Application of GPNMB in preparation of medicine for diagnosing and / or treating glioma

The antibody diagnostic and treatment strategy targeting GPNMB has solved the treatment challenges of gliomas, especially GBM, providing personalized diagnostic and treatment plans that effectively inhibit tumor growth and invasion, and prolong patient survival.

CN121454068APending Publication Date: 2026-02-03金凤实验室
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511602964.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-04
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

There is a lack of effective molecularly targeted therapies to combat gliomas, especially glioblastoma (GBM), and existing treatment options such as surgery, radiotherapy, and chemotherapy have limited efficacy, high recurrence rates, and short median survival.

Method used

Using the glycoprotein nonmetastatic melanoma protein B (GPNMB) as a target, gliomas can be diagnosed and treated with antibodies that specifically bind to it, such as glembatumumab. This includes the preparation of diagnostic kits and pharmaceutical compositions containing antibodies that target GPNMB.

Benefits of technology

It provides diverse and personalized diagnostic and treatment options for highly active gliomas, enabling the assessment and targeting of GPNMB expression, inhibiting tumor growth and invasion, and prolonging patient survival.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121454068A_ABST
    Figure CN121454068A_ABST
Patent Text Reader

Abstract

The invention provides an application of a glycoprotein non-metastatic melanoma protein B (GPNMB) in preparation of a medicine for diagnosing or treating glioma. The invention also provides a diagnostic kit for diagnosing glioma, and a pharmaceutical composition for treating glioma. According to the invention, more diversified and personalized means are provided for clinical diagnosis and treatment of high-activity glioma, and a potential targeted treatment strategy is provided for overcoming glioma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biodiagnostic technology, specifically to the use of GPNMB in the preparation of medicaments for the diagnosis and / or treatment of gliomas. Background Technology

[0002] Gliomas are the most common primary brain tumors, with glioblastoma (GBM) being the most malignant subtype and posing significant clinical challenges. Standard treatment for GBM involves maximal surgical resection, followed by combined radiotherapy and temozolomide-based chemotherapy. Despite years of optimization, clinical outcomes remain poor, with a median survival of only about 14 months and a five-year survival rate of less than 5%. [1-3] GBM exhibits a diffuse, infiltrative growth pattern with indistinct boundaries from normal brain tissue, making complete resection virtually impossible, and resulting in a recurrence rate as high as 90%. Radiotherapy can prolong progression-free survival, but GBM stem cells acquire radioresistance, thus weakening the treatment's effectiveness. [4,5] Transmembrane receptors occupy a central position in tumor biology due to their unique topological structure and signaling function. These proteins not only sense microenvironmental signals through their extracellular structure, but their aberrant activation can also drive tumorigenesis and progression through downstream signaling cascades. Importantly, their location on the cell surface makes them ideal candidate targets for antibody drugs and molecular targeted therapies. In the field of targeted therapy, antibody drugs targeting the extracellular structure of transmembrane receptors have achieved breakthrough progress in various solid tumors; however, effective molecular targets in GBM remain scarce, severely limiting therapeutic progress. [6-9] Typical success stories include tyrosine kinase inhibitors (TKIs) targeting EGFR-mutant non-small cell lung cancer, trastuzumab for HER2-positive breast cancer, and dabrafenib-trametinib combination therapy for BRAF V600E-mutant melanoma. [10-12] However, the development of targeted therapy for gliomas has lagged far behind. Identifying transmembrane receptors that are abnormally highly expressed in GBM and regulate tumorigenesis may provide new diagnostic and therapeutic targets.

[0003] The glycoprotein nonmetastatic melanoma protein B (GPNMB) gene was first discovered in human melanoma cells through differential cDNA library screening.

[13] It encodes a highly glycosylated type I transmembrane protein, primarily located in the plasma membrane, endosomes, and lysosomes.

[14] Structurally, GPNMB consists of an extracellular region, a single transmembrane domain, and an intracellular tail.

[14] The extracellular region contains an N-terminal signal peptide, an RGD (arginine-glycine-aspartic acid) motif, and a PKD (polycystic kidney disease) domain. The RGD motif mediates integrin binding and regulates cell adhesion, migration, proliferation, and apoptosis, while the PKD domain facilitates cell-cell interactions. The intracellular tail contains the hemITAM motif (YXXI) and the dileucine motif (D / EXXXLL), which are involved in receptor phosphorylation and endocytic transport, respectively.

[14] In various cancers, GPNMB expression is significantly elevated, promoting invasion and metastasis, and is associated with poor prognosis. [15-21] The most in-depth research focuses on melanoma and triple-negative breast cancer (TNBC). Among breast cancer subtypes, TNBC shows the highest GPNMB expression, promotes metastasis, and is associated with the shortest overall survival.

[22] A humanized anti-GPNMB monoclonal antibody-drug conjugate (ADC) – Glembatumumab-Vedotin (CR011-vcMMAE, bound to the microtubule inhibitor monomethylauratestatin E, MMAE) – has demonstrated antitumor activity in melanoma and TNBC. [23,24] In gliomas, GPNMB is also significantly upregulated, and its high expression is associated with increased proliferation, invasion, angiogenesis, and poorer prognosis. [25-27] However, the molecular mechanism of action of GPNMB in GBM remains unclear.

[0004] The JAK-STAT pathway is an important signaling cascade in mammalian cells, mediating cellular responses to extracellular cytokines and growth factors. It consists of three main components: cell surface receptors, Janus kinases (JAK1, JAK2, JAK3, and TYK2), and signal transduction and transcription activators (STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6). [28,29] Ligand binding induces receptor dimerization and JAK activation, leading to receptor phosphorylation and recruitment of STAT proteins to their SH2 domains. Phosphorylated STATs form homodimers or heterodimers, translocate into the nucleus, and activate target gene transcription. Under physiological conditions, JAK-STAT signaling regulates proliferation, differentiation, apoptosis, and immune responses, thereby maintaining tissue homeostasis. [29-33] Its abnormal activation is widely considered to be an important factor driving tumorigenesis. [29-31] Of all STAT proteins, STAT3 is the most common high-frequency overactivator, especially in GBM, where its high expression, phosphorylation, and nuclear localization are closely associated with poor prognosis. [34-38] STAT3 activation promotes GBM proliferation, invasion, treatment tolerance, and mesenchymal transformation. [37-45]It also helps to adapt to hypoxia, promotes angiogenesis and immunosuppression, and together creates a microenvironment conducive to tumor growth.

[46] Furthermore, the absence of STAT3 phosphatase PTPRD is common in GBM, further enhancing STAT3 activity.

[47] .

[0005] References

[0006] [1] QT Ostrom, H. Gittleman, P. Liao, T. Vecchione-Koval, Y.Wolinsky, C. Kruchko, JS Barnholtz-Sloan, CBTRUS Statistical Report: Primary brain and other central nervous system tumors diagnosed in the United States in 2010-2014, Neuro Oncol, 19 (2017) v1-v88.

[0007] [2] DN Louis, A. Perry, G. Reifenberger, A. von Deimling, D.Figarella-Branger, WK Cavenee, H. Ohgaki, OD Wiestler, P. Kleihues, DWEllison, The 2016 World Health Organization Classification of Tumors of theCentral Nervous System: a summary, Acta Neuropathol, 131 (2016) 803-820.

[0008] [3] L. Lin, J. Cai, C. Jiang, Recent Advances in Targeted Therapy for Glioma, Curr Med Chem, 24 (2017) 1365-1381.

