Application of miR-6742-5p in preparation of anti-liver cancer product
By overexpressing miR-6742-5p in liver cancer to inhibit cell proliferation and migration, and by developing corresponding diagnostic reagents, the problem of limited efficacy in the treatment of hepatocellular carcinoma has been solved, enabling targeted therapy and early diagnosis of liver cancer.
Patent Information
- Application Number
- CN202511548488.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-28
- Publication Date
- 2026-02-03
AI Technical Summary
Hepatocellular carcinoma has an insidious onset, a high rate of intrahepatic recurrence and metastasis, and existing treatments have limited efficacy, with a lack of effective targeted therapies.
In the preparation of anti-hepatocellular carcinoma products, miR-6742-5p was used to inhibit the proliferation and migration of hepatocellular carcinoma cells by overexpressing miR-6742-5p. A reagent for detecting the expression level of miR-6742-5p was also developed for the diagnosis of hepatocellular carcinoma.
It effectively inhibits the proliferation and migration of liver cancer cells, provides an early liver cancer screening method, predicts the malignant progression of tumors, and improves the targeted effect of liver cancer treatment.
Smart Images

Figure CN121450797A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, in particular to the application of miR-6742-5p in the preparation of anti-liver cancer products. BACKGROUND
[0002] Hepatocellular carcinoma is one of the common malignant tumors of the digestive system, accounting for the vast majority of primary liver malignancies. The incidence and mortality of liver cancer have been high for a long time. Global cancer statistics show that the incidence of liver cancer ranks fifth among malignant tumors, and the mortality rate reaches the third place. The early symptoms of hepatocellular carcinoma are not obvious, and it develops rapidly, and metastasis occurs early, so that patients are in the middle and advanced stages or have local or systemic metastasis when they are diagnosed, losing the best treatment opportunity. At present, the treatment methods of liver cancer mainly include surgical resection, radiotherapy and chemotherapy, liver transplantation and immunotherapy, but the overall efficacy is still limited, and the prognosis is poor. This is closely related to the insidious onset, high intrahepatic recurrence and metastasis rate.
[0003] MicroRNAs (miRNAs) are a group of endogenous evolutionarily conserved single-stranded non-coding small RNAs, with a length of 18-25 nucleotides, which mediate mRNA degradation or translation inhibition by binding to complementary sequences in the 3'-untranslated region (UTR) of target mRNA. MiRNAs are widely involved in the occurrence, development and progression of cancer, such as cell proliferation, apoptosis, metastasis and drug resistance. As a post-transcriptional regulatory factor of gene expression, it can inhibit or promote the development of cancer.
[0004] Therefore, exploring the pathological mechanism of hepatocellular carcinoma and finding new targets related to liver cancer treatment and prognosis not only helps to improve the prognosis, but also helps to target the treatment of liver cancer. SUMMARY
[0005] Therefore, the application provides the application of miR-6742-5p in the preparation of anti-liver cancer products. Experiments have proved that overexpression of miR-6742-5p can effectively inhibit liver cancer cell proliferation, invasion and migration, and detection of miR-6742-5p expression level can predict tumor malignant progression, so it has potential application value in the treatment of liver cancer and other malignant tumors.
[0006] The specific technical solutions are as follows:
[0007] The first aspect of the present application provides the application of miR-6742-5p in the preparation of anti-liver cancer products, and the nucleotide sequence of the miR-6742-5p is shown in SEQ ID NO. 1.
[0008] In some embodiments, the expression of miR-6742-5p is down-regulated in liver cancer cell lines HepG2, BEL7402 and BEL7404.
[0009] The application further provides use of a reagent for detecting the expression level of miR-6742-5p in preparation of a liver cancer diagnosis product.
[0010] In some embodiments, the reagent comprises a nucleic acid product for detecting the expression level of miR-6742-5p.
[0011] In some embodiments, the nucleic acid product comprises a primer pair for detecting the expression level of miR-6742-5p, and the nucleotide sequences of the primer pair are shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0012] In some embodiments, the nucleic acid product further comprises an internal reference primer pair, and the nucleotide sequences of the internal reference primer pair are shown in SEQ ID No. 4 and SEQ ID No. 3.
[0013] In some embodiments, the reagent detects the expression level of miR-6742-5p by one or more of the following methods:
[0014] RT-PCR method, Western blot method and microarray method.
