Antigen expression vector and application of combination of antigen expression vector and antibody in cancer treatment

Abstract

The invention discloses an antigen expression vector, a combination of the antigen expression vector and an antibody and application of the combination in cancer treatment. The antigen expression vector comprises one or more DMP-antigen coding gene units; the DMP-antigen coding gene is composed of two functional elements DMP and an antigen coding gene, the DMP is an NF-kappa B specific promoter, and the antigen coding gene is an antigen molecule coding sequence. The antigen expression vector prepared by the invention can selectively express antigen molecules in cancer cells, an in-vivo delivery vector taking adeno-associated virus as the antigen expression vector, and a combination of an antigen CD20 expressed by the antigen expression vector and an anti-CD20 antibody rituximab. The compound has a good treatment effect on mouse colon cancer on mice and human colon cancer on humanized mice, and has good tumor targeting property and safety in the treatment of the cancer mice. The invention is expected to provide a new technology and a new reagent for the treatment of various cancer diseases.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of cancer gene immunotherapy biotechnology, and particularly relates to an antigen expression vector and application of the combination of the antigen expression vector and an antibody in cancer treatment. BACKGROUND

[0002] Cancer is a serious threat to life, with high morbidity and mortality. At present, the world's new cancer incidence is up to 200 million per year, and the death toll is nearly 100 million. As a highly complex systemic disease, humans have developed various treatment technologies and drugs such as surgery, chemotherapy, radiotherapy, targeted therapy, and immunotherapy. Among them, immunotherapy has attracted much attention due to its potential for cure, especially antibody-based immunotherapy, such as therapeutic monoclonal antibodies, immune checkpoint antibodies, antibody conjugate drugs (ADC), and bispecific antibodies (including T cell engagers), which have developed rapidly in recent years. Antigens are targets for cancer immunotherapy, which mediate cancer cell death through specific binding with various antibody drugs via different mechanisms. There are generally two types of antigens related to cancer treatment, one is tumor-associated antigen (TAA), and the other is tumor-specific antigen (TSA). TAA is usually distributed in both cancer cells and normal cells, so immunotherapy targeting TAA inevitably causes off-tumor toxicity. TSA is an antigen that only exists in tumors and is an ideal immunotherapy target, which is expected to avoid off-tumor toxicity of immunotherapy, but the identification of such antigens is very difficult and highly heterogeneous. In addition, tumor immunotherapy targeting antigens also faces two key limitations, one is antigen loss caused by treatment, which makes immunotherapy lose its target and leads to tumor resistance; the other is the high heterogeneity of tumor antigens within tumors, especially in various solid tumors that account for the majority of cancers, which makes immunotherapy targeting a single antigen unable to target all cancer cells. Therefore, natural antigens as targets for tumor immunotherapy have their natural defects, which easily cause off-tumor and tumor resistance and recurrence.

[0003] To break this antigen bottleneck, in recent years, there have been attempts to introduce artificial antigens into tumor cells, such as delivering green fluorescent protein (GFP) by tumor colonization probiotics, introducing fluorescein (FITC) using membrane insertion ligands, or delivering VHH by lipid nanoparticles, etc., hoping to use artificial antigens as targets for tumor immunotherapy. Overall, these strategies alleviate the antigen selection bottleneck and meet the urgent need for CAR-T cell and therapeutic antibody immune recognition in the absence of naturally targetable antigens. However, the clinical translation of these methods faces concerns about biological safety or the efficiency of delivery targets, such as endotoxin contamination from gram-negative bacterial components, non-specific membrane insertion of anchor ligands, and the lack of specificity and stability of lipid nanoparticle mRNA delivery, as well as rapid metabolism. Therefore, artificial antigen technologies with true clinical value are still very limited and cannot form revolutionary and disruptive new immunotherapy technologies and drugs.

[0004] In recent years, the applicant has focused on the technology of tumor cell-specific gene expression in vivo, and based on a transcription factor NF-κB that is over-activated in various cancer cells, a NF-κB-based tumor cell-specific gene expression technology in vivo has been demonstrated. The key to this technology is a NF-κB-specific promoter DMP, which is composed of a NF-κB decoy sequence and a minimal promoter sequence. Through a large number of in vitro and in vivo experiments, we found that DMP can use the over-activated NF-κB in cancer cells to drive the selective expression of exogenous therapeutic genes in tumor cells. Using the currently safest viral vector, adeno-associated virus (AAV), to deliver this in vivo tumor cell-specific gene expression element, we can achieve highly selective expression of exogenous therapeutic genes in cancer cells in mice, thus demonstrating a cancer gene therapy technology platform with potential important application value. SUMMARY

[0005] The present application provides a new strategy for cancer immunotherapy, i.e. an antigen expression vector and its combination with antibodies. The antigen expression vector can specifically express antigen proteins on cancer cells, and the expressed antigen proteins can bind to corresponding antibodies. Then the antibodies bind to immune cells, establishing an immune connection between immune cells and cancer cells, thereby activating immune cells to kill cancer cells. When the antigen expression vector is used to treat tumors in vivo, it can be delivered in vivo by delivery vectors such as recombinant adeno-associated virus, and used for the treatment of human cancer.

[0006] The antigen expression vector and the combination thereof with the antibody provided by the application are expected to solve the neck constriction problems of tumor immunotherapy, such as the scarcity of targetable antigens, the low density of antigens, the loss of antigens, and the heterogeneity of antigens, by redirecting the existing antibody drugs, so that the antibody drugs can be used for the broad-spectrum and universal treatment of different tumors, and the clinical application value of the existing antibody drugs is greatly expanded. In addition, the antigen expression vector and the in vivo delivery thereof provided by the application are a cancer and autoimmune treatment platform with great extension, which can mine the application value of the existing antibody related drugs, such as monoclonal antibodies, ADCs, BsAbs (especially T cell connectors), and the like, so as to increase new indications and be used for the treatment of more kinds of cancers.

[0007] Technical scheme: In order to achieve the above-mentioned purpose, the antigen expression vector for cancer disease treatment provided by the application comprises one to multiple DMP-antigen expression gene units; the DMP-antigen expression gene is composed of two functional elements DMP and antigen expression gene, wherein the DMP is an NF-κB specific promoter, and the antigen expression gene is an antigen molecule coding sequence.

[0008] The NF-κB specific promoter is composed of an NF-κB decoy and a minimum promoter, and the DMP comprises various sequences of the NF-κB decoy and the minimum promoter.

[0009] As a preferred, the sequence of the DMP is shown in SEQ ID NO. 1: 5'-GGGAAT TTC CGG GGA CTT TCCGGG AAT TTC CGG GGA CTT TCC GGG AAT TTC CTA GAG GGTATATAATGGAAG CTC GAC TTCCAG-3'.

[0010] The antigen expression gene is an expression gene of various antigens.

[0011] As a preferred, the antigen expression gene is a CD20 expression gene.

[0012] The coding sequence of the CD20 is SEQ ID NO. 2.

[0013] The sequence SEQ ID NO. 2 of the CD20 is 5 ′- ATG ACAACA CCC AGAAAT TCA GTA AATGGG ACT TTC CCG GCA GAG CCA ATG AAA GGC CCT ATTGCT ATG CAA TCT GGT CCA AAACCA CTC TTC AGG AGG ATG TCT TCACTG GTG GGC CCC ACG CAAAGC TTC TTC ATG AGG GAATCT AAG ACTTTG GGG GCT GTC CAG ATT ATG AAT GGG CTC TTC CAC ATT GCC CTGGGG GGTCTT CTG ATG ATC CCA GCA GGG ATC TAT GCA CCC ATC TGTGTG ACT GTG TGG TAC CCTCTC TGG GGA GGC ATT ATG TAT ATT ATTTCC GGA TCA CTC CTG GCA GCAACG GAG AAAAACTCC AGG AAG TGTTTG GTC AAA GGA AAA ATG ATA ATG AAT TCA TTG AGC CTC TTT GCTGCCATT TCT GGAATG ATT CTT TCAATC ATG GAC ATA CTTAATATTAAAATT TCC CAT TTTTTAAAAATG GAGAGT CTGAAT TTTATTAGAGCT CACACA CCA TAT ATT AAC ATA TAC AAC TGTGAA CCA GCT AAT CCC TCTGAG AAA AAC TCC CCA TCT ACC CAA TAC TGT TAC AGC ATACAA TCTCTG TTC TTG GGC ATT TTG TCA GTG ATG CTG ATC TTT GCC TTC TTCCAG GAA CTTGTAATA GCT GGC ATC GTT GAG AAT GAA TGG AAA AGAACG TGC TCC AGA CCC AAA TCT AACATA GTT CTC CTG TCA GCA GAAGAAAAAAAA GAA CAG ACT ATT GAAATAAAA GAA GAA GTGGTT GGGCTAACT GAA ACA TCT TCC CAA CCA AAG AAT GAA GAA GAC ATTGAAATTATTCCAATCCAA GAA GAG GAA GAA GAA GAAACA GAG ACG AACTTT CCA GAA CCT CCC CAA GATCAG GAA TCC TCA CCA ATA GAA AATGACAGC TCT CCT TAA-3 ′ .