[0009] [4] S. Bao, Q. Wu, R.E. McLendon, Y. Hao, Q. Shi, A.B. Hjelmeland,M.W. Dewhirst, D.D. Bigner, J.N. Rich, Glioma stem cells promoteradioresistance by preferential activation of the DNA damage response,Nature, 444 (2006) 756-760.

[0010] [5] O.S. Sahoo, R. Mitra, N.K.H. Nagaiah, The hidden architects ofglioblastoma multiforme: Glioma stem cells, MedComm-Oncology, 3 (2024) 1-27.

[0011] [6] X. Lei, N. Ma, L. Du, Y. Liang, P. Zhang, Y. Han, B. Qu, PP2A andtumor radiotherapy, Hereditas, 157 (2020) 36.

[0012] [7] J.S. Wefel, T.S. Armstrong, S.L. Pugh, M.R. Gilbert, M.M.Wendland, D.G. Brachman, K.S. Roof, P.D. Brown, I.R. Crocker, H.I. Robins, G.Hunter, M. Won, M.P. Mehta, Neurocognitive, symptom, and health-relatedquality of life outcomes of a randomized trial of bevacizumab for newlydiagnosed glioblastoma (NRG / RTOG 0825), Neuro Oncol, 23 (2021) 1125-1138.

[0013] [8] J Yin, W Yin, L Zheng, Y Li, C Luo, S Zhang, L Duan, H Zhou, K Cheng, J Lang, K Xu, Anlotinib as Monotherapy or CombinationTherapy for Recurrent High-Grade Glioma: A Retrospective Study, Clin MedInsights Oncol, 17 (2023). 11795549231175714 .

[0014] [9] Li P, YyY Chen, S Lai, F Jiang, X Liu, C Tao, L Wang, G Liu, J Huang, Y Tang, Z Liu, G Shen, C Li, T Xie, F Lu, A phase IIstudy of anlotinib combined with STUPP regimen in the treatment of patientswith newly diagnosed glioblastoma (GBM), Journal of Clinical Oncology, 39(2021) 2039-2039.

[0015]

[10] Mok TS, Wu YL, Ahn MJ, Garassino MC, Kim HR, SSRamalingam, Shepherd FA, He Y, Akamatsu H, Theelen WS, Lee CK, Sebastian M, Templeton A, Mann H, Marotti MJ, Ghiorghiu H, VAPapadimitrakopoulou, A Investigators, Osimertinib or Platinum-Pemetrexed inEGFR T790M-Positive Lung Cancer, N Engl J Med, 376 (2017) 629-640.

[0016]

[11] SM Swain, J. Baselga, SB Kim, J. Ro, V. Semiglazov, M.Campone, E. Ciruelos, JM Ferrero, A. Schneeweiss, S. Heeson, E. Clark, G.Ross, MC Benyunes, J. Cortes, CS Group, Pertuzumab, and trastuzumab, and trastuzumab in metastatic HER2-positive breast cancer, N Engl J Med, 372 (2015)724-734.

[0017]

[12] GV Long, D. Stroyakovskiy, H. Gogas, E. Levchenko, F. deBraud, J. Larkin, C. Garbe, T. Jouary, A. Hauschild, JJ Grob, V. Chiarion-Sileni, C. Lebbe, M. Mandala, M. Millward, A. Arance, I. J. Bondarenko, J. B. Hansen, J. Hansen. Utikal, V. Ferraresi, N. Kovalenko, P. Mohr, V.Probachai, D. Schadendorf, P. Nathan, C. Robert, A. Ribas, DJ DeMarini,JG Irani, S. Swann, JJ Legos, F. Jin, B. Mookerjee, K. Flaherty,Dabrafenib and tramefentinib for placebo and tramefenib in 2006 BRAF-mutant melanoma: a multicentre, double-blind, phase 3 randomized controlledtrial, Lancet, 386 (2015) 444-451.

[0018]

[13] M.A. Weterman, N. Ajubi, I.M. van Dinter, W.G. Degen, G.N. vanMuijen, D.J. Ruitter, H.P. Bloemers, nmb, a novel gene, is expressed in low-metastatic human melanoma cell lines and xenografts, Int J Cancer, 60 (1995)73-81.

[0019]

[14] G. Maric, A.A. Rose, M.G. Annis, P.M. Siegel, Glycoprotein non-metastatic b (GPNMB): A metastatic mediator and emerging therapeutic targetin cancer, Onco Targets Ther, 6 (2013) 839-852.

[0020]

[15] J.P. Zhai, Z.H. Liu, H.D. Wang, G.L. Huang, L.B. Man, GPNMBoverexpression is associated with extensive bone metastasis and poorprognosis in renal cell carcinoma, Oncology letters, 23 (2022) 36.

[0021]

[16] D.D. Truong, A. Kratz, J.G. Park, E.S. Barrientos, H. Saini, T.Nguyen, B. Pockaj, G. Mouneimne, J. LaBaer, M. Nikkhah, A Human OrganotypicMicrofluidic Tumor Model Permits Investigation of the Interplay betweenPatient-Derived Fibroblasts and Breast Cancer Cells, Cancer research, 79(2019) 3139-3151.

[0022]

[17] G. Maric, M.G. Annis, Z. Dong, A.A. Rose, S. Ng, D. Perkins,P.A. MacDonald, V. Ouellet, C. Russo, P.M. Siegel, GPNMB cooperates withneuropilin-1 to promote mammary tumor growth and engages integrin α5β1 forefficient breast cancer metastasis, Oncogene, 34 (2015) 5494-5504.

[0023]

[18] M. Taya, S.R. Hammes, Glycoprotein Non-Metastatic MelanomaProtein B (GPNMB) and Cancer: A Novel Potential Therapeutic Target, Steroids,133 (2018) 102-107.

[0024]

[19] A.M. Lazaratos, M.G. Annis, P.M. Siegel, GPNMB: a potent inducerof immunosuppression in cancer, Oncogene, 41 (2022) 4573-4590.

[0025]

[20] Y.N. Li, L. Zhang, X.L. Li, D.J. Cui, H.D. Zheng, S.Y. Yang,W.L. Yang, Glycoprotein nonmetastatic B as a prognostic indicator in smallcell lung cancer, APMIS, 122 (2014) 140-146.

[0026]

[21] G. Maric, M.G. Annis, P.A. MacDonald, C. Russo, D. Perkins, D.R.Siwak, G.B. Mills, P.M. Siegel, GPNMB augments Wnt-1 mediated breast tumorinitiation and growth by enhancing PI3K / AKT / mTOR pathway signaling and beta-catenin activity, Oncogene, 38 (2019) 5294-5307.

[0027]

[22] A.A. Rose, M.G. Annis, Z. Dong, F. Pepin, M. Hallett, M. Park,P.M. Siegel, ADAM10 releases a soluble form of the GPNMB / Osteoactivinextracellular domain with angiogenic properties, PloS one, 5 (2010) e12093.

[0028]

[23] L. Naumovski, J.R. Junutula, Glembatumumab vedotin, a conjugateof an anti-glycoprotein non-metastatic melanoma protein B mAb and monomethylauristatin E for the treatment of melanoma and breast cancer, Curr Opin MolTher, 12 (2010) 248-257.

[0029]

[24] C. Vaklavas, A. Forero, Management of metastatic breast cancerwith second-generation antibody-drug conjugates: focus on glembatumumabvedotin (CDX-011, CR011-vcMMAE), BioDrugs, 28 (2014) 253-263.