[0015] In some embodiments, the liver cancer diagnosis product comprises a kit comprising a primer pair or a nucleic acid product for detecting the expression level of miR-6742-5p.
[0016] In some embodiments, the kit further comprises one or more of a nucleic acid extraction reagent, a quality control reagent, a PCR reaction reagent and a sequencing reagent.
[0017] In some embodiments, the method comprises:
[0018] obtaining a healthy control sample and a sample to be tested;
[0019] using the nucleic acid product or the kit to perform a fluorescent quantitative PCR amplification reaction on the healthy control sample and the sample to be tested as templates, and analyzing the reaction results.
[0020] The application first discovers that miR-6742-5p can independently inhibit cancer in liver cancer and other tumors, and its regulatory mechanism of inhibiting cell proliferation, cell migration and cell invasion and its functional impact on tumor cells. Therefore, the application provides important significance and application prospects for the development of primary liver cancer prevention, diagnosis, treatment and anti-tumor drug research based on miR-6742-5p strategy. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1The miR-6742-5P transfection of the hepG2 cell function experiment verification result in the embodiment 1 of the present application; Figure 1 The abscissa of the middle A is time, and the ordinate is the absorbance at 450 nm wavelength; Figure 1 The abscissa of the middle B is different sample groups, and the ordinate is the cell apoptosis rate; Figure 1 The abscissa of the middle C is the cell cycle stage, and the ordinate is the cell population percentage; Figure 1 The abscissa of the middle D is time, and the ordinate is the cell migration rate;
[0022] Figure 2 The miR-6742-5P transfection of the BEL-7402, BEL-7404 cell scratch experiment verification result in the embodiment 1 of the present application; wherein Figure 2 The abscissa of the middle A and Figure 2 The abscissa of the middle B is time, and the ordinate is the cell migration rate;
[0023] Figure 3 The miR-6742-5P relative expression amount comparison result of the liver cancer tissue and the cancer-adjacent tissue in the embodiment 2 of the present application; the abscissa is the normal tissue and tumor tissue sample group, and the ordinate is the relative expression level of miR-6742-5P;
[0024] Figure 4 The miR-6742-5P tissue chip in situ hybridization result and ROC curve of the liver cancer tissue and the cancer-adjacent tissue in the embodiment 2 of the present application; wherein Figure 4 The abscissa of the middle B is the normal tissue and tumor tissue sample group, and the ordinate is the immunohistochemical staining score; Figure 4 The abscissa 1 of the middle C is specificity, and the specificity refers to the proportion of negative detection in non-patients (or negative samples), and the ordinate is the sensitivity, and the sensitivity refers to the proportion of positive detection in patients (or positive samples). DETAILED DESCRIPTION
[0025] In order to facilitate the understanding of the present application, the present application will be described more fully below, and the preferred embodiments of the present application are given. However, the present application can be realized in many different forms, and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the specification of the present application is only for the purpose of describing specific embodiments and is not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more related listed items.
[0027] The selection range of the terms "and / or", "or / and", "and / or" used in the present application includes any one of two or more relevant listed items, and also includes any and all combinations of the relevant listed items, which includes any two relevant listed items, any more relevant listed items, or a combination of all relevant listed items. It should be noted that when at least two conjunctions selected from "and / or", "or / and", "and / or" are combined to connect at least three items, it should be understood that in the present application, the technical solution undoubtedly includes the technical solution connected by "logical and", and also undoubtedly includes the technical solution connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C and D (i.e. the technical solution connected by "logical or"), and also includes any and all combinations of A, B, C and D, i.e. includes the combination of any two or any three of A, B, C and D, and also includes the four-item combination of A, B, C and D (i.e. the technical solution connected by "logical and").
[0028] In the present application, "multiple", "various", "multiple times", "multiple" and the like are used without specific limitation, which means greater than or equal to 2 in quantity. For example, "one or more" means one or greater than or equal to two.
[0029] As used herein, "combinations thereof", "any combination thereof", "any combination manner thereof" and the like include all suitable combination manners of any two or more of the listed items.
[0030] As used herein, "suitable combination manner", "suitable manner", "any suitable manner" and the like mean that the "suitable" is subject to the implementation of the technical solutions of the present application, the solution of the technical problems of the present application, and the realization of the expected technical effects of the present application.