[0014] Wherein, the DMP-antigen expression gene is introduced into cancer cells, and the functional element DMP can bind to the transcription factor protein NF-κB in the nucleus, thereby activating the expression of the antigen expression gene.

[0015] The combination of the antigen expression vector and the antibody for treating cancer diseases, the combination of the antigen expression vector and the antibody includes the antigen expression vector and the antibody, the antibody can bind to the antigen expressed by the antigen expression vector, and can further bind to immune cells, thereby activating the immune cells, so that the immune cells attack and kill the cancer cells.

[0016] The antibody is various types of antibody molecules, including monoclonal antibodies, antibody conjugated drugs (ADC), bispecific antibodies (BsAbs), and chimeric antigen receptors (CAR) displayed on the surface of engineered immune cells.

[0017] Wherein, the monoclonal antibody can bind to the antigen expressed by the antigen expression vector, and further bind to immune cells or the complement system, thereby mediating the attack of the immune cells or the complement system on the cancer cells, resulting in the death of the cancer cells.

[0018] Wherein, the immune cells combined with the antibody include natural killer cells (NK cells) and macrophages; wherein the antibody molecule can bind to the FcγRIIIa (CD16a) of the NK or macrophage through the Fc segment, activate the NK cells through antibody-dependent cell-mediated cytotoxicity (ADCC), or activate the macrophages through antibody-dependent cell-mediated phagocytosis (ADCP), thereby killing the cancer cells; the complement system combined with the antibody can kill the cancer cells through the activation of complement-dependent cytotoxicity (CDC).

[0019] As a preferred, the monoclonal antibody is various antibodies combined with the antigen CD20.

[0020] As a preferred, the antibody combined with the antigen CD20 is rituximab, ofatumumab or obinutuzumab.

[0021] The antibody drug conjugate (ADC) can bind to the antigen expressed by the antigen expression vector, and the drug molecule carried by the antibody drug conjugate (ADC) can be introduced into the cancer cell, resulting in the death of the cancer cell.

[0022] The bispecific antibody can block the signal transduction of the cancer cell or mediate the binding of the immune cell, resulting in the death of the cancer cell.

[0023] Preferably, the bispecific antibody is an immune cell engager.

[0024] Preferably, the bispecific antibody is a T cell engager (TCE).

[0025] The chimeric antigen receptor (CAR) displayed on the surface of the engineered immune cell can bind to the antigen expressed by the antigen expression vector, capture the engineered immune cell, and activate the attack of the engineered immune cell on the cancer cell.

[0026] Preferably, the engineered immune cell is a T cell, an NK cell, or a macrophage with a CAR on the surface.

[0027] The antigen expressed by the antigen expression vector of the present application can also be activated by the MHC molecule to attack the cancer cell without the antibody, and the natural receptor molecule on the immune cell, such as the T cell receptor (TCR), can play the role of the antibody.

[0028] Preferably, the antibody is an antibody that can bind to the CD20 protein, including rituximab, ofatumumab, or obinutuzumab; and the immune cell is an immune cell that can be bound by the antibody, including a natural killer cell or a macrophage.

[0029] The antigen expression vector for treating cancer disease of the present application uses a recombinant adeno-associated virus as the in vivo delivery vector; and the recombinant adeno-associated virus includes various types of recombinant adeno-associated viruses.

[0030] The antigen expression vector can be delivered in vivo using various non-viral and viral vectors.

[0031] Preferably, the antigen expression vector can be delivered in vivo using a recombinant adeno-associated virus.

[0032] The adeno-associated virus includes various natural and artificially modified adeno-associated viruses.

[0033] Preferably, the adeno-associated virus is AAV2.

[0034] The antigen expression vector for cancer disease treatment or the in vivo delivery of the recombinant adeno-associated virus or the combination of the antigen expression vector and the antibody for cancer disease treatment has an application in the preparation of a cancer treatment reagent or drug.

[0035] Further, the cancer includes various types of cancer, that is, the antigen expression vector and the in vivo delivery of the recombinant adeno-associated virus can be used for the treatment of various cancers, and is a broad-spectrum cancer treatment reagent.

[0036] The cancer includes colon cancer.

[0037] The recombinant adeno-associated virus is prepared by intravenous injection or intratumoral injection.

[0038] In addition to being used for the treatment of cancer, the antigen expression vector and the combination of the antigen expression vector and the antibody have potential for the treatment of autoimmune diseases and anti-aging. Autoimmune diseases and aging are closely related to inflammation, and the inflammatory cells and aging cells causing autoimmune diseases have NF-κB activity, so the virus constructed in the application has the potential to stimulate immune cells to eliminate inflammatory cells (especially chronic inflammatory cells), and is expected to be used for the preparation of a drug reagent for the treatment of autoimmune diseases and anti-aging.

[0039] The application proposes and demonstrates a new technology of an antigen expression vector and the combination of the antigen expression vector and the antibody for cancer treatment, which is named as "tumor immune redirection therapy" (TIRT), aiming at the above-mentioned antigen problem of current cancer immunotherapy. The application uses DMP to drive the selective expression of an antigen coding gene on cancer cells in vivo, and the expressed antigen is used as a target of an antibody to activate the immune system to attack cancer cells. The application takes CD20 as an antigen example, and fully demonstrates that the combination of DMP-driven CD20 expression and CD20 antibody rituximab can effectively activate natural killer cells (NK cells) to selectively kill various cancer cells in vivo and in vitro. The application has a significant curative effect on solid tumors through the combination of the antigen expression vector for cancer disease treatment and the in vivo delivery of the recombinant adeno-associated virus containing the antigen expression vector and the antibody.

[0040] Beneficial effects: compared with the prior art, the application has the following advantages:

[0041] (1) Retargeting of Existing Antibody-Related Drugs. For example, the CD20 antigen is mainly expressed in mature B lymphocytes and some pre-B cells, and is almost absent in hematopoietic stem cells, terminally differentiated plasma cells, and other normal tissues, making it a recognized therapeutic target with high safety and strong druggability. Rituximab, as one of the first approved monoclonal antibodies, targets CD20, laying the cornerstone for immunotherapy of B-cell lymphoma. Currently, immunotherapy targeting CD20 has made significant progress, covering various forms such as traditional monoclonal antibodies, antibody-drug conjugates (ADCs), bispecific antibodies (BsAbs), and chimeric antigen receptor T cells (CAR-T). However, currently, CD20 antibody-based immunotherapies such as rituximab are only used for the immunotherapy of hematological malignancies such as B-cell lymphoma. By using the antigen expression vector proposed in this invention, the antigen molecule CD20 can be successfully expressed on solid tumor cells, thereby enabling rituximab to be used for the treatment of various hematological malignancies and solid tumors other than B-cell lymphoma, thus greatly developing the application value of the existing drug rituximab, i.e., antibody retargeting. Drug retargeting is the most ideal and economical strategy for new drug development because the efficacy, safety, and production of existing drugs already used in clinical practice have been fully demonstrated and guaranteed.

[0042] (2) Solving the antigen problem that severely restricts tumor immunotherapy—antigen deficiency, antigen loss, and antigen heterogeneity. Using the antigen expression vector proposed in this invention, various cancer cells can be normalized and labeled with a specific antigen, such as CD20. This allows existing drugs targeting a specific antigen, such as rituximab targeting CD20, ADCs, T-cell connectors, and CAR-T, to be used for broad-spectrum and universal treatment of various tumors. This not only solves the problems of antigen deficiency and antigen heterogeneity but also greatly expands the application value of existing drugs. Furthermore, high-dose or repeated administration can solve the antigen loss problem.