[0030]

[25] G. Bao, N. Wang, R. Li, G. Xu, P. Liu, B. He, Glycoprotein non-metastaticmelanoma protein B promotes glioma motility and angiogenesisthrough the Wnt / β-catenin signaling pathway, Experimental biology andmedicine (Maywood, N.J.), 241 (2016) 1968-1976.

[0031]

[26] C.T. Kuan, K. Wakiya, S.T. Keir, J. Li, J.E. Herndon, 2nd, I.Pastan, D.D. Bigner, Affinity-matured anti-glycoprotein NMB recombinantimmunotoxins targeting malignant gliomas and melanomas, International journalof cancer, 129 (2011) 111-121.

[0032]

[27] J.J. Huang, W.J. Ma, S. Yokoyama, Expression andimmunolocalization of Gpnmb, a glioma-associated glycoprotein, in normal andinflamed central nervous systems of adult rats, Brain Behav, 2 (2012) 85-96.

[0033]

[28] X. Hu, J. Li, M. Fu, X. Zhao, W. Wang, The JAK / STAT signalingpathway: from bench to clinic, Signal Transduct Target Ther, 6 (2021) 402.

[0034]

[29] R.P. Agashe, S.M. Lippman, R. Kurzrock, JAK: Not Just AnotherKinase, Mol Cancer Ther, 21 (2022) 1757-1764.

[0035]

[30] N. Awasthi, C. Liongue, A.C. Ward, STAT proteins: a kaleidoscopeof canonical and non-canonical functions in immunity and cancer, J HematolOncol, 14 (2021) 198.

[0036]

[31] C. Xue, Q. Yao, X. Gu, Q. Shi, X. Yuan, Q. Chu, Z. Bao, J. Lu,L. Li, Evolving cognition of the JAK-STAT signaling pathway: autoimmunedisorders and cancer, Signal Transduct Target Ther, 8 (2023) 204.

[0037]

[32] A.V. Villarino, Y. Kanno, J.J. O'Shea, Mechanisms andconsequences of Jak-STAT signaling in the immune system, Nat Immunol, 18(2017) 374-384.

[0038]

[33] J.J. O'Shea, D.M. Schwartz, A.V. Villarino, M. Gadina, I.B.McInnes, A. Laurence, The JAK-STAT pathway: impact on human disease andtherapeutic intervention, Annu Rev Med, 66 (2015) 311-328.

[0039]

[34] S.G. Manore, D.L. Doheny, G.L. Wong, H.W. Lo, IL-6 / JAK / STAT3Signaling in Breast Cancer Metastasis: Biology and Treatment, Front Oncol, 12(2022) 866014.

[0040]

[35] C.Y. Loh, A. Arya, A.F. Naema, W.F. Wong, G. Sethi, C.Y. Looi,Signal Transducer and Activator of Transcription (STATs) Proteins in Cancerand Inflammation: Functions and Therapeutic Implication, Front Oncol, 9(2019) 48.

[0041]

[36] H. Yu, D. Pardoll, R. Jove, STATs in cancer inflammation andimmunity: a leading role for STAT3, Nat Rev Cancer, 9 (2009) 798-809.

[0042]

[37] E.C. Brantley, L.B. Nabors, G.Y. Gillespie, Y.H. Choi, C.A.Palmer, K. Harrison, K. Roarty, E.N. Benveniste, Loss of protein inhibitorsof activated STAT-3 expression in glioblastoma multiforme tumors:implications for STAT-3 activation and gene expression, Clin Cancer Res, 14(2008) 4694-4704.

[0043]

[38] G.S. Lin, L.J. Yang, X.F. Wang, Y.P. Chen, W.L. Tang, L. Chen,Z.X. Lin, STAT3 Tyr705 phosphorylation affects clinical outcome in patientswith newly diagnosed supratentorial glioblastoma, Med Oncol, 31 (2014) 924.

[0044]

[39] Z.G. Ouedraogo, J. Biau, J.L. Kemeny, L. Morel, P. Verrelle, E.Chautard, Role of STAT3 in Genesis and Progression of Human MalignantGliomas, Mol Neurobiol, 54 (2017) 5780-5797.

[0045]

[40] G.P. Atkinson, S.E. Nozell, E.T. Benveniste, NF-kappaB and STAT3signaling in glioma: targets for future therapies, Expert Rev Neurother, 10(2010) 575-586.

[0046]

[41] E.Z. Chai, M.K. Shanmugam, F. Arfuso, A. Dharmarajan, C. Wang,A.P. Kumar, R.P. Samy, L.H. Lim, L. Wang, B.C. Goh, K.S. Ahn, K.M. Hui, G.Sethi, Targeting transcription factor STAT3 for cancer prevention andtherapy, Pharmacol Ther, 162 (2016) 86-97.

[0047]

[42] N. Cancer Genome Atlas Research, Comprehensive genomiccharacterization defines human glioblastoma genes and core pathways, Nature,455 (2008) 1061-1068.

[0048]

[43] H.S. Phillips, S. Kharbanda, R. Chen, W.F. Forrest, R.H.Soriano, T.D. Wu, A. Misra, J.M. Nigro, H. Colman, L. Soroceanu, P.M.Williams, Z. Modrusan, B.G. Feuerstein, K. Aldape, Molecular subclasses ofhigh-grade glioma predict prognosis, delineate a pattern of diseaseprogression, and resemble stages in neurogenesis, Cancer Cell, 9 (2006) 157-173.

[0049]

[44] J. Halliday, K. Helmy, S.S. Pattwell, K.L. Pitter, Q. LaPlant,T. Ozawa, E.C. Holland, In vivo radiation response of proneural gliomacharacterized by protective p53 transcriptional program and proneural-mesenchymal shift, Proc Natl Acad Sci U S A, 111 (2014) 5248-5253.

[0050]

[45] Carro MS, Lim WK, Alvarez MJ, Bollo RJ, Zhao X, EYSnyder, Sulman EP, Anne SL, Doetsch F, Colman H, Lasorella A, Aldape K, Califano A, Iavarone A, The transcriptional network for mesenchymaltransformation of brain tumors, Nature, 463 (2010) 318–3

[0051]

[46] J. Wei, J. Barr, LY Kong, Y. Wang, A. Wu, AK Sharma, J.Gumin, V. Henry, H. Colman, W. Priebe, R. Sawaya, FF Lang, AB Heimberger,Glioblastoma cancer-initiating cells inhibit T-cell proliferation andeffector responses, Mol Cancer Ther, 9(2010) 67-78.

[0052]

[47] S. Veeriah, C. Brennan, S. Meng, B. Singh, JA Fagin, DBSolit, PB Paty, D. Rohle, I. Vivanco, J. Chmielecki, W. Pao, M. Ladanyi, WL Gerald, L. Liau, TC Cloughesy, PS Mischel, C. Sander, B. Taylor, N.Schultz, J. Major, A. Heguy, F. Fang, IK Mellinghoff, TA Chan, Thetyrosine phosphatase PTPRD is a tumor suppressor that is frequently inactivated and mutated in glioblastoma and other human cancers, Proc NatlAcad Sci USA, 106 (2009) 9435-9440. Summary of the Invention

[0053] To address the gaps in the existing technology, this invention provides the use of glycoprotein nonmetastatic melanoma protein B (GPNMB) in the preparation of drugs for the diagnosis or treatment of gliomas.