[0031] As used herein, "preferably", "better", "better", "as appropriate" only describe the implementation manner or embodiment with better effect, and it should be understood that it does not constitute a limitation on the protection scope of the present application.
[0032] In the present application, "further", "more further", "in particular" and the like are used for description purposes, indicating differences in content, but should not be understood as a limitation on the protection scope of the present application.
[0033] In the present application, "optionally", "optional", "optional" means optional, i.e. selected from two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, and there is no specific description, and there is no contradictory relationship or mutual restriction, each "optional" is independent.
[0034] In the present application, the technical features described in an open manner include both the closed technical solutions consisting of the listed features and the open technical solutions containing the listed features.
[0035] In the present application, the temperature parameters, if not particularly limited, allow both constant temperature treatment and variation within a certain temperature range. It should be understood that the constant temperature treatment allows fluctuations within the accuracy range controlled by the instrument. Fluctuations within a range such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.
[0036] In the present application, the terms "first", "second", etc. in "first processing sample", "second processing sample", etc. are only for the purpose of distinguishing description, and cannot be understood as indicating or implying relative importance or quantity, nor can it be understood as implying the importance or quantity of the indicated technical features. Moreover, "first", "second", etc. only serve the purpose of non-exhaustive enumeration description, and it should be understood that they do not constitute a closed limitation on the quantity.
[0037] In the present application, mmol / L and mM both represent millimoles per liter and can be used interchangeably. mol / L and M both represent moles per liter and can be used interchangeably.
[0038] In the present application, the concentration or amount of each component in the sample processing liquid component, if not particularly defined, refers to the final concentration or final amount in the sample processing liquid component, which is equivalent to the final concentration or final amount in the sample processing liquid reagent composed of the sample processing liquid component.
[0039] In the present application, the concentration or amount of each component in the reaction liquid component, if not particularly defined, refers to the final concentration or final amount in the reaction liquid component, which is equivalent to the final concentration or final amount in the reaction liquid reagent composed of the reaction liquid component.
[0040] An embodiment of the present application provides an application of miR-6742-5p in the preparation of a liver cancer resistant product. The nucleotide sequence of the miR-6742-5p is shown in SEQ ID NO. 1.
[0041] Specifically, the nucleotide sequence shown in SEQ ID NO. 1 is 5'-AGUGGGGUGGGACCCAGCUGUU-3'.
[0042] In some embodiments, the expression level of the miR-6742-5p in the liver cancer tissue is significantly down-regulated compared to the expression level in the corresponding paracancer normal liver tissue.
[0043] In some embodiments, the expression of the miR-6742-5p in liver cancer cell lines HepG2, BEL7402 and BEL7404 is down-regulated.
[0044] In some embodiments, the overexpression of miR-6742-5p can inhibit the proliferation, invasion and migration of hepatoma cells.
[0045] The present application first discovers that miR-6742-5p can inhibit cancer in tumors such as hepatoma, and its regulatory mechanism of inhibiting cell proliferation, cell migration and cell invasion, and the functional impact on tumor cells. Therefore, the present application provides an important significance and application prospect for the development of primary hepatoma prevention, diagnosis, treatment and anti-tumor drug research based on miR-6742-5p strategy.
[0046] Another embodiment of the present application also provides the use of a reagent for detecting the expression level of miR-6742-5p in the preparation of a hepatoma diagnosis product.
[0047] In some embodiments, the reagent includes a nucleic acid product for detecting the expression level of miR-6742-5p.
[0048] In some embodiments, the nucleic acid product includes a primer pair for detecting the expression level of miR-6742-5p.
[0049] In some embodiments, the nucleotide sequence of the primer pair is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0050] Specifically, the nucleotide sequence shown in SEQ ID NO. 2 is 5'- AGTGGGGTGGGACCCAGCTGTT -3'; and the nucleotide sequence shown in SEQ ID NO. 3 is 5'- GTGCAGGGTCCGAGGT -3'.
[0051] In some embodiments, a reference primer pair is also included, and the nucleotide sequence of the reference primer pair is shown in SEQ ID No. 4 and SEQ ID NO. 3.
[0052] Specifically, the nucleotide sequence shown in SEQ ID NO. 4 is 5'- CTCGCTTCGGCAGCACATATA -3'; and the nucleotide sequence shown in SEQ ID NO. 3 is 5'- GTGCAGGGTCCGAGGT -3'.