[0043] (3) Existing antibodies exert their therapeutic effects by targeting the natural distribution of natural antigens in cells within the body. However, the antigen expression vector proposed in this invention can free antibody-based therapy from this heavy dependence on the natural distribution of natural antigens. By combining the antigen expression vector with antibodies, precise antigen labeling and antibody-based therapy can be performed on any type of cancer. For tumor cells, the antigen expressed on tumor cells using this antigen expression vector is a newly created artificial antigen.

[0044] (4) Immunotherapy requires the interaction of antigen and antibody to produce therapeutic effect. In the example of the present application, it can be seen that neither the antigen expression vector alone nor the antibody alone has significant therapeutic effect on solid tumor colon cancer, but the combination of the antigen expression vector and the antibody has significant therapeutic effect on solid tumor colon cancer. Because, the antigen expression vector alone only plays the role of antigen marker of tumor, and the antibody alone has no antigen to interact with, and the combination of the two has antigen marker of tumor cells and antibody binding to it, which effectively stimulates immune response and produces therapeutic effect. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 Schematic diagram of TIRT principle and NF-κB expression in different cell types. (A) Schematic diagram of TIRT anti-tumor mechanism. (B) qPCR analysis of NF-κB RELA / P65 expression in various cells (n = 3 biologically independent samples). Statistical significance was determined by comparing cancer cells with normal cells. Data are expressed as mean ± standard deviation (SD) and statistical analysis was performed using one-way ANOVA and Tukey's post-hoc test.

[0046] Figure 2 Flow cytometry analysis of CD20 surface expression after transfection with pAAV-DMP vector. (A) Representative flow cytometry histograms of cells 72 hours after transfection with pAAV-MCS, pAAV-mCD20 or pAAV-hCD20 plasmids. (B) Quantitative analysis of mCD20 and hCD20 surface expression. Data are expressed as mean fluorescence intensity (MFI) ± standard deviation (SD) and are derived from three biologically independent replicate experiments.

[0047] Figure 3 TIRT-mediated CD20 expression can promote NK cell activation and induce ADCC in tumor cells. (A, B) Representative flow cytometry histograms of NK cell activation markers in co-culture systems of tumor cells and normal cells after different treatments. Tumor cells (HCT116, PANC-1, MDA-MB-231) or normal cells (HL7702, GES-1, MCF-12A) were transfected with pAAV-DMP-CD20 or control plasmid (pAAV-MCS), then co-cultured with PBMC and given rituximab (RTX) or control treatment. The expression of NK cell surface CD107a (A) and intracellular IFN-γ (B) was detected. + NK cells (C) and IFN-γ +Quantitative analysis of NK cells (D). (E) LDH release assay to evaluate ADCC effect. Data are presented as mean ± standard deviation (SD) (n = 3 biological replicates) and statistical significance was determined using one-way ANOVA followed by Tukey’s post-hoc test.

[0048] Figure 4 Gating strategy for in vitro NK cell experiments. (A) FSC-H vs. SSC-H scatter plot to gate lymphocyte population and exclude debris. (B) FSC-A vs. FSC-H scatter plot to select singlets. (C) Within singlets, CD3-CD56 + cells were identified as NK cells and used for subsequent analysis of CD 107a and IFN-γ expression.

[0049] Figure 5 Western blot analysis of hCD20 expression in HCT116 tumor spheroids. Tumor spheroids were transduced with rAAV-hCD20 or control vector (rAAV-MCS), respectively, and analyzed 72 hours later. Total proteins were extracted and immunoblotted with anti-CD20 and anti-β-actin antibodies, and bands were visualized by Odyssey infrared imaging system (LI-COR). The results show that CD20 was detected only in rAAV-hCD20-transduced tumor spheroids, confirming the high efficiency of viral transduction.

[0050] Figure 6 TIRT induces significant cytotoxic effect in HCT116 tumor spheroids. (A) Representative images of different treatment groups of HCT116 tumor spheroids: optical (bright field), Calcein AM live cell staining (green), propidium iodide (PI) dead cell staining (red), and merged image. Treatment groups include rAAV-MCS, rAAV-MCS + rituximab, rAAV-hCD20, and rAAV-hCD20 + rituximab. Only in the rAAV-hCD20 + rituximab treatment group, a clear structural disintegration and extensive PI staining were observed, while control tumor spheroids maintained a tight structure and exhibited strong Calcein AM signal. Scale bar = 50 μm. (B) Quantitative analysis of tumor spheroid area (μm2) showed that the TIRT combination treatment group was significantly reduced (about 70%) compared to all control groups. (C) Analysis of fluorescence intensity of Calcein AM (live cells) and PI (dead cells) staining in each treatment group. Data are presented as mean ± standard deviation (SD) (n = 3 biological replicates); statistical significance was determined using one-way ANOVA followed by Tukey’s post-hoc test. 2

[0051] Figure 7 ​In vivo anti-tumor activity of TIRT in humanized HCT116 xenograft tumor model. (A) Treatment schedule of humanized HCT116 xenograft tumor. (B) Body weight change of mice. (C) Tumor growth curve. (D) Tumor photographs at the end of the study. (E, F) Tumor volume (E) and weight (F) at the time of dissection (n = 6 per group). (G) TUNEL staining results showed that tumor cell apoptosis was significantly increased in the rAAV-hCD20 + rituximab group, and the difference was significant compared with the control group. (H) NK cell analysis experimental schedule: 4 days after rituximab treatment, tumor infiltrating lymphocytes were isolated and detected by flow cytometry with CD45, CD3 and CD56 antibodies. (I) Flow cytometry of NK cells (CD45 + CD3-CD56 + ) and quantitative analysis showed that the proportion of NK cells in the rAAV-hCD20 + rituximab group was significantly higher than that in the rAAV-MCS + rituximab group.

[0052] Figure 8 Flow cytometry gating strategy for identifying CD45 + tumor infiltrating lymphocytes (TILs) in NCG humanized HCT116 xenograft tumor model.

[0053] Figure 9 Biodistribution of rAAV DNA and tumor-specific hCD20 mRNA expression in humanized HCT116 xenograft model. (A) At the end of the study in NCG humanized HCT116 model, rAAV distribution in major organs (heart, liver, spleen, lung, kidney) and tumor tissue was detected. (B) The expression level of hCD20 mRNA in the same tissues was determined by qRT-PCR. The results showed that rAAV DNA could be detected in all organs tested, but hCD20 transcript was significantly increased only in tumor tissue. Data are expressed as mean ± standard deviation (SD) (n = 6 per group). Statistical analysis was performed by one-way ANOVA and Tukey's multiple comparison test.

[0054] Figure 10Safety evaluation of TIRT treatment in humanized HCT116 xenograft model. (A) Serum biochemical test results at the end of the experiment (day 16 after transplantation), including liver function indicators (ALT, AST, ALP) and kidney function indicators (BUN, Cr, UA). There was no significant difference between the PBS group, rAAV-MCS + rituximab + PBMC group and rAAV-hCD20 + rituximab + PBMC group, suggesting that no hepatotoxicity or nephrotoxicity occurred. (B) Representative H&E staining images of major organs (heart, liver, spleen, lung, kidney) in each treatment group. Data are expressed as mean ± standard deviation (SD) (n = 3 per group). Statistical significance was assessed using one-way ANOVA and Tukey's multiple comparison test.

[0055] Figure 11 Anti-tumor efficacy of TIRT in an immune-competent C57BL / 6 colon cancer mouse model. (A) Schematic diagram of the treatment regimen for C57BL / 6 mice inoculated subcutaneously with MC38 tumors. (B) Changes in mouse body weight during treatment. There was no significant difference between groups, suggesting that no systemic toxicity occurred. (C) Tumor growth curve showing that only the rAAV-mCD20 combined with mCD20 antibody treatment group significantly inhibited tumor progression, with a statistically significant difference compared to all control groups (P < 0.0001). (D) Actual tumor images taken at the end of the study. (E, F) Tumor volume (E) and weight (F) measurements showed that the tumor inhibition effect of the combined treatment group was significantly better than that of the single-drug group or control group. Data are expressed as mean ± standard deviation (SD). Tumor growth, volume and weight were analyzed using one-way ANOVA and Tukey's multiple comparison test.