[0054] This invention provides the use of glycoprotein nonmetastatic melanoma protein B (GPNMB) in the preparation of medicaments for the diagnosis or treatment of gliomas.

[0055] In one embodiment of the invention, the glioma is a highly active glioma.

[0056] In one embodiment of the invention, it includes detecting the expression level of GPNMB in a sample by means of an antibody that specifically binds to GPNMB.

[0057] In one embodiment of the invention, the antibody is a monoclonal antibody that specifically binds to GPNMB.

[0058] The present invention also provides a diagnostic kit for diagnosing gliomas, which includes reagents for detecting the expression level of GPNMB in a sample.

[0059] In one embodiment of the invention, it comprises an antibody targeting GPNMB; preferably, the antibody is a polyclonal antibody or a monoclonal antibody. The antibody is Glembatumumab.

[0060] The present invention further provides a pharmaceutical composition for treating glioma, comprising an antibody targeting GPNMB and pharmaceutically acceptable excipients. The antibody is preferably Glembatumumab.

[0061] The beneficial effects of the above-described technical solution of the present invention are as follows:

[0062] This invention provides the application of glycoprotein nonmetastatic melanoma protein B (GPNMB) in the assessment and targeting strategies for the diagnostic and treatment characteristics of highly active glioma patients, providing more diversified and personalized means for the clinical diagnosis and treatment of highly active gliomas, and offering potential targeted therapy strategies for overcoming gliomas. Attached Figure Description

[0063] Figure 1 To detect the increased expression of GPNMB in GBM compared to LGG and predict poor prognostic outcomes, the following atlases were created: A shows the atlas of 338 genes significantly upregulated in GBM compared to LGG, identified by analysis of four publicly available glioma transcriptome datasets; B and C show the atlases after integrating transcriptome, proteome, and membrane receptor annotations, respectively, identifying 14 transmembrane receptors upregulated in GBM, with GPNMB showing the strongest prognostic significance; D shows the atlas of proteomics analysis results, showing that among the upregulated receptors, GPNMB ranked second in terms of upregulation, second only to PROM1, while the latter had no prognostic significance; E shows the atlases of Western blot and quantitative analysis results of fresh glioma tissues (different grades), showing the difference in GPNMB expression; F shows the representative immunohistochemical (IHC) images of GPNMB protein in glioma tissue microarrays (n = 169); G shows the IHC results atlas, showing that compared to LGG, GBM... GPNMB protein expression was stronger in the middle; H is the Kaplan-Meier survival analysis result, which shows that high levels of GPNMB expression are associated with significantly shortened overall survival; I and J are the correlation maps of GPNMB upregulation and copy number amplification, IDH wild-type status, mesenchymal subtype, and Non-G-CIMP phenotype, respectively.

[0064] Figure 2This section presents a map showing the correlation between genetic and epigenetic alterations and high GPNMB expression. A represents the proteomic analysis of 12 glioma cases (6 LGG and 6 GBM), identifying 907 significantly altered proteins, of which 696 were upregulated and 293 downregulated in GBM. B and C are Kaplan-Meier survival analysis maps, showing that the top 50 upregulated genes predict poor survival, while the top 50 downregulated genes predict good survival. D and E are GSEA analysis results, showing that GBM is enriched with genes characteristic of epithelial-mesenchymal transition and mesenchymal subtypes. F and G are Kaplan-Meier survival curves across glioma datasets, showing that GPNMB expression has significant prognostic value. H and I are TCGA data maps, showing frequent GPNMB amplification in GBM, with a positive correlation between amplification and transcriptional levels. J and K are CpG sites near the GPNMB promoter and exon 1, respectively. Genomic location map of the probe; L and M are methylation detection results maps, showing significantly lower methylation at three CpG sites compared to LGG and GBM; N–P show that reduced methylation at these CpG sites predicts shorter survival for glioma patients;

[0065] Figure 3 This is a map showing the tumor-promoting effects of GPNMB in GBM cells (in vitro and in vivo). A shows the results of the EdU incorporation experiment, indicating enhanced proliferation in GPNMB-overexpressing cells and decreased proliferation in GPNMB-knockdown cells. B shows the results of the Transwell assay, indicating enhanced invasiveness in GPNMB-overexpressing cells and decreased invasiveness in knockdown cells. C and D show the results of orthotopic xenograft models using U251 and GL261 cells, respectively, showing that GPNMB overexpression significantly accelerates tumor growth. E shows the H&E staining, confirming a larger tumor burden in the GPNMB-overexpressing group. F shows the immunohistochemical analysis results of Ki-67 and GPNMB, showing significantly enhanced proliferative activity in tumors with high GPNMB expression.

[0066] Figure 4This is a graph depicting the experimental results of GPNMB promoting GBM cell proliferation, invasion, and spheroid formation in vitro. A shows the basal expression levels of GPNMB in human and mouse GBM cell lines; B–E show the results of establishing and validating stable GPNMB overexpression and knockdown cell lines using Western blot, respectively; F shows the quantitative analysis results of the EdU incorporation experiment; G shows the quantitative analysis results of the Transwell invasion experiment; H shows the results of the colony formation experiment, demonstrating that GPNMB promotes adherent growth; and I shows the results of the spheroid formation experiment under suspension culture, confirming that GPNMB enhances dry-sample properties.

[0067] Figure 5 The diagram illustrates the activation of the IFN signaling pathway by GPNMB in GBM cells. A shows the intersection of proteins upregulated in GPNMB-overexpressing cells and downregulated in knockdown cells, identifying 81 overlapping proteins enriched in immune-related pathways. B shows real-time PCR results, validating that GPNMB knockdown leads to downregulation of IFN-stimulated genes. C–E show GSEA analysis of proteomic data, demonstrating consistent enrichment of IFN-related pathways across all groups. F shows analysis of the TCGA_GBMLGG, TCGA_GBM, and CGGA datasets, indicating significant enrichment of IFN-related pathways in GPNMB-overexpressing tumors. G shows the integrated analysis of proteomic and clinical data, identifying 71 shared GOBP gene sets with repeated occurrences of multiple IFN signaling pathways, indicating their enrichment.

[0068] Figure 6 Molecular annotation maps for identifying GPNMB-related proteins in GBM cells using mass spectrometry analysis were constructed. A is a PCA plot showing the reproducibility of proteomic replicates across experimental groups; B is a volcano plot showing differentially expressed proteins between U251 / GPN and U251 / EV cells; C is a volcano plot showing differentially expressed proteins between U251 / shGP and U251 / shCL cells; D–G are functional annotation maps showing enrichment in immune-related pathways, including the interferon (IFN) signaling pathway.

[0069] Figure 7GPNMB promotes STAT3 phosphorylation under both basal and stimulated conditions. Figure A shows a Western blot analysis, indicating that GPNMB overexpression enhances STAT3–Y705 phosphorylation, while knockdown inhibits this process. Figures B–C show Western blot analysis, indicating that stimulating cytokines (IFNα and IFNγ) further enhance STAT3 phosphorylation in GPNMB-overexpressing cells, while this is inhibited in knockdown cells. Figure D shows a Kaplan–Meier survival curve, indicating that simultaneous high expression of GPNMB and STAT3 predicts poor prognosis in glioma patients. Figures E–F show immunohistochemical analysis results, showing that in the orthotopic xenograft model, GL261 / shGP tumors exhibit reduced STAT3–Y705 phosphorylation levels, validating the in vivo relevance of this phenomenon.