[0053] The nucleic acid product can be used to screen early hepatoma with high specificity in the clinic.
[0054] In some embodiments, the reagent detects the expression level of miR-6742-5p by one or more of the following methods: In some embodiments, the reagent detects the expression level of miR-6742-5p by one or more of the following methods:
[0055] RT-PCR, Western blotting and microarray.
[0056] In some embodiments, the liver cancer diagnostic product comprises a kit comprising a primer pair or a nucleic acid product for detecting the expression level of miR-6742-5p.
[0057] In some embodiments, the kit further comprises one or more of a nucleic acid extraction reagent, a quality control reagent, a PCR reaction reagent and a sequencing reagent.
[0058] In some embodiments, the method comprises steps S10-S20.
[0059] Step S10: obtaining a healthy control sample and a sample to be tested.
[0060] In some embodiments, in step S10, the sample is obtained from one or more of a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, plasma, serum, whole blood, isolated blood cells and cells isolated from blood.
[0061] The corresponding control tissue or blood sample or control reference sample can be obtained from the unaffected tissue of the subject, from a normal individual or a population of normal individuals, or from cultured cells corresponding to the majority of cells in the sample of the subject.
[0062] Step S20: using the nucleic acid product or the kit to perform a fluorescent quantitative PCR amplification reaction on the healthy control sample and the sample to be tested obtained.
[0063] In some embodiments, in step S20, the reaction system of the fluorescent quantitative PCR amplification reaction comprises:
[0064] 10 μL of PCR reaction solution, 4 μL of primer pair for detecting the expression level of miR-6742-5p and 0.5-5 μL of nucleic acid sample.
[0065] In some specific examples, the PCR reaction solution comprises an internal reference primer pair, a PCR buffer, dNTP, MgCl2 and Taq DNA polymerase.
[0066] In some embodiments, in step S20, the program of the fluorescent quantitative PCR amplification reaction is set as: 94-96°C pre-denaturation for 5-10 min, 94-96°C denaturation for 8-10 s, 58-65°C annealing for 18-22 s, collecting fluorescence signal, and cycling for 35-40 times.
[0067] In one specific example, the procedure of the fluorescent quantitative PCR amplification reaction is set as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 10 s, annealing at 60℃ for 20 s, collecting fluorescence signal, and repeating for 40 cycles.
[0068] Step S30: analyzing the reaction result.
[0069] In some embodiments, the step of analyzing the reaction result in step S30 includes steps S31-S33.
[0070] Step S31: obtaining the Ct value and the corresponding fluorescence group channel amplification curve of the healthy control sample amplified by the primer pair, the Ct value and the corresponding fluorescence group channel amplification curve of the healthy control sample amplified by the internal reference primer pair, the Ct value and the corresponding fluorescence group channel amplification curve of the sample to be tested amplified by the primer pair, and the Ct value and the corresponding fluorescence group channel amplification curve of the sample to be tested amplified by the internal reference primer pair, respectively.
[0071] Step S32: calculating the expression level of the corresponding miR-6742-5p of the healthy control sample and the sample to be tested according to the Ct value.
[0072] Step S33: comparing the expression level of the corresponding miR-6742-5p of the healthy control sample and the sample to be tested to obtain a comparison result.
[0073] Further, compared with the level of miR-6742-5p in the healthy control sample, the down-regulation of the level of miR-6742-5p in the sample to be tested indicates that the subject has hepatocellular carcinoma.
[0074] The present application provides miR-6742-5p as a tumor treatment target for liver cancer to inhibit the progression of HCC. Through CCK-8, cell cycle experiment, clonogenic assay, Annexin V-FITC / PI apoptosis experiment, and migration and transwell invasion experiment, it is found that overexpression of miR-6742-5p can significantly inhibit the migration and invasion of HCC cell lines, and has no obvious effect on the proliferation and apoptosis of HCC. Therefore, by regulating the expression of miR-6742-5P in liver cancer, the migration and invasion of HCC can be significantly inhibited.
[0075] Through clinical sample detection, it is found that the expression of miR-6742-5p in liver cancer tissue is significantly lower than that in paracancerous tissue. By detecting the expression level of miR-6742-5p in tumor samples or peripheral blood of liver cancer patients, the malignant progression of liver cancer can be predicted and evaluated. It has important scientific research reference value and application value for studying the inhibition of tumor cell malignant phenotype and the regulation of liver cancer cell differentiation level by miR-6742-5p through targeting.