[0056] Figure 12 Distribution of rAAV and gene expression in C57BL / 6 mice after TIRT treatment. (A) The content of rAAV DNA in major organs (heart, liver, spleen, lung, kidney) and tumor tissue was detected by qPCR. (B) The expression of target gene mCD20 was detected by qRT-PCR (2^-ΔCt method). Data are expressed as mean ± standard deviation (SD). (C) The expression level of RELA mRNA was detected by qRT-PCR, and the results showed that the expression of RELA in tumor tissue was significantly higher than that in other tissues. Statistical comparison was performed using one-way ANOVA and Tukey's multiple comparison test.

[0057] Figure 13Safety evaluation of TIRT treatment in immunocompetent C57BL / 6 mouse model. (A) Hematology and biochemistry parameters at the end of the experiment were examined for comparison among treatment groups including rAAV-MCS, rAAV-mCD20, mCD20 antibody (mCD20 Ab) and their combinations. Parameters examined include hematology (RBC, WBC, PLT, HGB), liver function (ALT, AST, ALP) and kidney function (BUN, Cr, UA). Except for the decrease in white blood cell count (WBC), no significant abnormalities were observed, and the decrease in WBC is consistent with the expected performance of B cell depletion after CD20-targeted therapy, and this effect is clinically manageable (n = 3 per group). (B) Spleen weight analysis showed no significant difference between the groups, and the appearance of the spleen was provided for comparison. (C) H&E staining histological examination of major organs (heart, liver, spleen, lung, kidney) showed no pathological damage to other important organs except the spleen. In groups receiving mCD20 Ab treatment, spleen sections showed a decrease in germinal centers, consistent with the characteristics of B cell depletion caused by CD20-targeted therapy. Data are expressed as mean ± standard deviation (SD). Statistical significance was analyzed by one-way ANOVA and Tukey's multiple comparison test.

[0058] Figure 14 Anti-tumor efficacy of TIRT in immunocompetent C57BL / 6 colon cancer mouse model. (A) Treatment schedule for C57BL / 6 mice inoculated subcutaneously with MC38 tumors (survival analysis). (B) Kaplan-Meier survival analysis of MC38 tumor-bearing mice, comparing PBS group, rAAV-MCS + mCD20 antibody group and rAAV-mCD20 + mCD20 antibody group. Combination therapy significantly prolonged the survival of mice, and the difference was significant compared with the control group. Survival curves were evaluated using the log-rank (Mantel-Cox) test. DETAILED DESCRIPTION

[0059] The application will be further described below with reference to the drawings and examples.

[0060] The materials, reagents, etc. used in the examples can be obtained from commercial channels unless otherwise specified.

[0061] Example 1

[0062] I. Materials and Methods

[0063] 1. DNA construction: Decoy minimal promoter (DMP) is a chemically synthesized NF-κB specific promoter, which is composed of NF-κB response element (5'-GGGAATTTC CGG GGACTT TCC GGGAAT TTC CGG GGACTT TCC GGGAATTTC C-3') and minimal promoter sequence (5'-TAGAGG GTA TAT AAT GGAAGC TCG ACT TCC AG-3'), the specific sequence is shown as SEQ ID NO. 1. The sequence is used to replace the CMV promoter in pAAV-MCS vector (Stratagene), thereby constructing pAAV-DMP vector.

[0064] Mouse CD20 antigen coding sequence is obtained by chemical synthesis (NM_007641.6), the obtained sequence is amplified by PCR (Table 1 primers Mouse CD20-F and Mouse CD20-R), and is connected to pAAV-DMP plasmid by using EcoRI and BamHI enzyme cutting sites, to generate pAAV-DMP-mCD20 construct. To enhance transgene expression, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is inserted downstream of the CD20 gene, which is completed by using homologous recombination with ClonExpress Ultra One Step Cloning Kit (Vazyme), and the obtained vector is named as pAAV-DMP-mCD20-WPRE (abbreviated as pAAV-mCD20). The WPRE element is amplified from the lentivirus commonly used vector GV341 (Jikai Gene) by using Table 1 primers (WPRE-F and WPRE-R). Human CD20 antigen coding sequence (SEQ ID NO. 2) is also obtained by chemical synthesis (NM_021950.4), and the obtained sequence is amplified by PCR (Table 1 primers Human CD20-F and Human CD20-R). Subsequently, pAAV-mCD20 is linearized by double enzyme digestion of EcoRl and BamHI (eliminating mCD20 sequence), and human CD20 coding sequence is introduced by homologous recombination, to generate pAAV-DMP-hCD20-WPRE (abbreviated as pAAV-hCD20). All primers used for plasmid construction are synthesized by Shanghai Shengong Bioengineering Co., Ltd., and the specific sequences are shown in Table 1. All plasmids (including pAAV-MCS, pAAV-mCD20 and pAAV-hCD20) are transformed into E. coli DH5α (Vazyme), purified by EndoFree plasmid extraction kit (Vazyme), and the correctness is verified by DNA sequencing.

[0065] Table 1 primer sequences used for plasmid construction

[0066] Name Primer sequence (5'-3') MouseCD20-F GAATTCGCCACCATGAGTGG MouseCD20-R GGATCCTTAAGGAGCGATCTCA HumanCD20-F AGCTCGACTTCCAGGAATTCACTAGCACAACCCCAGA HumanCD20-R CGACTCTAGAGGACTCCTTAAGGAGAGGCTGCTATTTTCT WPRE-F GAGTCGACCTGCAGAAGCTTAACTCAACCTCTGGATT WPRE-R TGCTCGAGGCAAGCTCGCGGGAGGCGGGCCCAAAG

[0067] 2. Cell culture and PBMC isolation: The cell lines used in this application include: HEK-293T (human fetal kidney cells), HCT116 (human colon cancer cells), PANC-1 (human pancreatic cancer cells), MDA-MB-231 (human breast cancer cells), MC38 (mouse colon cancer cells), HL7702 (human normal liver cells), GES-1 (human gastric mucosa epithelial cells), MCF-12A (human mammary epithelial cells) and NIH-3T3 (mouse embryonic fibroblasts). HEK-293T, PANC-1, MDA-MB-231, MC38, HL7702, GES-1 and NIH-3T3 cell lines were obtained from the Cell Resource Center of Shanghai Life Science Research Institute, Chinese Academy of Sciences, and HCT116 and MCF-12A cell lines were purchased from ATCC. HEK-293T, HCT116, PANC-1, MDA-MB-231 and NIH-3T3 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco), and HL7702, GES-1, MCF-12A and MC38 cells were cultured in RPMI-1640 medium (Gibco). All media were supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin and 100 μg / mL streptomycin (Gibco). Cells were cultured in a 37 °C, 5% CO2saturated humidity incubator. Healthy donor peripheral blood was subjected to density gradient centrifugation using SepMate tubes and Lymphoprep (STEMCELL Technologies), and the human PBMC layer was collected, washed with RPMI 1640 containing 5 mM EDTA and 2% FBS, and resuspended in RPMI 1640 medium supplemented with 10% FBS for use.

[0068] 3. Cell transfection: Cell transfection experiments were performed according to the instructions of Lipofectamine 2000 (Thermo Fisher Scientific) and were operated according to the manufacturer’s instructions. Briefly, 5 x 105cells were seeded in 6-well plates and incubated for 24 h. Then, 2 μg of plasmid DNA and 6 μL of Lipofectamine 2000 were diluted in 2 mL of Opti-MEM (Gibco) and incubated for 5 min at room temperature. The DNA-Lipofectamine 2000 complex was added to the cells and incubated for 6 h. The medium was replaced with fresh medium, and the cells were incubated for 48 h before being used for experiments. 5Cells were seeded in 6-well plates and cultured overnight. After overnight culture, each well of cells was transfected with 4 pg of pAAV-MCS, pAAV-mCD20 or pAAV-hCD20 plasmid, respectively. After 72 hours of transfection, cells were collected for flow cytometric surface staining. All samples were resuspended in FACS buffer and stained with anti-human CD20-APC antibody (clone 2H7, Biolegend, USA) or anti-mouse CD20-PE antibody (clone QA18A73, Biolegend, USA) at 4 °C in the dark for 30 min. After washing three times, the cells were resuspended in FACS buffer. Data were collected using a NovoCyte 2000R flow cytometer (Agilent Technologies) and analyzed using FlowJo software (v10.6.2).