[0070] Figure 8 The images show the activation maps of the JAK–STAT pathway in GPNMB and GBM cells. A is a phosphoproteomic analysis map, showing decreased STAT3–Y705 phosphorylation in U251 / shGP cells compared to shCL cells. B is a map validating STAT3–Y705 phosphorylation in LN229 cells overexpressing GPNMB. C–D are maps related to GPNMB knockdown, showing reduced IFN-induced STAT1–Y701 phosphorylation in U251 cells. E–F are immunohistochemical analysis results from GL261 / shGP cells, showing decreased STAT1–Y701 phosphorylation levels compared to the control group.

[0071] Figure 9 The diagram shows the interaction between GPNMB and JAK1, demonstrating its promotion of STAT activation in GBM cells. A represents the Co-IP and proteomic analysis map, identifying 119 GPNMB-specific interacting proteins. B shows the functional annotation map, indicating these proteins are enriched in glycosyl modification, IFN signaling pathways, and innate immune-related pathways. C–D represent the Co-IP validation of the GPNMB-JAK1 interaction in 293T cells, with immunofluorescence showing co-localization in T98G cells. E is the structural modeling map, suggesting that the intracellular domains of GPNMB mediate its binding to JAK1. F shows the Co-IP experimental results, indicating a direct interaction between GPNMB and STAT1 / 3. G and H represent the effects of mutating Y525 to phenylalanine (Y525F), showing a significant reduction in GPNMB phosphorylation and disruption of its interaction with STAT proteins.

[0072] Figure 10 This is an experimental map showing the phosphorylation of GPNMB–Y525 by JAK1 in GBM cells. A shows the immunofluorescence results, indicating co-localization of GPNMB and JAK1 in T98G cells; B shows the tyrosine phosphorylation level of GPNMB; C and D are structural modeling diagrams predicting the interaction between GPNMB and STAT1 / STAT3; E is a cross-species comparison diagram showing the high evolutionary conservation of GPNMB–Y525; F shows the impact of the Y525F mutation, which reduces tyrosine phosphorylation of GPNMB; and G shows the in vitro kinase experiment results, indicating that JAK1 can directly phosphorylate GPNMB's Y525.

[0073] Figure 11 This is a diagram illustrating the experimental results of antibody targeting GPNMB inhibiting GBM cell growth in vivo. A and B show the results of the Co-IP experiment, demonstrating that GPNMB can form dimers, and phosphorylation at the Y525 site promotes this dimerization. C shows the experimental results of the humanized anti-GPNMB monoclonal antibody Glembatumumab in an orthotopic mouse model, showing significant inhibition of GBM tumor growth. D is a schematic model diagram showing that JAK1-mediated GPNMB–Y525 phosphorylation provides a docking site for STAT1 / 3, thereby driving JAK–STAT pathway activation and promoting glioblastoma progression.

[0074] Figure 12 Figures show the experimental results related to the inhibition of GPNMB activity in GBM cells by the outer domain of soluble GPNMB. Among them, A is the Western blot result, showing the expression of GPNMB–ECD–FC protein and control FC protein; B and C are the experimental results of GPNMB–ECD–FC treatment, showing that GPNMB–ECD–FC treatment reduced the phosphorylation level of STAT3; D and E are the results of Transwell migration assay and colony formation assay, respectively, showing that GPNMB–ECD–FC inhibited cell migration and proliferation. Detailed Implementation

[0075] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0076] Unless otherwise specified, all reagents used in this embodiment are of analytical grade, and the progress of all chemical reactions is detected by thin-layer chromatography.

[0077] Example 1. GPNMB is a transmembrane receptor highly expressed in GBM, more significantly than in LGG.

[0078] 1. Experimental Materials and Methods

[0079] 1) Multi-database GPNMB analysis:

[0080] Online databases such as TCGA_GBMLGG, CGGA, Rembrandt, and Gravendeel were used to divide the population into high and low expression groups based on the median expression level of GPNMB in GBM. Genes that were significantly upregulated in GBM (Fold Change > 1.5, P < 0.01) were intersected to obtain 338 candidate genes.

[0081] Table 1. Clinical data of glioma patients in this study.

[0082] Patient ID. gender age IDH classification Organizational Analysis Classification MS Western Patient 1 female 41 MU OD 2 yes yes Patient 2 male 38 MU OD 3 yes yes Patient 3 male 53 MU OD 3 yes yes Patient 4 male 57 MU AC 2 yes yes Patient 5 male 47 MU AC 3 yes yes Patient 6 male 43 MU AC 3 yes yes Patient 7 male 54 WT GBM 4 yes yes Patient 8 male 55 WT GBM 4 yes yes Patient 9 female 33 WT GBM 4 yes yes Patient 10 male 54 WT GBM 4 yes yes Patient 11 female 50 WT GBM 4 yes yes Patient 12 male 66 WT GBM 4 yes yes Patient 13 male 43 MU OD 2 no yes Patient 14 male 56 MU OD 2 no yes Patient 15 female 38 MU AC 3 no yes

[0083] 2) Specific steps of Western blot:

[0084] Proteins were collected using RIPA lysis buffer with added protease inhibitors. The subsequent step involved lysing the samples on ice for 30 min. After centrifugation at 15,000 rpm for 15 min at 4 °C, the resulting precipitate was collected for protein concentration determination and high-temperature denaturation. Proteins of different sizes were subjected to SDS-PAGE and transferred to a PVDF membrane. Following blocking, the membranes were incubated with specific primary antibodies, including GPNMB (#38313), JAK1 (#3344), P–JAK1 (#3331), STAT1 (#14994), P–STAT1 (#9167), STAT3 (#9139), P–STAT3 (#9145), P–Tyr-100 (#9411), Flag–Tag (#1685), HA–Tag (#3724) from Cell Signaling Technology; monoclonal anti-phosphotyrosine antibody (#A1806, mouse; #SAB5600274, rabbit) from MERCK–Sigma–Aldrich; monoclonal anti-Flag–M2 (#F1804); and β-actin antibody (#AC026) from ABclonal. Proteins on the membranes were visualized using a Western blot (WB) system (VILBER BIO IMAGING, China).

[0085] 3) Specific steps of immunohistochemical (IHC) experiment:

[0086] First, tumor tissue was embedded in a suitable medium, sectioned using precise techniques, and then dewaxed and dehydrated. The sections were then placed in citrate buffer or EDTA antigen retrieval solution to restore the antigen. Subsequently, the samples were blocked with goat serum at room temperature for 30 min. Following this, they were incubated with specific primary antibodies, including STAT1 (#14994), P–STAT1 (#9167), STAT3 (#9139), P–STAT3 (#9145) from Cell Signaling Technology, GPNMB (AF2550-SP) from R&D Systems, and Ki67 (ab279653) from Abcam, overnight at 4°C and then warmed to 37°C for 2 h. The sections were then incubated with secondary antibodies at 37°C for 1 h. After three washes with PBS, the samples were stained with DAB (ZLI-9018, ZSGB-BIO, China). Cell nuclei were counterstained with hematoxylin. Finally, the samples were digested with hydrochloric acid and alcohol. Finally, the samples were embedded in neutral resin and dried in a constant-temperature oven. Images were acquired using a pathological slide scanner.

