiation of heterozygous genotypes.
[0061] By screening molecular markers, the KASP molecular marker closely linked to the 100-seed weight trait of soybean was finally obtained. The primer combination sequence for this molecular marker is as follows:
[0062] Forward primer F-FAM:
[0063] 5'-GAAGGTGACCAAGTTCATGCT CCCCCAAAGCCTAAGAAAGC -3';SEQ ID NO.3;
[0064] Forward primer F-HEX:
[0065] 5'-GAAGGTCGGAGTCAACGGATT TCCCCCAAAGCCTAAGAAAGT -3';SEQ ID NO.4;
[0066] Reverse primer R:
[0067] 5'-CAGTATGAATTTGGCCCATCTTG-3'; SEQ ID NO. 5.
[0068] The SNP marker is located at 7703524 bp on soybean chromosome 6. The molecular marker is an SNP mutation marker, classified into C and T genotypes. The 50 bp sequences before and after the molecular marker site are as follows:
[0069] ATCTGTTGCCATAGCTGATGAGAATTCAAATCCCCCAAAGCCTAA GAAAG C GCGGTTAAGAGGAAGTCTTCCAAGAGGAAACCCTCTAGAG ACAAGATGG; SEQ ID NO. 1.
[0070] or
[0071] ATCTGTTGCCATAGCTGATGAGAATTCAAATCCCCCAAAGCCTAAGAAAG T GCGGTTTAAGAGGAAGTCTTCCAAGAGGAAACCCTCTAGAGACAAGATGG; SEQ ID NO. 2.
[0072] according to Figure 1 As shown, the low 100-grain weight materials in the population (including the parent Dongsheng 16) have an average grain weight of 24.36g and are homozygous CC genotype, represented in red in the figure; the high 100-grain weight materials in the population (including the parent Qihuang 34) have an average grain weight of 25.27g and are homozygous TT genotype, represented in blue in the figure; the heterozygous materials are green, with genotype CT.
[0073] Table 1. Genotyping and 100-grain weight data of the RIL population
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080] The weight of 100 soybean seeds in the natural population was measured according to Example 1, and the results were detected according to the method and molecular markers developed in Example 2. The results of the natural population are shown in Table 2.
[0081] Table 2 Genotyping and 100-grain weight data of natural populations
[0082]
[0083]
[0084]
[0085] like Figure 2 (Where red indicates the CC genotype consistent with the low 100-grain weight material Dongsheng 16; blue indicates the TT genotype consistent with the high 100-grain weight material Qihuang 34; and black crosses indicate negative controls with no fluorescence signal.) As shown in Table 2, the 100-grain weight and molecular marker identification results of 70 natural soybean germplasm materials are as follows:
[0086] Based on theoretical predictions, soybeans with the CC genotype should be low 100-seed weight materials, while soybeans with the TT genotype should be high 100-seed weight materials. The theoretical results are largely consistent with the measured 100-seed weight results. Molecular markers can detect different genotypes of materials with different 100-seed weights in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with different 100-seed weights.
[0087] like Figure 2 Analysis of the data in Table 2 shows that the 100-seed weight of homozygous CC genotype soybeans (17.76 g) is significantly lower than that of TT genotype soybeans (21.38 g). Therefore, the molecular markers of this invention are mainly used for the initial screening of soybean varieties with high 100-seed weight to achieve the purpose of molecular marker-assisted breeding.
[0088] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A KASP molecular marker primer set for identifying the 100-seed weight trait of soybeans, characterized in that, The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTCCCCCAAAGCCTAAGAAAGC-3'; SEQ ID NO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTCCCCCAAAGCCTAAGAAAGT-3'; SEQ ID NO.4; Reverse primer R: 5'-CAGTATGAATTTGGCCCATCTTG-3'; SEQ ID NO.
5.
2. The KASP molecular marker primer combination for identifying the 100-seed weight trait of soybean according to claim 1, characterized in that, The KASP molecular marker primer combination was developed from the KASP molecular marker located at 7703524 bp on chromosome 6 of soybean genome Wm82.a2.v1; the KASP molecular marker genotype is C or T.
3. The KASP molecular marker primer combination for identifying the 100-seed weight trait of soybean according to claim 2, characterized in that, When the KASP molecular marker genotype is C, the sequence of the first and last 50 bp is shown in SEQ ID NO.1, and the corresponding phenotype is low 100-grain heavy; when the KASP molecular marker genotype is T, the sequence of the first and last 50 bp is shown in SEQ ID NO.2, and the corresponding phenotype is high 100-grain heavy.
4. A reagent kit for identifying the 100-seed weight trait of soybeans, characterized in that, Contains the KASP molecular marker primer combination as described in any one of claims 1-3.
5. The use of the KASP molecular marker primer combination according to any one of claims 1-3 or the kit according to claim 4 in the identification or auxiliary identification of the 100-seed weight trait of soybean.
6. A method for identifying the 100-seed weight trait of soybeans, characterized in that, Includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; perform PCR amplification of soybean sample genomic DNA using the KASP molecular marker primer combination as described in any one of claims 1-3 on an ABI Stepone PCR instrument; detect fluorescence signals using an ABI Stepone PCR instrument and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype TT of the high 100-grain weight soybean material, the soybean sample being identified exhibits the high 100-grain weight trait; when the genotype result of the sample is consistent with the genotype CC of the low 100-grain weight material, the soybean sample being identified exhibits the low 100-grain weight trait.
Citation Information
Patent Citations
Soybean hundred-grain weight related SNP (Single Nucleotide Polymorphism) site, molecular marker, amplification primer and application thereof
CN116287421A
Molecular marker related to soybean hundred-grain weight character and primer composition and application thereof
CN119799946A