[0076] The following detailed description is made with reference to the accompanying drawings. The following examples are described in detail without special explanation, which does not include other components except inevitable impurities. In the examples, reagents and instruments are used as conventional selection in the art unless otherwise specified. The experimental method is not specified in the examples, which is implemented according to conventional conditions, such as conditions described in the literature, books or methods recommended by the manufacturer.
[0077] Example 1
[0078] 1) Cell culture: HepG2, BEL7402, BEL7404 cells and HE293T cells are from the Human Stem Cell National Engineering Research Center of Central South University. HCC cell lines are cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA) with 10% fetal bovine serum (FBS, Gibco, USA). HepG2, Huh7 cell lines are replaced with culture medium every other day. All cells are stored in a CO2 incubator at 37°C with 5% CO2 humidity.
[0079] 2) Cell transfection:
[0080] MiR-6742-5p mimic and negative control Negative control mimic (NC mimic) are synthesized by Ribobio (Guangzhou, China), and transfection is completed by lipo2000 (Invitrogen, USA). HepG2 cells are seeded in a six-well plate at a density of 6x10 5 / well, and transfection is performed when the cell density reaches 30%~50% confluence. The mimic transfection concentration is 50nM, and the transfection is performed according to the lipo2000 instruction manual. For example, using miR-297 mimic, 5ul of 20μM miR-297 mimic stock solution is dissolved in 250ul of Opti-MEM medium with RNase-free gun head, and mixed gently; 5ul of lipo2000 is dissolved in 250ul of Opti-MEM medium with RNase-free gun head, and mixed and incubated at room temperature for 5min; the mimic solution and lipo solution are mixed, and the transfection mixture is prepared by blowing and mixing, and incubated at room temperature for 30min, then 1500ul of Opti-MEM medium is added to 2mL of transfection mixture. Discard the culture medium in the six-well plate, wash the dish bottom twice with DPBS, add 2mL of transfection mixture per well; replace the new culture medium after 6h of transfection, and continue to culture for subsequent functional experiments. The transfection efficiency is detected by fluorescence quantitative PCR method to detect the overexpression of miRNA.
[0081] After washing the adherent cells twice with DPBS, 1x10 6Cells plus 1 ml of total RNA extraction reagent Trizol, fully blow lysis, incubate at room temperature for 5 min, collect homogenate and add to 1.5 ml EP tube. After shaking for 15 s, add 0.2 ml of chloroform to 1 ml of Trizol, mix well by shaking for 15 s, incubate at room temperature for 10 min, centrifuge at 4°C, 12000 rpm for 15 min, collect 400 μL of the upper aqueous phase in a new sterile EP tube. Add an equal volume of isopropanol, mix well by shaking, incubate at room temperature for 10 min, centrifuge at 4°C, 12000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 4°C, 12000 rpm for 5 min, discard the supernatant, use 10 μL of gun head to suck out the residual ethanol, and dry in the fume hood. Add 30 μL of DEPC water to each tube to dissolve the RNA, after detecting the RNA concentration and purity, label and store at -80°C.
[0082] MiRNA is about 20 nt long, and unlike mRNA, it does not have a Poly(A) structure. We used tailing reverse transcription to add Poly(A) tail to the miRNA in the sample, and then performed reverse transcription to obtain cDNA. The kit uses Mir-X™ miRNA First-Strand Synthesis Kit (Takara) to complete. The reagent and sample should be centrifuged before the experiment, and the reaction should be performed on ice. In a 0.2 ml RNase-free tube, prepare the reverse transcription reaction system including mRQ Buffer (2x) 5 μL RNA sample 3.75 μL and mRQ Enzyme 1.25 μL, a total of 10 μL system. After preparing the reaction solution, mix well and centrifuge for 5 s, and put it into the PCR instrument. Set the program to 105°C (Lip), 37°C for 60 min (Poly(A) tailing and reverse transcription reaction); 85°C for 5 min (enzyme inactivation reaction). After the reaction is completed, add enzyme-free water to the obtained RT reaction liquid to make up to 100 μL diluent. Store the cDNA product at 4°C or continue the experiment.