[0087] 2. Experimental Results

[0088] This invention first analyzed four publicly available glioma bulk RNA–seq datasets (TCGA_GBMLGG, CGGA, Rembrandt, and Gravendeel (https: / / gliovis.bioinfo.cnio.es / )) using the aforementioned multi-database method. The intersection of genes significantly upregulated in GBM (Fold Change > 1.5, P < 0.01) yielded 338 candidate genes. Figure 1 (See Table A). Subsequently, this invention performed 4D-label-free LC-MS / MS proteomics analysis on 12 freshly resected glioma samples (6 GBM and 6 LGG in Table 1) to verify differences at the protein level. The results showed 907 significantly different proteins (P < 0.05), of which 696 were upregulated in GBM (Fold Change > 1.5) and 293 were downregulated (Fold Change < 2 / 3). Figure 2 Datasets A and 1). Survival analysis using the top 50 upregulated genes predicted poor prognosis, while the top 50 downregulated genes predicted better survival outcomes. Figure 2 China B and Figure 2The presence of C in the middle of the spectrum is consistent with the higher malignancy of GBM. Gene set enrichment analysis (GSEA) [1] The results showed that GBM significantly enriched genes associated with epithelial-mesenchymal transition (EMT) and GBM mesenchymal subtypes. Figure 2 China D and Figure 2 Next, this invention intersected 338 candidate transcriptome genes, 696 upregulated proteins, and genes annotated under the plasma membrane (GO:0005886) and transmembrane (KW_0812) categories, ultimately identifying 14 transmembrane receptors upregulated in GBM compared to LGG. Figure 1 (B and C). Among them, GPNMB showed the strongest prognostic significance in the TCGA_GBM queue ( Figure 1 C, Figure 2 China F and Figure 2 (G). In the proteomic data of this invention, GPNMB ranked second in fold change, second only to PROM1, while the latter had no significant prognostic effect (G). Figure 1 (C and D). Therefore, this invention focuses on GPNMB. Western blot analysis of fresh glioma tissues (4 grade 2, 5 grade 3, and 6 grade 4) showed that GPNMB was detectable in some grade 2 and 3 gliomas, while it was persistently elevated in all grade 4 tumors. Figure 1 Immunohistochemistry (IHC) on glioma tissue microarrays (n = 169) further validated strong GPNMB protein signaling in GBM, while the staining was weaker in low-grade gliomas. Figure 1 (F and G). Kaplan–Meier survival analysis showed that high GPNMB expression was associated with significantly shortened overall survival (F and G). Figure 1 To investigate the mechanism of GPNMB upregulation in GBM, this invention analyzed its genomic and epigenetic alterations. GPNMB is located on chromosome 7, a region commonly amplified in gliomas. TCGA_GBMLGG data showed significant GPNMB amplification in GBM compared to LGG. Figure 2 H and Figure 2 (I), and amplification is positively correlated with transcription level ( Figure 1 Furthermore, regardless of 1p / 19q status, IDH wild-type gliomas showed higher expression levels than IDH mutant gliomas. Figure 1(I). In the TCGA_GBM cohort, GPNMB expression was higher in tumors with gene amplification, non-G-CIMP phenotype, and stromal subtype, but lower in anterior neural or classic subtypes. Figure 1 (J). This invention further evaluated DNA methylation levels. Three CpG probes (cg02203656, cg08455073, cg17274742) located near the promoter region and the start codon (ATG) of exon 1; Figure 2 J and K were negatively correlated with GPNMB expression, compared to LGG, and were significantly hypomethylated in GBM. Figure 2 (Middle L and M). Decreased methylation at these sites has also predicted poor prognosis in multiple glioma cohorts ( Figure 2 (N–P). In summary, transcriptomic, proteomic, and epigenetic analyses collectively indicate that GPNMB is a highly upregulated transmembrane receptor in GBM, and its high expression is associated with copy number amplification, promoter hypomethylation, and poor prognosis.

[0089] Example 2. Correlation between GPNMB and the malignancy of gliomas

[0090] 1. Experimental Materials and Methods

[0091] 1) Microbial strains and animals:

[0092] Human GBM cell lines (A172, DBTRG-05MG, LN-18, LN-229, U-87, U-251, T98G), mouse GBM cell lines (GL261, CT2A), and human embryonic kidney cell line (293T) were purchased from the American Type Culture Collection (ATCC). All cell lines underwent short tandem repeat (STR) analysis by Wuhan Gene Creation Biotechnology Co., Ltd. to ensure reliability and prevent cross-contamination or cell identification errors. Primary GBM cells (091214, 090116) were provided by the Department of Pathology, Southwest Hospital, Army Medical University, Chongqing, China.

[0093] Both C57BL / 6J mice and NCG mice were purchased from Cyagen Biosciences Co., Ltd.

[0094] 2) Specific steps for cell construction:

[0095] Lentiviral vectors, including control vectors, vectors overexpressing GPNMB, small hairpin RNA (shRNA) targeting GPNMB, and negative control shRNA, were all purchased from Hanheng Biotechnology Co., Ltd. GBM cells were infected with lentiviruses for two consecutive days in the presence of polybrene (10 µg / mL), and then selected with puromycin (2 µg / mL) or blastomycin (20 µg / mL) to establish stable cell lines.

[0096] 3) Specific steps of the EdU incorporation experiment:

[0097] The effect of GPNMB on GBM cell proliferation was assessed using the BeyoClicklot Cell Proliferation Detection Kit (containing Alexa Fluor 594, Beyotime, China). In short, 2 × 10⁶ cells were used... 4 Cells were seeded in 24-well plates (triple replicates per group). After overnight culture and recovery to normal conditions, subsequent experiments were performed. Cells were incubated with 10 µM EdU at 37°C for 2 h, fixed with 4% paraformaldehyde for 30 min, and permeabilized with 0.1% Triton X-100 for 10 min. After washing with PBS, cells were stained with EdU-Alexa Fluor 594 for 30 min and counterstained with Hoechst 33342 for 20 min. EdU-positive cells were observed and quantified under a fluorescence microscope.

[0098] 4) Specific steps of the invasion experiment:

[0099] For invasion assays, Transwell chambers were pre-coated with Matrigel (BD Pharmingen). GBM cells (10 5 Cells were seeded in serum-free medium in the upper chamber and medium containing 10% FBS in the lower chamber. After incubation for 24 h, cells were fixed with 4% paraformaldehyde for 15 min, stained with crystal violet for 5–10 min, and photographed under a microscope (Leica). Five fields of view were randomly selected from each chamber for observation.

[0100] 5) The specific steps of Western blot are the same as step 2 of the experimental materials and methods in Example 1.

[0101] 6) Specific steps of the clone formation experiment:

[0102] For the colony formation assay, GBM cells were seeded in six-well plates (2,000 cells per well). After two weeks of culture, the cells were washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, and stained with crystal violet for 5–10 min. The number of colonies was then counted.

[0103] 7) Specific steps of the stem cell spheroidization experiment:

[0104] For the stem cell spheroid formation assay, glioblastoma stem cells were suspended in serum-free DMEM / F12 medium containing 1×B27, epidermal growth factor (20 ng / mL), and basic fibroblast growth factor (20 ng / mL). Cells (2,000 cells per well) were seeded in ultra-low adsorption six-well plates and cultured for one week. The number and size of spheroids were assessed using a microscope.

[0105] 8) Specific steps for constructing an in situ transplantation model:

[0106] First, 5 × 10⁵ cells containing luciferase expression were placed in the container. 4 GL261 cells (shCTRL and shGPNMB) / U251 cells (EV and GPNMB) were suspended in 10 μL PBS and transplanted into the right frontal lobe of 6-week-old C57 mice. Tumor growth was monitored by bioluminescence imaging using an in vivo imaging system (IVIS) spectrometer. At the end of the experiment, all mice were euthanized and their brains were extracted for hematoxylin-eosin (H&E) staining and immunohistochemical (IHC) analysis.

