KASP primer group of aegilops tauschii 4D chromosome, kit and application

Abstract

The invention discloses a KASP primer group of an aegilops tauschii 4D chromosome, a kit and application, and belongs to the technical field of molecular biology. The kit comprises six KASP primer groups, each primer group comprises two forward primers and one reverse primer, and the specific sequences of the primers are as shown in SEQ ID NO.1-18. After the aegilops tauschii and common wheat are subjected to whole genome comparison, the specific SNP of the aegilops tauschii is obtained through screening, and then the corresponding specific marker is developed, so that the marker developed by the invention can be used for tracking and detecting 4D chromosome introgression fragments or genes which are rich in genetic variation and originated from Straangula type aegilops tauschii AT23; the method has important value for genetic breeding improvement of common wheat.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a KASP primer set of Aegilops tauschii 4D chromosome, a kit and use. BACKGROUND

[0002] Hexaploid bread wheat originated from the allopolyploidization of tetraploid wheat and diploid Aegilops tauschii. The strong genomic plasticity after polyploidization endows hexaploid wheat with broad adaptability to complex habitats, making hexaploid wheat one of the most important crops in the world. However, due to the genetic evolution bottleneck caused by polyploidization and the loss of genetic diversity in the process of human domestication and breeding, the yield of wheat cannot meet the rapid population growth and the huge production challenges brought by global climate change.

[0003] Aegilops tauschii Coss. Aegilops tauschii , with a chromosome number of 2N=2x=14 and a genome of DD, is divided into strangulata and tauschii two subtypes, and is the ancestor of common wheat D genome, which has a variety of excellent genes for regulating yield, disease resistance, processing quality and the like. However, it is reported that only a small part of germplasm is involved in the allopolyploidization process of hexaploid wheat, and research shows that there is a large difference between the D genome of common wheat and the D genome of its wild relative Aegilops tauschii. Therefore, Aegilops tauschii is an important gene pool for enriching the genetic diversity of common wheat. For example, artificial synthetic hexaploid wheat obtained by crossing tetraploid wheat and Aegilops tauschii is used as a bridge parent, and then crossed with common wheat to obtain wheat introgression lines containing Aegilops tauschii fragments, and new wheat varieties containing excellent traits of Aegilops tauschii are selected from the lines; or Aegilops tauschii is directly crossed with common wheat, and then backcrossed with common wheat to transfer excellent genes of Aegilops tauschii.

[0004] Although chromosome 4D is the shortest among the D genome chromosomes of wheat, it carries nearly 5700 genes, including many genes with important breeding values. Research shows that 4D chromosome is more conservative than other chromosomes of D genome, and has fewer difference sites. Therefore, in-depth analysis of 4D chromosome of Aegilops tauschii and development of specific molecular markers have important application values for assisting construction of high-density genetic map, carrying out fine mapping and functional identification of genes, and screening new genetic improvement materials created by using 4D chromosome. SUMMARY

[0005] In view of the above deficiencies in the prior art, the application provides a KASP primer set of Aegilops tauschii 4D chromosome, a kit and use, which lays a foundation for subsequent construction of high-density genetic map and carrying out fine mapping, cloning and functional identification of genes, and provides a screening marker for breeding new wheat breeding improvement materials introgressed with Aegilops tauschii 4D chromosome.

[0006] To achieve the above object, the technical scheme adopted by the present application to solve its technical problems is: The present application aims to provide a KASP primer set of Aegilops tauschii 4D chromosome, which comprises six KASP primer sets, KASP-AET4Gv20311800, KASP-AET4Gv20346900, KASP-AET4Gv20385800, KASP-AET4Gv20503200, KASP-AET4Gv20550100-1 and KASP-AET4Gv20550100-2, each of which comprises two forward primers and one reverse primer, and the specific sequences of the primers are shown in SEQ ID NO. 1-18.

[0007] Further, the 5' end of the forward primer in each primer set is connected with different fluorescent labels, respectively.

[0008] Further, the fluorescent labels are FAM, Cy5, Cy3, JOE or HEX.

[0009] Another object of the present application is to provide a kit comprising the KASP primer set of Aegilops tauschii 4D chromosome.

[0010] Another object of the present application is to provide the use of the KASP primer set or the kit in identifying Aegilops tauschii 4D chromosome or a wheat variety containing Aegilops tauschii 4D chromosome.

[0011] Further, the kit comprises the following steps: (1) extracting the wheat genomic DNA to be tested; (2) using the KASP primer set or the kit to amplify the wheat genomic DNA to be tested, and then determining whether the wheat genomic DNA to be tested contains 4D chromosome according to the fluorescence signal after amplification.

[0012] Further, the amplification system comprises 1 µL of DNA sample with a concentration of 30 ng / µL, 0.04 µL of each of two forward primers with a concentration of 100 µmol / L, 0.12 µL of reverse primer with a concentration of 100 µmol / L, and 1 µL of KASP MasterMix.