[0083] The miRNA fluorescent quantitative PCR adopts the LightCycler 480 SYBR Green I Master kit of Roche Company, and the experiment process needs to be carried out in the dark. The upstream miRNA primer is customized by Shengong, and the downstream universal primer and the internal reference U6 primer are provided by the reverse transcription kit Mir-X™ miRNA First-Strand Synthesis Kit of Takara. The upstream primer sequence of miR-6742-5P is SEQ ID NO. 2: 5'-AGTGGGGTGGGACCCAGCTGTT-3'; the downstream primer sequence is SEQ ID NO. 3: 5'-GTGCAGGGTCCGAGGT-3'; the upstream primer sequence of the internal reference U6 is SEQ ID NO. 4: 5'-CTCGCTTCGGCAGCACATATA-3'; the downstream primer sequence is SEQ ID NO. 3: 5'-GTGCAGGGTCCGAGGT-3'. The Roche LightCycler 480 Real-time PCR special eight connection tube is applied, 10 μL of SYBR Green is added to each hole, 2 μL of cDNA sample diluent, 4 μL of miRNA-specific Primer primer (1 μM), 4 μL of mRQ 3' Primer (1 μM), and the total reaction system is 20 μL.
[0084] After the sample is added, the cap is sealed, centrifuged for 5 s, mixed, and then placed on the Lightcycler 480 SYBR Green II real-time PCR instrument. The program is set as follows: pre-denaturation at 95°C for 10 min, cycle temperature at 95°C for 10 s, 60°C for 20 s, a total of 40 cycles. The melting curve is set as follows: 95°C for 60 s, 55°C for 30 s, and 95°C for 30 s. The Ct value comparison method is applied to analyze the relative expression, and the calculation formula is the fold change = 2 raised to the power of negative ΔΔCt. The primers are shown in Table 1.
[0085] Table 1
[0086]
[0087] 3) Cell proliferation detection:
[0088] The present application detects cell proliferation by CCK-8 and clonal formation test, and analyzes the mechanism of affecting cell proliferation by cell cycle and apoptosis detection. The CCK-8 method selects the Japanese Tongren CCK-8 detection kit. Taking hepG2 cells as an example, the hepG2 cells are diluted to 5×10 3HCC cells were seeded in 96-well plates at a density of 5000 cells / well. When the cell density reached 30%-50% confluence, the cells were transfected with the miRNA or negative control. Six hours after transfection, the medium was replaced with fresh medium, and the cells were incubated for 48 hours. The proliferation of the cells was detected at 1, 2, 3, and 4 days after transfection. The cells were divided into an miRNA transfection group and an NC negative control group. For detection, 10 μL of CCK-8 solution was added to each well, and the mixture was incubated at 37°C for 1 hour. The absorbance at 450 nm was measured using a microplate reader, and the absorbance of blank culture medium to which CCK-8 solution was added was used as a blank control. Other cell detection methods were the same as for the HepG2 cells. For a colony formation test, HCC cell lines were seeded in 6-well plates at a density of 500 cells / well (n=3 for each group). The cells were washed twice with PBS, fixed with methanol for 30 minutes, and incubated at 37°C for 14 days. The cells were then stained with 0.5% crystal violet solution. The colonies composed of 50 or more cells in each well were counted under a microscope (Olympus, Japan). Each experiment was repeated three times.
[0089] Cell cycle analysis was performed using the PI / RNase staining method, and cycle fitting analysis was performed using modifit software. HepG2 cells were seeded in 6-well plates at a density of 6×10 5 HCC cells were seeded in 6-well plates at a density of 6×10 6 After overnight fixation, the cells were centrifuged at 1200 rpm for 10 minutes, and the supernatant was discarded. The cells were washed twice with DPBS and centrifuged at 1200 rpm for 3 minutes to remove the fixative. 0.5 mL of PI / RNase staining solution was added to each tube to resuspend the cells, and the cell density was adjusted to 1×10 6 After overnight fixation, the cells were centrifuged at 1200 rpm for 10 minutes, and the supernatant was discarded. The cells were washed twice with DPBS and centrifuged at 1200 rpm for 3 minutes to remove the fixative. 0.5 mL of PI / RNase staining solution was added to each tube to resuspend the cells, and the cell density was adjusted to 1×10
[0090] Apoptosis was detected using the Annexin-V / PI staining method. HepG2 cells were seeded in 6-well plates at a density of 6×10 5HepG2 cells were seeded at a density of 30%-50% in six-well plates and transfected when the cell density reached confluence (see section 2 for transfection method). Six hours after transfection, the medium was replaced with fresh medium, and the cells were cultured for another 48 hours. The apoptosis rate of hepG2 cells was then measured. Experimental groups included normal culture cells, miRNA transfection groups, and a negative control group (NC). For detection, cells were digested and neutralized, washed three times with DPBS, and centrifuged at 1200 rpm for 5 min. After counting, cells were resuspended in 100 μL of 1×annexin-binding buffer, and 5 μL of Annexin V-FITC and 1 μL of 100 μg / ml PI working solution were added. Cells were incubated at room temperature in the dark for 15 min. After incubation, 400 μL of 1×annexin-binding buffer was added to each tube, mixed, and analyzed using a C6 flow cytometer. Other cell detection methods were the same as for hepG2.