[0069] 4. CD107a and IFN-g detection: CD107a and IFN-g expression are commonly used indicators to evaluate NK cell function and cytotoxic activity. Therefore, the present application uses CD107a degranulation and IFN-g production experiments to evaluate NK cell function. Human PBMCs were activated with 50 U / mL IL-2 (R&D Systems) overnight and used as effector cells. Tumor cells and normal cells transfected with pAAV-MCS or pAAV-hCD2072 hours were used as target cells. The target cells were first incubated with rituximab (10 pg / mL) at 37 °C for 30 min, and then co-cultured with effector PBMCs at an E:T ratio of 30:1. Anti-CD107a-FITC antibody (H4A3, BioLegend) and 1x Monensin (BioLegend) were added at the beginning of co-culture, and incubated at 37 °C, 5% CO2 for 4 hours. Then the cells were collected and stained with anti-CD3-PE (clone SK7, BioLegend, USA) and anti-CD56-APC (clone 5.1H11, BioLegend, USA) for surface staining to identify the NK cell population Figure 4 ). Cyto-Fast TM Fix / Perm reagent (clone BioLegend, USA) was used for fixation and permeabilization. Anti-IFN-g-FITC antibody (clone 4S.B3, Biolegend, USA) (1:20) was added and incubated at 4 °C for 30 min. After washing, the cells were detected by NovoCyte 2000R flow cytometry and analyzed by FlowJo.

[0070] 5、In vitro antibody-dependent cell-mediated cytotoxicity (ADCC) assay: The ADCC assay was performed by lactate dehydrogenase (LDH) release assay. The tumor cells and normal cells were transfected with pAAV-MCS or pAAV-hCD20, respectively, and incubated with rituximab (10 μg / mL) for 30 min, and then co-cultured with IL-2 (50 U / mL) activated PBMCs at an E:T ratio of 30:1 for 4 h. The supernatant was collected, and the content of LDH was detected using a CytoTox96 non-radioactive cytotoxicity assay kit (Promega). The ADCC (%) was calculated according to the following formula: ADCC (%) = (sample LDH release value - spontaneous LDH release value) / (target cell maximum LDH release value - target cell spontaneous LDH release value) x 100, and all experiments were biologically repeated three times.

[0071] 6、Virus preparation: HEK293T cells were seeded in 75 cm 2 bottles at a cell density of 5 x 10 6 After overnight culture, three plasmids, including two helper plasmids (pHelper and pAAV-RC) and one target plasmid (pAAV-MCS, pAAV-hCD20, or pAAV-mCD20), were co-transfected according to the instructions using ExFect (Vazyme, China). After 72 h, the cells and culture medium were collected, frozen at -80°C overnight, and then thawed at 37°C. The thawed cells were subjected to repeated freezing and thawing for 3 times. After lysis, chloroform was added (1 / 10 of the total volume), and the mixture was shaken at 37°C for 1 h. NaCl was then added to a final concentration of 1 M, and the solution was centrifuged (12,000 x g, 15 min, 4°C) to collect the supernatant. PEG8000 was added to the supernatant to a final concentration of 10%, and the mixture was dissolved by stirring and then centrifuged (12,000 x g, 15 min, 4°C). The precipitate was resuspended in PBS, and DNase and RNase (1 μg / mL) were added for incubation at room temperature for 30 min. The incubated reaction solution was extracted with an equal volume of chloroform, and the upper aqueous phase was collected to obtain purified virus. The virus titer was determined by qPCR (primers: AAV-F and AAV-R, see Table 2), and the results were expressed as the number of virus genomes (vg). The virus was stored at -80°C and named rAAV-MCS, rAAV-hCD20, and rAAV-mCD20.

[0072] 7、3D tumor sphere culture of HCT116: Tumor spheres were prepared by serum-free suspension culture of HCT116 cells. Specifically, the cells were seeded at a density of 1 x 10 4HCT116 cells were resuspended at a density of [number] cells / mL in serum-free DMEM / F12 medium (Gibco), supplemented with epidermal growth factor (EGF) 20 ng / mL (PeproTech), basic fibroblast growth factor (bFGF) 20 ng / mL (PeproTech), B27 additive (1×, Gibco), N2 additive (1×, Gibco), and penicillin-streptomycin (1%, Gibco). 100 μL of HCT116 cell suspension / well was added to each ultra-low adsorption 96-well plate (Corning, USA) and incubated at 37°C and 5% CO2 for approximately 48 h. Cell formation was monitored under a microscope, and uniform, dense tumor spheres were selected for subsequent experiments.

[0073] 8. Western blot analysis: The expression of target antigens in tumor cells was detected by Western blotting. The homogeneous and dense tumor spheres were infected with rAAV-MCS or rAAV-hCD20 at a dose of 1×10⁻⁶. 8 Tumor spheres were collected 72 hours after infection (vg / well) for CD20 protein detection to assess the penetration and transduction capabilities of rAAV into tumor spheres. Protein was extracted using a total protein extraction kit (Solarbio, China) according to the manufacturer's instructions. 20 μg of protein was loaded, separated by SDS-PAGE electrophoresis, transferred to a membrane, and then immunoblotted. Primary antibodies were mouse monoclonal anti-β-actin (Wuhan Sanying, 1:10,000) and monoclonal anti-CD20 (Wuhan Sanying, 1:5,000). Secondary antibodies were... 800CW goat anti-rabbit IgG (LI-COR, C80118-05, 1:10,000). Protein bands were acquired using the Odyssey infrared imaging system (LI-COR) and analyzed using Odyssey software.

[0074] 9. Calcein / PI Cytotoxicity Assay: The cytotoxicity of HCT116 tumor spheres was assessed using the Calcein / PI Cell Viability / Cytotoxicity Assay Kit (Beyotime, China). Homogeneous and dense tumor spheres were infected using rAAV-MCS or rAAV-hCD20 (1×10⁻⁶ cells / mL). 8 The tumor spheres were incubated with 10 μg / mL rituximab (MCE, USA) at 37°C for 30 minutes, followed by incubation for 72 hours. 4One PBMC (pre-activated overnight with 50 U / mL IL-2; R&D Systems) was co-cultured for 24 hours. After co-culture, tumor spheres were gently washed with PBS and 100 μL of staining solution from the Calcein / PI cell viability / cytotoxicity assay kit (Beyotime, China) was added. The cells were incubated at 37°C, 5% CO2, and humidified for 30 minutes. Bright-field and fluorescence images were obtained using fluorescence microscopy. Cell viability was quantitatively analyzed by measuring the fluorescence area of ​​Calcein (live cells) and PI (dead cells) using ImageJ software.

[0075] 10. Quantitative PCR (qPCR): using TRIzol TM Total RNA was extracted from cell lines and mouse tissues using Invitrogen reagents, following the manufacturer's instructions. cDNA synthesis was performed using PrimeScript. TM RT Reagent Kit (including gDNA removal step, Takara). Genomic DNA (gDNA) was extracted using the TIANamp Genomic DNA Kit (TIANGEN). Quantitative PCR was performed on an ABI StepOne Plus system (Applied Biosystems) using Fast SYBR Green Master Mix (Roche). Each sample was performed in triplicate, and all experiments were independently repeated at least three times. Relative mRNA expression levels were calculated in 2^– ΔCt Or 2^– ΔΔCt The method is used for calculation, where ΔCt=Ct 目标基因 –Ct GAPDH ,ΔΔCt=ΔCt 处理组 –ΔCt 对照组 2^ –ΔΔCt Defined as relative quantification (RQ). Viral DNA abundance was normalized using GAPDH as an internal reference and expressed as RQ = 2^ –ΔCt The primer specificity was verified by melting curve analysis, and all primer sequences are shown in Table 2.