[0013] Further, the amplification program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 60 s, a total of 10 cycles, and the annealing temperature decreases by 0.6℃ for each cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 60 s, a total of 30 cycles; and termination at 4℃.

[0014] The present application has the following beneficial effects: 1. The existing wheat molecular (breeding) markers or chips mainly cover the AB genome, while the markers of the D genome are relatively few. Developing KASP molecular markers specific to Aegilops tauschii has important application value for enriching the marker library. For example, it lays the foundation for markers for fine mapping of excellent genes on the D genome and subsequent gene cloning, functional identification.

[0015] 2. Aegilops tauschii chromosome 4D contains excellent genes for dwarfing, high yield, stripe rust resistance, Indian brown rust resistance, aluminum tolerance, salt and alkali tolerance, and regulation of leaf sheath epidermal pubescence traits. Developing KASP molecular markers specific to chromosome 4D can provide identification markers for screening Aegilops tauschii chromosome 4D introgression in new wheat materials for genetic improvement, accelerating the breeding process. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Flow chart for KASP marker development; Figure 2 KASP-AET4Gv20311800 marker typing result figure; red dots in the figure represent the typing results of diploid Aegilops tauschii AT23 (3 repeats), red crosses indicate that four tetraploid Durum wheat LM (2 repeats) and 25 hexaploid wheat have no amplification, and black squares represent no amplification of 2 negative controls; Figure 3 KASP-AET4Gv20346900 marker typing result figure; blue dots in the figure represent the typing results of hexaploid wheat Chuanmai 42, red dots represent the typing results of diploid Aegilops tauschii AT23 (3 repeats), red crosses indicate that four tetraploid Durum wheat LM (2 repeats) and other 24 hexaploid wheat have no amplification, and black squares represent no amplification of 2 negative controls; Figure 4 KASP-AET4Gv20385800 marker typing result figure; red dots in the figure represent the typing results of diploid Aegilops tauschii AT23 (3 repeats), red crosses indicate that four tetraploid Durum wheat LM (2 repeats) and 25 hexaploid wheat have no amplification, and black squares represent no amplification of 2 negative controls; Figure 5 KASP-AET4Gv20503200 marker typing result figure; red dots in the figure represent the typing results of diploid Aegilops tauschii AT23 (3 repeats), red crosses indicate that four tetraploid Durum wheat LM (2 repeats) and 25 hexaploid wheat have no amplification, and black squares represent no amplification of 2 negative controls; Figure 6Figure 1 is a KASP-AET4Gv20550100-1 marker genotyping result diagram; the red dots in the figure represent the genotyping results of the diploid Aegilops spelt AT23 (3 repeats), the red crosses indicate that the tetraploid Durum wheat LM (2 repeats) and 25 hexaploid wheat samples have no amplification, and the black squares represent no amplification of 2 negative controls; Figure 7 Figure 2 is a KASP-AET4Gv20550100-2 marker genotyping result diagram; the red dots in the figure represent the genotyping results of the diploid Aegilops spelt AT23 (3 repeats), the red crosses indicate that the tetraploid Durum wheat LM (2 repeats) and 25 hexaploid wheat samples have no amplification, and the black squares represent no amplification of 2 negative controls. DETAILED DESCRIPTION

[0017] The specific embodiments of the present application are described below to facilitate the understanding of the present application by those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, any changes that are obvious within the spirit and scope of the present application as defined and determined by the appended claims are obvious, and all inventions utilizing the concept of the present application are within the scope of protection.

[0018] Example 1 Marker Development The specific process of marker development is as follows, and the flowchart is shown in Figure 1 .

[0019] (1) The genome of the strangulata type Aegilops spelt AT23 (genome DD) is sequenced by the PacBio Revio platform, and is mounted to the chromosome level with the help of HiC technology; (2) From the Aegilops spelt AT23 reference genome assembled in step (1), the sequence of the 4D chromosome is extracted, and is compared with its 1D, 2D, 3D, 5D, 6D, and 7D chromosomes to screen the 4D chromosome specific SNPs of Aegilops spelt AT23; (3) The 4D chromosome specific SNPs of Aegilops spelt AT23 screened in step (2) are compared with the reference genome assembled by the third generation sequencing of the parent Durum wheat LM (genome AABB) to further filter the 4D chromosome specific SNPs of Aegilops spelt AT23; (4) The 4D chromosome specific SNPs of Aegilops spelt AT23 screened in step (3) are compared with the reference genomes (genome AABBDD) of Chinese Spring, Chuanmai 42, and Chuanmai 104 that have been published to further screen the 4D chromosome specific SNPs of Aegilops spelt AT23 and develop KASP markers; Based on the 4D chromosome of Aegilops tauschii AT23, six pairs of molecular markers were developed, which were named as KASP-AET4Gv20311800, KASP-AET4Gv20346900, KASP-AET4Gv20385800, KASP-AET4Gv20503200, KASP-AET4Gv20550100-1 and KASP-AET4Gv20550100-2; the first four markers were located in the genes AET4Gv20311800 (a co-chaperone protein related to auxiliary protein, which may be involved in endocytosis, response to abiotic stress and influence on grain development process), AET4Gv20346900 (a finger protein containing zinc finger domain, which may be involved in development regulation, immunity and disease resistance, response to abiotic stress and chromatin regulation), AET4Gv20385800 (a Lon protease family ATP-dependent protease, which may be involved in specific recognition and degradation of signal and regulation of protease activity) and AET4Gv20503200 (6-phosphofructo-2-kinase, which is a key glycometabolic regulatory enzyme and is involved in the regulation of glycolysis and gluconeogenesis pathways) of the 4D chromosome; the last two markers were both located in the gene AET4Gv20550100 (an AAA protein, which is a highly conserved ATP hydrolase and belongs to the ATPase family related to various cell activities) of the 4D chromosome.