[0107] 9) Specific steps for hematoxylin-eosin (H&E) staining:

[0108] For hematoxylin-eosin (H&E) staining, orthotopic tumors from mice were collected, fixed with 4% paraformaldehyde for 24 h, embedded in paraffin, and sectioned to a thickness of 4 μm. After dewaxing and rehydration, the sections were stained with hematoxylin and eosin sequentially. Images were acquired using a digital pathology scanner.

[0109] 10) The specific steps of the immunohistochemical experiment are the same as step 3 of the experimental materials and methods in Example 1.

[0110] 2. Experimental Results

[0111] This invention first used Western blot to detect its basal expression levels in a series of human and mouse GBM cell lines. Figure 4This further clarifies the role of GPNMB in GBM. Subsequently, this invention constructed stable GPNMB overexpressing cell lines in U251 and LN229 cells, and established GPNMB knockdown cell lines in U251, A172, and the mouse GBM cell line GL261. Figure 4 (B–E). This invention first assesses cell proliferation through an EdU incorporation experiment. The results showed that the proportion of EdU-positive proliferating cells in GPNMB-overexpressing cells was significantly higher than that in the low-expression control group (B–E). Figure 3 China A and Figure 4 (F). Meanwhile, the Transwell invasion assay with matrix gel coating showed that forced expression of GPNMB significantly enhanced invasive ability, while its knockdown inhibited cell invasion. Figure 3 China B and Figure 4 Similarly, clonogenic assays showed that GPNMB promoted dependent growth, further supporting its pro-tumorigenic effect. Figure 4 (H). Given the crucial role of tumor stem cells in glioma invasiveness, this invention further employs suspension culture to enrich stem cell populations. Under these conditions, GPNMB overexpression significantly enhanced spheroid formation efficiency, while knockdown significantly reduced this ability. Figure 4 These results suggest that GPNMB helps maintain the stem-like properties of GBM cells. Subsequently, this invention evaluated the tumorigenic effect of GPNMB using an orthotopic transplantation model. Intracranial injection of U251 cells stably overexpressing GPNMB into NCG mice significantly accelerated tumor growth compared to the control group. Figure 3 (C). Consistent results were obtained when experiments were conducted in C57BL / 6J mice using the mouse-derived GBM cell line GL261, further validating the tumorigenicity of GPNMB. Figure 3 (D). Histological analysis of brain tissue from tumor-bearing mice showed that the tumor volume in the GPNMB overexpression group was significantly larger than that in the low expression group, which was also confirmed by hematoxylin-eosin (H&E) staining results. Figure 3 Furthermore, immunohistochemical analysis of Ki-67 showed that proliferative activity was significantly enhanced in tumors with high GPNMB expression. Figure 3 (F). In summary, these results indicate that GPNMB possesses potent tumorigenic function in GBM and serves as a significant driver of malignant progression in gliomas.

[0112] Example 3. GPNMB significantly activates the interferon signaling pathway in GBM cells.

[0113] 1. Experimental methods and procedures

[0114] 1) Specific steps of label-free quantitative mass spectrometry analysis:

[0115] Detection of human glioma, GBM cell, and CO-IP samples was performed by PTM BIO LLC. Samples were first ground into cell powder using liquid nitrogen and then transferred to a 5 mL centrifuge tube. Four volumes of lysis buffer (8 M urea, 1% protease inhibitor mixture) were then added to the cell sample, followed by sonication on ice using a high-intensity sonicator (Scientz) for 3 min. Residue was removed by centrifugation at 12,000 g for 10 min (4 °C). The supernatant was collected, and protein concentration was determined using the BCA kit according to the manufacturer's instructions. The sample was then slowly added to trichloroacetic acid (TCA) to a final concentration of 20% (m / v) to precipitate proteins, followed by vortexing and incubation at 4 °C for 2 h. The precipitate was collected by centrifugation at 4,500 g for 5 min at 4 °C. The precipitated proteins were washed with 200 mM TEAB and sonicated for dispersion. For the first digestion, trypsin was added at a 1:50 trypsin-to-protein mass ratio and digestion was performed overnight. The sample was reduced with 5 mM dithiothreitol (DTT) at 37°C for 60 min and alkylated with 11 mM iodoacetamide at room temperature in the dark for 45 min. Finally, the peptides were desalted using a Strata X solid-phase extraction (SPE) column. For biomaterial-based phosphorylation PTM concentration, the peptide mixture was first incubated with a suspension of IMAC microspheres in a loading buffer (50% acetonitrile / 0.5% acetic acid) by shaking. To remove non-specifically adsorbed peptides, the IMAC microspheres were washed sequentially with 50% acetonitrile / 0.5% acetic acid and 30% acetonitrile / 0.1% trifluoroacetic acid. To elute the enriched phosphopeptides, an elution buffer containing 10% ammonia was added, and the enriched phosphopeptides were eluted by shaking. The supernatant containing phosphopeptides was collected and lyophilized for LC–MS / MS analysis.

[0116] 2) Specific steps of GO / GSEA enrichment analysis:

[0117] Based on the raw files obtained from mass spectrometry detection, 2–1) a sample-specific protein database was constructed according to the sample source, and then the database was searched using analysis software; 2–2) quality control analysis of peptide and protein levels was performed based on the database search results; 2–3) quantitative analysis of proteins was performed, including quantitative distribution and repeatability analysis, and the distribution results of sample quantitative intensity values ​​were displayed; 2–4) common functional annotations were performed on the identified proteins, including GO, KEGG, Proteindomain, COG / KOG, STRING database, Reactome, WikiPathways, HallMark, and transcription factor (TF) annotations, etc., among which Reactome, WikiPathways, HallMark, and transcription factors only provide relevant bioinformatics analysis for some species; 2–5) based on the quantitative results, the fold change (FC) and T-test significance p-value between the two groups were calculated, and the differences were screened according to the set threshold. Statistical graphs related to the difference analysis were plotted. If the sample has three or more groups, one-way ANOVA was also provided. Calculate the significance P-values ​​for multiple groups, and screen differentially expressed proteins among the groups for subsequent correlation analysis based on ANOVA P-values; 2–6) Perform functional classification statistical analysis on differentially expressed proteins between the two groups, including GO secondary classification, subcellular localization classification, COG / KOG classification, and KEGG pathway classification statistics; 2–7) Perform enrichment analysis on differentially expressed proteins between the two groups using Fisher's exact test, involving functions such as GO, KEGG, protein domain, reactorome, and Wikipathways; 2–8) When the project has multiple experimental groups, compare the functional relationships of differentially expressed proteins under different experimental conditions through enrichment cluster analysis; 2–9) Screen key regulatory proteins under specific experimental conditions through protein-protein interaction (PPI) network analysis.