[0091] 4) Detection of cell invasion and migration:
[0092] This application verifies cell migration and invasion functions using scratch assays and Transwell invasion assays. Cell migration was detected using the scratch assay. HepG2 cells were inoculated at a concentration of 6 × 10⁶ cells / year. 5 Cells were seeded at a density of 30%–50% confluence in six-well plates. Transfection was performed when the cell density reached 30%–50% confluence (see section 2 for transfection method). Six hours after transfection, the medium was replaced with fresh medium, and cultured until 90% confluence was achieved. The medium was then discarded, and the cells were washed twice with DPBS. After 24 hours of serum-free culture and starved for 200 μL, the cells were scratched with a 200 μL pipette tip, washed twice with DPBS to remove suspended cells, and photographed. Serum-free culture was continued, and the scratch pattern was photographed at 24, 48, and 72 hours. ImageJ software was used to analyze the scratch area at each time point for both groups of cells, and cell migration rate was calculated. The calculation formula was: Migration rate = (Scratch area at 0 h - Scratch area at 24 h) / Scratch area at 0 h × 100%. The experimental method for BEL-7404 cells was the same as for HepG2 cells.
[0093] 5) Results
[0094] The results are as follows Figure 1 and Figure 2 As shown, overexpression of miR-6742-5p can significantly inhibit the migration and invasion of HCC cell lines. Figure 1 To verify the functional results of miR-6742-5P transfected hepG2 cells, the experimental groups were: normal culture control group (control), negative control mimic transfection group (NC), and miR-6742-5P transfection experimental group (miR-6742-5P). Figure 1 In Figure A, the results of a cell proliferation assay were obtained using the CCK-8 assay. Figure 1 B represents the results of the AV / PI apoptosis experiment;Figure 1 Figure 21C is a graph showing the results of cell cycle detection by PI staining. Figure 1 Figure 21D is a graph showing the results of cell migration detection by scratch assay. Figure 1 Figure 21E is a graph showing the results of invasion assay. Figure 2 Figure 21A is a graph showing the results of cell migration detection by scratch assay for BEL-7402 cells transfected with miR-6742-5p. The experimental groups are normal culture control (control), negative control mimic transfection group (NC), and miR-6742-5p transfection experimental group (miR-6742-5p). Figure 2 Figure 21A is a graph showing the results of cell migration detection by scratch assay for BEL-7402 cells transfected with miR-6742-5p. The experimental groups are normal culture control (control), negative control mimic transfection group (NC), and miR-6742-5p transfection experimental group (miR-6742-5p). Figure 2 Figure 21B is a graph showing the results of cell migration detection by scratch assay for BEL-7404 cells transfected with miR-6742-5p. The experimental groups are normal culture control (control), negative control mimic transfection group (NC), and miR-6742-5p transfection experimental group (miR-6742-5p).
[0095] In summary, the present application uses miR-6742-5p as a molecular intervention target, and overexpression of miR-6742-5p can regulate HCC progression by inhibiting the invasion and migration of HCC cell lines. Transfection of miR-6742-5p mimic can significantly inhibit the migration and invasion of HCC cell lines. miR-6742-5p can provide a new target for the treatment of liver cancer.
[0096] Example 2
[0097] 1. Data collection
[0098] The miRNA expression profile data of 97 cases of liver cancer tissues and 97 cases of para-cancer tissues were collected from the GEO database, and the expression level of miR-6742-5p in liver cancer tissues and para-cancer tissues was analyzed.