[0020] The KASP marker primer set constructed includes two forward primers and one reverse primer, and a sequence GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 19) matching with FAM fluorescent group is added to the 5' end of one of the forward primers, and a sequence GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 20) matching with HEX fluorescent group is added to the 5' end of the other forward primer. The specific information of the primer set is shown in Table 1, which was synthesized by Shanghai Yingjie Biotechnology Co., Ltd.

[0021] Table 1 KASP marker information

[0022] Example 2 Marker verification The genotypes of diploid Aegilops tauschii AT23 (three replicates were set), tetraploid Durum wheat LM (two replicates were set) and 25 hexaploid common wheat were detected by using the six KASP markers developed in the application, and the specificity of the KASP markers was verified, and two negative controls were set, and the specific process was as follows: (1) Collecting wheat leaf samples for extracting genomic DNA; (2) Using the DNA extracted in step (1) as a template, using the KASP markers KASP-AET4Gv20311800, KASP-AET4Gv20346900, KASP-AET4Gv20385800, KASP-AET4Gv20503200, KASP-AET4Gv20550100-1 and KASP-AET4Gv20550100-2 designed above, using the reaction system in Table 2 and the reaction conditions in Table 3, PCR sample loading, plate sealing, amplification and detection were carried out in the high-throughput KASP genotype detection instrument GeneSmart 2000 (Chengdu Han Chen Guangyi Science and Technology Co., Ltd.). Table 2 PCR reaction system

[0023] Table 3 PCR amplification conditions

[0024] (3) Amplification product clustering typing: the PCR amplification and genotyping results of 6 KASP markers of 30 wheat samples are shown in Figures 2-7 .

[0025] As shown in Figures 2-7 , the 6 pairs of KASP marker primers were not detected in the material LM without D genome of the hard wheat, and all can identify the 4D chromosome derived from Aegilops tauschii AT23 and other common wheat.

[0026] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the examples, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.

Claims

1. A KASP primer set for Aegilops taus 4D chromosome, characterized in that, The KASP primer set comprises six KASP primer sets, KASP-AET4Gv20311800, KASP-AET4Gv20346900, KASP-AET4Gv20385800, KASP-AET4Gv20503200, KASP-AET4Gv20550100-1 and KASP-AET4Gv20550100-2, each primer set comprising two forward primers and one reverse primer, and the specific sequences of the primers are shown in SEQ ID NO. 1-18.

2. The KASP primer set for Secale montanum 4D chromosome according to claim 1, characterized by, The 5' end of the forward primer in each primer set is connected with different fluorescent labels.

3. The KASP primer set for Secale montanum 4D chromosome according to claim 2, characterized by The fluorescent labels are FAM, Cy5, Cy3, JOE or HEX.

4. A kit characterized in that, The KASP primer set for the 4D chromosome of Aegilops tauschii of claim 1 or 2.

5. Use of the KASP primer set of any one of claims 1-3 or the kit of claim 4 in identifying the 4D chromosome of Aegilops tauschii or a wheat variety containing a fragment or gene of the 4D chromosome of Aegilops tauschii.

6. Use according to claim 5, characterized in that, The method comprises the following steps: (1) extracting the wheat genomic DNA to be tested; (2) amplifying the wheat genomic DNA to be tested using the KASP primer set of any one of claims 1-3 or the kit of claim 4, and then determining whether the 4D chromosome introgression fragment or gene is contained according to the fluorescence signal after amplification.

7. Use according to claim 6, characterized in that, The amplification system comprises 1 µL of DNA sample with a concentration of 30 ng / µL, 0.04 µL of each of two forward primers with a concentration of 100 µmol / L, 0.12 µL of a reverse primer with a concentration of 100 µmol / L, and 1 µL of KASP MasterMix.

8. Use according to claim 6, characterized in that, The amplification procedure is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ for each cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 60 s, for a total of 30 cycles; termination at 4℃. The amplification procedure is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 60 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ for each cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 60 s, for a total of 30 cycles; termination at 4℃.

Images