[0076] Table 2 Primer sequences used for qPCR detection

[0077] Name Primer sequence (5'-3') AAV-F TGCATGACCAGCTTCAAGCTA AAV-R GAACAGGGAGAGGAGCAGATG MouseRELA-F TGCATTCCTCCACTTAAACGC MouseRELA-R ACAATCTCTGTCTGTAGGCGC MouseGAPDH-F TCACCATCTTCCAGGAGCGC MouseGAPDH-R CTGCTCCTGGAAGATGGTGA HumanRELA-F CCTGGAGCAAGGACTCAGCA HumanRELA-R ATGCACAGCAGGACAATGGG HumanGAPDH-F ATTTTGGAGGGATCTCGCTCC HumanGAPDH-R CTCCCTCTTCCGTTCCAGTTT MouseCD20-F CTTTCCCGAGGACGGCCTAC MouseCD20-R ATGGCAGTGGAGTCAGGAAT HumanCD20-F CTTTGGGGCGGTCCCAGATT HumanCD20-R AGATTTGGGGTGCTGAGCAG

[0078] 11. Animal model treatment: 10-week-old female C57BL / 6J mice were purchased from Changzhou Cavens Experimental Animal Co., Ltd. for homology models, and 6-week-old female triple immunodeficient mice (NOD CRISPR Prkdc Il2rγ, NCG) were purchased from Jiangsu Jizhuangkang Biotechnology Co., Ltd. All animal experiments followed the guidelines and ethical standards of the Animal Ethics and Use Committee of Southeast University (Nanjing, China). Tumor growth was measured using a vernier caliper, and tumor volume was calculated according to the formula V = (ab 2 ) / 2, where a is the longest diameter and b is the shortest diameter. When the tumor volume reached 2000 mm 3 or the body weight decreased by more than 20%, the mice were sacrificed. After the end of the experiment, the heart, liver, spleen, lung, kidney, and tumor tissue were taken for subsequent analysis. Six-week-old female NCG mice were subcutaneously inoculated with HCT116 cells to establish a humanized colorectal cancer mouse model. The NCG mice were randomly divided into three groups, with 6 mice in each group. Group 1 mice were subcutaneously injected with 5 x 10 6 HCT116 cells, and group 2 and group 3 were subcutaneously injected with 5 x 10 6 HCT116 cells and 1 x 10 6 PBMC cells. When the tumor volume was about 100 mm 3 , the tumor-bearing mice in group 2 and group 3 were injected with rAAV-MCS or rAAV-hCD20 (5 x 10 10 vg / mouse) via the tail vein, and the injection was repeated once 48 h later. After rAAV injection, 48 h later, the mice were given a tail vein injection of rituximab (30 mg / kg). The tumor volume and body weight were recorded every 2 days. When the tumor volume reached 2000 mm 3 , the mice were sacrificed, and the heart, liver, spleen, lung, kidney, and tumor tissue were collected for virus DNA and gene expression detection. The heart, liver, spleen, lung, and kidney were used for HE staining, and the tumor tissue was subjected to TUNEL detection. Serum samples from each group were collected for serum biochemical parameter detection. We performed experiments on the C57BL / 6J mouse MC38 colorectal cancer xenograft model. After washing, MC38 cells were resuspended in PBS (1 x 10 7 cells / mL), and each C57BL / 6J mouse was subcutaneously inoculated with 1 x 10 6 cells (100 μL) in the groin. The mice were randomly divided into groups (rAAV-MCS, rAAV-mCD20 + anti-mouse CD20 monoclonal antibody, rAAV-MCS + anti-mouse CD20 monoclonal antibody, rAAV-mCD20 + anti-mouse CD20 monoclonal antibody, n = 6). Treatment began when the tumor volume was about 100 mm 3 . The mice were injected with rAAV-MCS or rAAV-mCD20 (5 x 10 10Vg / mouse), injected twice every other day. 48 hours later, administer anti-mouse CD20 monoclonal antibody (MB20-11, 250 μg / mouse, 100 μL PBS solution) via tail vein. Record tumor volume and body weight daily. When the tumor volume reaches 2000 mmHg... 3 Mice were sacrificed, and heart, liver, spleen, lung, kidney, and tumor tissues were collected for HE staining, viral DNA and gene expression detection. Blood samples were also collected for complete blood count and serum biochemistry analysis. To further evaluate the impact of the therapy on survival, Kaplan-Meier survival curve analysis was used. MC38 tumor-bearing mice were randomly divided into three groups (PBS control, rAAV-MCS + anti-CD20, rAAV-mCD20 + anti-CD20; n=6). The initial treatment regimen was the same as described above, with supplemental antibody administration once a week for a total of two weeks after the initial administration. Survival was monitored and recorded until the tumor volume reached 2000 mmHg. 3 The mice were euthanized and the results were recorded.

[0079] 12. Processing and Immunophenotyping of Ex vivo Tumor Tissue: To evaluate the effect of rAAV-hCD20 on human NK cells, HCT116 tumor tissue was harvested on day 4 after rituximab (RTX) administration, following the above-described humanized HCT116 xenograft NCG mouse model treatment protocol. GentleMACS was used for analysis. TM Tumor tissue was mechanically dispersed using a tissue dissociation instrument (Miltenyi Biotec), filtered through a 70 μm filter, washed with PBS, and resuspended in staining buffer containing an Fc receptor blocker. Cell surface staining was performed using anti-human CD45-FITC (clone HI30), CD3-PE (clone SK7), and CD56-APC (clone 5.1H11). Dead cells were excluded using 7-AAD viability stain (all purchased from BioLegend, USA). For flow cytometry analysis, single-cell gating was performed first, followed by staining for live CD45 cells. + Cellular loop gate, ultimately CD3-CD56 + The event is defined as NK cells. NK cell frequency is calculated based on live CD45 cells. + CD3-CD56 in single cells + The percentage.

[0080] 13. Hematoxylin-Einstein (H&E) staining: Mouse tissues (heart, liver, spleen, lung, and kidney) were fixed, embedded in paraffin, and sectioned (5 μm thick). H&E staining was performed using standard histological methods. Specific steps: Tissues were fixed overnight in 4% paraformaldehyde, dehydrated, embedded in paraffin, sectioned, and stained sequentially with hematoxylin (Beyotime, China). Microscopic observation and imaging were performed (Olympus IX51).

[0081] 14、TUNEL detection: The apoptosis of humanized xenograft HCT116 mouse tumor tissues was detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) method according to the kit instructions (Bi Yun Tian, China). Briefly, after the tissue sections were deparaffinated and rehydrated, they were incubated with TUNEL reaction solution, followed by hematoxylin restaining for 5 minutes. The TUNEL-positive cells were observed under a 400x optical microscope, and finally quantitatively analyzed using ImageJ software.

[0082] 15、Statistical analysis: All data were expressed as mean ± standard deviation (SD). Statistical analysis and graph drawing were performed using GraphPad Prism 8.0. Two-tailed Student's t-test was used for comparison between two groups, and one-way or two-way analysis of variance (ANOVA) was used for comparison among multiple groups, followed by Tukey or Sidak multiple comparison test if necessary. Survival analysis was performed using the Kaplan-Meier method, and P value was calculated by log-rank (Mantel-Cox) test. Differences were considered statistically significant at P < 0.05.

[0083] II. Experimental results

[0084] 1、Concept of TIRT: TIRT therapy consists of two core parts: relocation of mature antigens and combination of clinical antibody drugs Figure 1 A) In this invention, CD20 was chosen as a model target, which is a widely used immunotherapeutic antigen in clinic. DMP is a synthetic NF-κB-responsive promoter composed of NF-κB decoy elements and a minimal promoter. Since NF-κB is usually highly activated in cancer cells, it can bind to DMP and selectively drive the expression of transgenes in tumor cells; in contrast, the NF-κB activity in normal cells is insufficient to initiate downstream gene transcription Figure 1B). Based on this mechanism, in the present application, the CD20 coding sequence is cloned downstream of the DMP promoter, so that the DMP promoter regulates the expression of CD20, achieving its specific expression in tumor cells, providing a target for the subsequent binding of CD20 monoclonal antibody (Rituximab). Rituximab (Rituximab, RTX) is a clinically approved therapeutic antibody, one of its main mechanisms of action is to induce natural killer (NK) cell-mediated antibody-dependent cellular cytotoxicity (ADCC). When RTX binds to CD20 on the surface of tumor cells, NK cells recognize the Fc region of antibody-coated tumor cells through the activation of FcγRIIIA (CD16a), which is then activated and releases lytic granules such as perforin and granzyme, ultimately leading to target cell lysis. In normal cells, due to low NF-κB activity and no expression of CD20, Rituximab lacks binding sites, so TIRT treatment does not trigger NK cell-mediated cytotoxicity.