[0099] 2. In situ hybridization detection of miR-6742-5p
[0100] A tissue microarray containing 75 human hepatocellular carcinoma (HCC) samples and 75 matched para-cancer tissues adjacent to the cancer tissues was purchased from Shanghai Owt Biotech Co., Ltd. (Shanghai, China). In situ hybridization was performed using the hsa-miR-6742-5p probe (3'-digoxin labeled) from Biosmart (Wuhan, China) according to the manufacturer's protocol, and DAB staining was used. The staining degree was scored according to the staining intensity and the proportion of positive cells: negative staining (0); low staining (1-4); moderate staining (5-8) and high staining (9-12). The staining intensity was scored based on the staining characteristics of the target cells: no color was scored as 0, light yellow was scored as 1, brown yellow was scored as 2, and brown was scored as 3. The positive cell ratio was scored as follows: 0-5% was scored as 1, 6%-25% was scored as 2, 26%-50% was scored as 3, 51%-75% was scored as 4, and >75% was scored as 5. Each tissue spot on the tissue chip was scored for staining intensity and positive cell percentage, and the positive comprehensive score was the product of the staining intensity and the positive cell percentage.
[0101] 3. Results
[0102] The data collected by the GEO database is as follows: Figure 3 , Figure 3 The results show the relative expression levels of miR-6742-5p between liver cancer tissue and adjacent normal tissue. Compared to adjacent normal tissue, the expression level of miR-6742-5p in liver cancer tissue was significantly decreased (p<0.05). The in situ hybridization results and ROC curves for tissue microarrays are shown below. Figure 4 The results of tissue microarray in situ hybridization staining are as follows: Figure 4 Figure A shows the staining of tumor tissues and paracancerous tissues at different magnifications (50× and 200×), aiming to detect the expression of proteins or molecules related to miR-6742-5p. Compared with paracancerous tissues, the expression level of miR-6742-5p in liver cancer tissues was significantly decreased (p<0.0001). Figure 4 As shown in Figure B, the receiver operating characteristics of miR-6742-5p were analyzed using the pROC package in R, the binomial exact confidence space was calculated, and the ROC curve was plotted, as shown in Figure B. Figure 4 As shown in Figure C, the AUC of miR-6742-5p was 0.751, indicating that miR-6742-5p has high sensitivity and specificity for the diagnosis of liver cancer and possesses diagnostic efficacy.
[0103] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0104] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.
Claims
1. The application of miR-6742-5p in the preparation of anti-liver cancer products, characterized in that, The nucleotide sequence of miR-6742-5p is shown in SEQ ID NO.
1.
2. The application as described in claim 1, characterized in that, The miR-6742-5p was downregulated in the hepatocellular carcinoma cell lines HepG2, BEL7402, and BEL7404.
3. Application of reagents for detecting miR-6742-5p expression levels in the preparation of liver cancer diagnostic products.
4. The application as described in claim 3, characterized in that, The reagents include nucleic acid products for detecting the expression level of miR-6742-5p.
5. The application as described in claim 4, characterized in that, The nucleic acid product includes a primer pair for detecting the expression level of miR-6742-5p, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.
3.
6. The application as described in claim 4, characterized in that, The nucleic acid product also includes an internal reference primer pair, the nucleotide sequences of which are shown in SEQ ID No. 4 and SEQ ID No.
3.
7. The application as described in any one of claims 3 to 6, characterized in that, The reagent is used to detect the expression level of miR-6742-5p by one or more of the following methods: RT-PCR, Western blotting, and microarray methods.
8. The application as described in any one of claims 3 to 6, characterized in that, The liver cancer diagnostic product includes a kit comprising primer pairs or nucleic acid products for detecting the expression level of miR-6742-5p.
9. The application as described in claim 8, characterized in that, The kit also includes one or more of the following: nucleic acid extraction reagents, quality control reagents, PCR reaction reagents, and sequencing reagents.
10. The application as described in claim 9, characterized in that, include: Obtain healthy control samples and samples to be tested; Using the obtained healthy control samples and test samples as templates, a fluorescence quantitative PCR amplification reaction was performed using the nucleic acid product according to any one of claims 3 to 5 or the kit according to any one of claims 6 to 8, and the reaction results were analyzed.