[0085] 2. DMP promoter mediates specific expression of CD20 on the surface of tumor cells in vitro: To verify the selective expression of CD20 in tumor cells, human or murine CD20 expression vectors driven by the DMP promoter were constructed and transfected into various cell lines, including tumor cells (HCT116, MDA-MB-231, PANC-1 and MC38) and normal cells (MCF-12A, HL7702, GES-1 and NIH-3T3). Immunofluorescence and flow cytometry analysis of the cells showed that tumor cells with high NF-κB signaling activity all showed significant expression of CD20 antigen after transfection; while normal cells with low NF-κB activity did not detect CD20 protein expression, suggesting that the level of NF-κB in the normal cells was not sufficient to initiate DMP-mediated transcription Figure 2 A-B).

[0086] 3. Anti-tumor effect of TIRT in vitro: Flow cytometry was used to verify that the AAV-DMP-hCD20 (pAAV-hCD20 for short) vector could achieve specific expression of CD20 antigen on the surface of tumor cells, and further evaluate whether the vector combined with Rituximab could induce NK cell-mediated cytotoxicity. Tumor cells transfected with pAAV-hCD20 Figure 3 (DMP-hCD20) were co-cultured with peripheral blood mononuclear cells (PBMCs as a source of NK cells) and treated with Rituximab. Two functional indicators were used to evaluate the activation of NK cells induced by TIRT: one was the expression of surface CD107a, which was used to indicate the degranulation process of cytotoxic granules; the other was the production of intracellular IFN-γ, which reflected the effector function of NK cells. According to the results of flow cytometric surface staining, when pAAV-hCD20 Figure 3CD107a and IFN-γ expression of NK cells were significantly up-regulated when combined with rituximab (RTX), while no significant changes were observed in single treatment or pAAV-MCS combined with rituximab control groups Figure 3 A-D). To verify whether NK cell activation could achieve the ADCC killing effect of targeting tumor, lactate dehydrogenase (LDH) release assay was used to detect cytotoxic effect. The results showed that tumor cells expressing CD20 could bind rituximab, and then interact with Fcγ receptors on the surface of NK cells to activate ADCC, significantly increasing the level of targeted tumor cell lysis, while other control groups had no such effect Figure 3 E). The same experimental conditions were applied to three human normal cell lines (MCF-12A, HL7702 and GES-1). The results showed that neither plasmid transfection alone nor combined with rituximab treatment, these normal cells did not appear CD107a expression, IFN-γ production or ADCC effect Figure 3 A-E). The gating strategy of the above in vitro NK cell experiments is shown in Figure 4

[0087] 4. Killing effect of TIRT on HCT116 tumor spheres: Three-dimensional tumor sphere model is closer to the behavior characteristics of in vivo tumor than two-dimensional cells. HCT116 tumor spheres were established using serum-free suspension culture system. pAAV-hCD20 was packaged into recombinant adeno-associated virus (rAAV-hCD20). RAAV-hCD20 was used for infection experiments of human colon cancer tumor spheres to explore the feasibility of rAAV-hCD20 for in vivo tumor killing. Western blot was used to detect whether tumor spheres expressed CD20 protein 72 hours after viral infection. The results showed that the rAAV-hCD20 treatment group detected significant expression of CD20 protein in tumor spheres, while the control group (rAAV-MCS) did not express, suggesting that rAAV can effectively penetrate the dense three-dimensional tumor sphere structure and drive the expression of CD20 protein Figure 5 ) To evaluate whether CD20 expression can confer antibody-dependent cell killing sensitivity to tumor spheres, on the basis of rAAV-hCD20 transduction, combined with rituximab treatment, and further co-cultured with activated NK cells. Then, by Calcein AM (labeling live cells) and propidium iodide (PI, labeling dead cells) double staining, cell viability was detected Figure 6 ​A). The results showed that rAAV-MCS, rAAV-hCD20 alone or rAAV-MCS combined with rituximab, tumor spheroids maintained dense spherical structure, Calcein AM fluorescence was strong and PI uptake was very low, showing that cell activity was well maintained. However, rAAV-hCD20 combined with rituximab group, tumor spheroid structure was significantly collapsed, a large number of cancer cells were detached from the spheroid, Calcein AM signal was significantly reduced, and PI signal was significantly enhanced. Statistical results showed that the tumor spheroid area of TIRT treatment group was reduced by more than 70%, the cell viability was significantly decreased, and the dead cells were significantly increased Figure 6 B-C). TIRT can exert effective antibody-mediated cytotoxicity in HCT116 three-dimensional tumor spheroid model, further supporting the feasibility of this therapy for in vivo tumor treatment.

[0088] 5. Anti-tumor effect of TIRT in vivo: Based on the significant anti-tumor effect of TIRT in vitro experiments, further evaluate the therapeutic effect of TIRT platform in vivo. Animal experiments use NOD CRISPR Prkdc Il2rγ(NCG) severe immunodeficient mice to establish a humanized HCT116 subcutaneous tumor model. First, NCG mice were randomly divided into three groups and subcutaneously inoculated with HCT116 cells. Group 1 was only subcutaneously inoculated with HCT116 tumor cells as a control group; group 2 and group 3 were subcutaneously injected with HCT116 cells mixed with human PBMCs according to the method described in the method section. When the tumor volume reached about 100 mm 3 10 vg / each), combined with rituximab treatment (30 mg / kg) Figure 7 A). During the treatment, the body weight of mice in each group remained stable and did not decrease significantly Figure 7 B), suggesting that TIRT therapy is well tolerated. rAAV-MCS combined with rituximab treatment (group 2) showed no significant difference in tumor growth compared to the control group, indicating that in the absence of target antigens, the presence of PBMCs and antibodies alone is not enough to affect tumor progression. In contrast, rAAV-hCD20 combined with rituximab treatment (group 3) significantly inhibited tumor volume growth Figure 7 ​C-F), suggesting that the specific expression of CD20 in tumor cells by the TIRT strategy could effectively redirect rituximab, and thus exert a significant anti-tumor effect in vivo. In addition, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining was performed on tumor tissues to assess the apoptosis induced by treatment. The results showed that the number of TUNEL-positive cells in the rAAV-hCD20 combined with rituximab treatment group (group 3) was significantly higher than that in other groups, suggesting that TIRT treatment significantly enhanced the apoptosis of tumor cells Figure 7 G).

[0089] Given that in vitro experiments showed that TIRT exerted an anti-tumor effect by activating NK cells to mediate ADCC, it was further evaluated whether NK cells might be involved in this effect in vivo. To this end, the proportion of NK cells in tumor tissues was detected 4 days after rituximab administration to observe the effect of TIRT treatment on NK cell infiltration Figure 7 H). The results showed that the proportion of NK cells in the tumor in the rAAV-hCD20 combined with rituximab group was significantly higher than that in the rAAV-MCS combined with rituximab group Figure 7 I), suggesting that TIRT might enhance the survival of NK cells in the tumor microenvironment. Combined with the significant apoptosis observed by TUNEL staining, this result suggests that NK cells might play a role in the anti-tumor effect mediated by TIRT. In the above NCG humanized HCT116 xenograft tumor model, a flow cytometry gate strategy was used to identify CD45 + Tumor infiltrating lymphocytes (TILs) as shown in Figure 8

[0090] To further verify the tumor targeting specificity of the TIRT platform, the distribution of rAAV in major organs (including heart, lung, kidney, spleen and liver) and tumor tissues was detected, and the expression of hCD20 mRNA was analyzed. The results showed that rAAV DNA could be detected in all tissues tested Figure 9 A); however, the significantly high expression of hCD20 mRNA only occurred in tumor tissues Figure 9 B), indicating that this strategy also has good tumor targeting in vivo (i.e., the selective expression of the exogenous antigen CD20 in tumor tissues).

[0091] Further evaluation of its systemic safety showed that no obvious pathological abnormalities were found in the heart, liver, spleen, lung and kidney by histological examination Figure 10 A). In addition, compared with the PBS control group, TIRT treatment did not cause significant changes in liver function indicators (ALT, AST, ALP) or kidney function indicators (BUN, CRE, UA) Figure 10 ​B) suggests that the strategy has good tolerability and biosafety at the experimental dose.

[0092] While immunodeficient mice provide a convenient model for evaluating the antitumor effects of TIRT in the presence of human PBMCs, this model cannot reproduce the intact immune system and tumor microenvironment. Therefore, further validation of TIRT efficacy was sought in an immune-intact host. The pDMP-mCD20 vector was constructed and packaged into recombinant adeno-associated virus (rAAV-mCD20) for in vivo validation of its antitumor effects. Subsequently, an MC38 colon cancer xenograft model was established in C57BL / 6 mice. Figure 11 A), and the animals were randomly divided into 5 groups: rAAV-MCS, rAAV-mCD20, mCD20 monoclonal antibody, rAAV-MCS+mCD20 monoclonal antibody, and rAAV-mCD20+mCD20 monoclonal antibody, with n=6 in each group. Throughout the treatment process, the body weight of the mice in each group remained stable. Figure 11 B) indicates that the strategy is well-tolerated. Notably, the combined use of rAAV-mCD20 and mCD20 monoclonal antibody significantly inhibited tumor growth, with a marked decrease in both terminal tumor volume and weight. Figure 11 In contrast, neither rAAV-mCD20 alone, nor mCD20 monoclonal antibody alone, nor rAAV-MCS combined with mCD20 monoclonal antibody showed tumor-suppressive effects. These results highlight that the TIRT strategy relies on tumor-specific antigen expression and antibody synergy; both are indispensable to achieve significant therapeutic effects. To further validate the tissue specificity of TIRT in a complete immune system model, the distribution of rAAV DNA and the mRNA levels of RELA gene and mCD20 in major organs were examined. The results showed that rAAV DNA was detectable in all tested tissues, with the highest levels in the liver and tumor tissues. Figure 12 A). However, mCD20 expression was almost exclusively limited to tumor tissue, with no significant expression observed in other organs. Only the spleen showed a high level, which is related to its rich endogenous B cell content. Figure 12 B). Furthermore, RELA expression in tumors was significantly higher than in other tissues (B). Figure 12 C), consistent with its known NF-κB hyperactivation state, also indirectly supports the tumor-selective expression characteristics mediated by DMP.

[0093] To further evaluate the safety of the TIRT regimen, hematological and biochemical parameters in mice were analyzed, including red blood cell count (RBC), platelet count (PLT), hemoglobin (HGB), liver function indicators (ALT, AST, ALP), and kidney function indicators (BUN, CRE, UA). Except for a decrease in white blood cell count, no significant abnormalities were observed. Figure 13A). This decrease was expected as CD20 targeted therapy depletes B cells, a clinically expected effect and can be compensated. TIRT treatment did not significantly affect spleen weight Figure 13 B). Histological examination of major organs (heart, liver, lung, kidney) did not reveal pathological changes, while spleen sections showed changes in germinal center structure, consistent with B cell depletion, a typical feature of anti-CD20 therapy Figure 13 C). Altogether, these findings indicate that at the doses used, the TIRT strategy is well tolerated, with observed changes consistent with clinically acceptable CD20 targeted immunotherapy effects.

[0094] To further assess the impact of the treatment regimen on mouse survival, a Kaplan-Meier survival analysis was performed. MC38 tumor-bearing mice were randomly divided into three treatment groups (PBS group, rAAV-MCS + mCD20 Ab group, and rAAV-mCD20 + mCD20 Ab group). Mice were intravenously injected with rAAV-MCS or rAAV-mCD20 every other day for a total of two times, followed by a tail vein injection of mCD20 Ab 48 hours later. To enhance the therapeutic effect, mCD20 Ab was then additionally injected intravenously once a week for a total of two times. The results show that mice receiving rAAV-mCD20 in combination with mCD20 Ab had significantly longer survival times compared to all control groups Figure 14 A-B).

Claims

1. An antigen expression vector for cancer treatment, characterized in that, The antigen expression vector contains one or more DMP-antigen coding gene units; the DMP-antigen coding gene includes DMP and an antigen coding gene, wherein DMP is an NF-κB specific promoter and the antigen coding gene is an antigen molecule coding sequence.

2. The antigen expression vector for cancer treatment according to claim 1, characterized in that, The NF-κB specific promoter consists of an NF-κB decoy and a minimal promoter. The DMP includes NF-κB decoys and minimal promoters of various sequences.

3. The antigen expression vector for cancer treatment according to claim 1, characterized in that, The preferred sequence of the DMP is as shown in SEQ ID NO.

1.

4. The antigen expression vector for cancer treatment according to claim 1, characterized in that, The antigen molecule is preferably human CD20 protein; The coding sequence for human CD20 protein is SEQ ID NO.

2.

5. The antigen expression vector for cancer treatment according to claim 1, characterized in that, After the DMP-antigen-encoding gene is introduced into cells, its functional element DMP can bind to the transcription factor protein NF-κB in the cell nucleus, thereby activating the expression of the antigen-encoding gene.

6. A combination of an antigen expression vector and an antibody for the treatment of cancer, characterized in that, The combination of the antigen expression vector and antibody includes the antigen expression vector and antibody as described in claim 1. The antibody can bind to the antigen expressed by the antigen expression vector and can also bind to immune cells, thereby activating immune cells and enabling them to launch an immune attack on cancer cells and kill them.

7. The combination of antigen expression vector and antibody for cancer treatment according to claim 6, characterized in that, The antibodies mentioned are various types of antibody molecules, including monoclonal antibodies, antibody-drug conjugates (ADCs), bispecific antibodies (BsAbs), and chimeric antigen receptors (CARs) displayed on the surface of engineered immune cells.

8. The combination of antigen expression vector and antibody for cancer treatment according to claim 7, characterized in that, The monoclonal antibody binds to the antigen expressed by the antigen expression vector, and then the antibody binds to immune cells or the complement system, mediating the attack of immune cells or the complement system on cancer cells, leading to cancer cell death. The antibody-drug conjugate (ADC) binds to the antigen expressed by the antigen expression vector, delivering the drug molecule loaded by the ADC into cancer cells, leading to cancer cell death; the bispecific antibody causes cancer cell death by blocking cancer cell signal transduction or mediating the binding of immune cells; the chimeric antigen receptor (CAR) displayed on the surface of the engineered immune cells can bind to the antigen expressed by the antigen expression vector, capturing the engineered immune cells and activating the engineered immune cells to attack cancer cells.

9. The combination of antigen expression vector and antibody for cancer treatment according to claim 7, characterized in that, The monoclonal antibody is any antibody that binds to the antigen CD20, preferably rituximab, octatumumab, or octatumumab; the bispecific antibody is an immune cell engager, preferably a T cell engager (TCE); the engineered immune cells are T cells with CAR on their surface, natural killer (NK) cells, or macrophages.

10. The combination of antigen expression vector and antibody for cancer treatment according to claim 6, characterized in that, The immune cells include NK cells or macrophages; wherein antibody molecules can bind to the FcγRIIIa (CD16a) of NK or macrophages through their Fc fragment, activating NK cells to kill cancer cells through antibody-dependent cell-mediated cytotoxicity (ADCC), or activating macrophages to kill cancer cells through antibody-dependent cell-mediated phagocytosis (ADCP).

11. An in vivo delivery recombinant adeno-associated virus containing the antigen expression vector for cancer treatment as described in claim 1, characterized in that, Its in vivo delivery vector is recombinant adeno-associated virus; among which recombinant adeno-associated virus includes various types of recombinant adeno-associated virus.

12. The use of the antigen expression vector for cancer treatment as described in claim 1, or the in vivo delivery recombinant adeno-associated virus as described in claim 8, or the combination of the in vivo delivery recombinant adeno-associated virus as described in claim 8 and the antibody of claim 6, in the preparation of a cancer treatment agent or drug.

13. The application according to claim 12, characterized in that, The cancers mentioned include colon cancer.

14. The application according to claim 12, characterized in that, The recombinant adeno-associated virus is used in the preparation of cancer treatment agents or drugs via intravenous injection or intratumoral injection.

Images