[0118] 2. Experimental Results

[0119] To elucidate the potential molecular mechanism by which GPNMB promotes GBM progression, this invention performed label-free quantitative mass spectrometry analysis on constructed GPNMB-overexpressing (U251 / GPN) or knockdown (U251 / shGP) U251 cells and their corresponding control groups (U251 / EV and U251 / shCL). Principal component analysis (PCA) showed that the three biological replicates within each experimental group exhibited good clustering and high reproducibility, thus verifying the reliability of the proteomics data. Figure 6 (A). Proteomics analysis revealed changes in the abundance of numerous proteins following GPNMB regulation. In U251 / GPN cells, compared to U251 / EV cells, 147 proteins were significantly upregulated (P < 0.05, fold change > 2), while 82 proteins were significantly downregulated (P < 0.05, fold change < 0.5). Figure 6 (B) In U251 / shGP cells, compared to U251 / shCL cells, 106 proteins were upregulated and 142 proteins were downregulated. Figure 6 (C). GO biological processes (GOBP) and KEGG pathway annotation of these differentially expressed proteins revealed significant enrichment in immune-related biological processes. Figure 6 (D–G). To further pinpoint robust downstream targets of GPNMB, this invention takes the intersection of upregulated proteins in U251 / GPN cells and downregulated proteins in U251 / shGP cells, obtaining 81 overlapping proteins (D–G). Figure 5 (A). GOBP enrichment analysis of this dataset subsequently revealed that GPNMB is closely associated with immune-related pathways, with interferon (IFN) signaling identified as a key downstream pathway. Supporting this finding, this invention screened a series of IFN-stimulated genes from proteomics data and validated them using real-time PCR, finding that these transcripts were significantly downregulated in U251 / shGP cells compared to U251 / shCL cells. Figure 5 (See section B). To further investigate pathway-level changes, this invention performed GSEA analysis on the HALLMARK gene set. Compared with U251 / EV cells, U251 / GPN cells were significantly enriched with 11 gene sets, while compared with U251 / shGP cells, U251 / shCL cells were significantly enriched with 8 gene sets (P < 0.05, FDR < 25%). Notably, there was overlap of 6 gene sets between the two groups, including 3 IFN-related pathways (…). Figure 5C and E) further support the link between GPNMB and IFN signaling regulation. Finally, to extend these findings to clinical samples, this invention analyzed three large-scale glioma cohorts: TCGA_GBMLGG, TCGA_GBM, and CGGA. In all three cohorts, tumors with high GPNMB expression were significantly enriched in IFN-related pathways compared to tumors with low expression. Figure 5 F). Integrating proteomics and clinical data, a total of 71 shared GOBP gene sets were identified, among which multiple IFN-related pathways were repeatedly detected. Figure 5 (G). In summary, multilevel analyses from cell models to patient cohorts consistently demonstrate that GPNMB can regulate IFN-related signaling pathways in GBM.

[0120] Example 4. GPNMB promotes the activation of STAT proteins in GBM cells.

[0121] 1. Experimental methods and procedures

[0122] 1) Specific steps for quantitative phosphorylated proteomics analysis:

[0123] Samples were removed from -80℃, and each group of samples was added with 4 volumes of lysis buffer (8 M urea, 1% protease inhibitor, 1% phosphatase inhibitor) and sonicated for lysis. After centrifugation at 12,000 g for 10 min at 4℃, cell debris was removed, and the supernatant was transferred to a new centrifuge tube for protein concentration determination using a BCA kit. Equal volumes of protein from each sample were digested, and the volume was adjusted to be consistent with lysis buffer. A final concentration of 20% TCA was slowly added, vortexed, and incubated at 4℃ for 2 h. After centrifugation at 4,500 g for 5 min, the supernatant was discarded, and the precipitate was washed 2–3 times with pre-cooled acetone. The precipitate was dried, and a final concentration of 200 mM TEAB was added. The precipitate was sonicated, and trypsin was added at a 1:50 ratio (protease:protein, m / m), and digested overnight. Dithiothreitol (DTT) was added to a final concentration of 5 mM, and the mixture was reduced at 37℃ for 60 min. Iodoacetamide (IAA) was then added to a final concentration of 11 mM, and the mixture was incubated at room temperature in the dark for 45 min. The peptides were dissolved in enrichment buffer (50% acetonitrile / 0.5% acetic acid), and the supernatant was transferred to pre-washed IMAC material. The material was then incubated on a rotary shaker with gentle shaking. After incubation, the material was washed three times sequentially with buffer solutions of 50% acetonitrile / 0.5% acetic acid and 30% acetonitrile / 0.1% trifluoroacetic acid. Finally, the phosphopeptides were eluted with 10% ammonia, and the eluent was collected and freeze-dried under vacuum. After drying, the eluent was desalted according to the C18 ZipTips manual, freeze-dried under vacuum, and then used for LC-MS analysis.

[0124] 2) Specific steps for cytokine treatment of cells:

[0125] IFNα / IFNγ cytokines were purchased from Beijing Sinocare Medical Technology Co., Ltd. 100 µg of cytokines was dissolved in 1 mL of PBS buffer to a final concentration of 100 µg / mL, and aliquoted into 200 µL tubes and frozen at –80℃. After GBM cells reached 80% confluence, they were cultured overnight in serum-free medium for 12 h. Cytokines were then added to the medium (working concentration 100 ng / mL) and treated for the appropriate time before protein collection.

[0126] 3) The specific steps of Western blot are the same as step 2 of the experimental materials and methods in Example 1.

[0127] 4) The specific steps of immunohistochemical analysis are the same as step 3 of the experimental materials and methods in Example 1.

[0128] 2. Experimental Results

[0129] To further elucidate the mechanistic link between GPNMB and the IFN signaling pathway, this invention performed quantitative phosphorylated proteomics analysis in U251 / shGP and U251 / shCL cells. Analysis was conducted on significantly altered phosphorylated proteins. Figure 8 In datasets A and 3, it was found that the phosphorylation level of STAT3 at tyrosine 705 (STAT3–Y705) was significantly reduced, and this site is a classic marker of STAT3 activation. Since downstream target genes of IFN are mainly regulated by the STAT transcription factor family, and STAT3 has a clear oncogenic effect in GBM cells, this invention hypothesizes that GPNMB may exert its function at least partially by regulating STAT3 activity. Consistent with this hypothesis, in a stable GBM cell model, overexpression of GPNMB significantly enhanced phosphorylation of STAT3–Y705, while knockdown of GPNMB significantly weakened phosphorylation of STAT3–Y705. Figure 7 (A). To further evaluate the responsiveness of this pathway to cytokine stimulation, cells were treated with IFNα and IFNγ, both of which can activate STAT3. The results showed that cytokine-induced STAT3–Y705 phosphorylation was further enhanced with GPNMB overexpression, but significantly weakened with GPNMB knockdown. Figure 7 (B and C). This result was also verified in LN229 cells overexpressing GPNMB. Figure 8(See section B). Next, this invention explores the clinical relevance of the interaction between GPNMB and STAT3. In three independent glioma datasets, high expression of both GPNMB and STAT3 was associated with significantly shortened patient survival, while low expression of both was associated with better survival. Figure 7 (D). Considering the functional interaction between STAT3 and STAT1, this invention used Western blot to detect the effect of GPNMB on STAT1 phosphorylation at tyrosine 701 (STAT1–Y701). The results showed that upregulation of GPNMB enhanced IFN-induced STAT1–Y701 phosphorylation, while knockdown of GPNMB inhibited this process. Figure 8 (C and D). More importantly, in the orthotopic xenograft model, STAT3–Y705 (C and D) was found in tumor tissue formed by GL261 / shGP cells. Figure 7 (E and F) and STAT1–Y701 ( Figure 8 The phosphorylation levels of STAT3 and STAT1 were significantly reduced in the GL261 / shCL control group, while they remained at higher levels. In summary, this study reveals that GPNMB, by regulating the phosphorylation of STAT3 and STAT1, can serve as a key mechanistic bridge connecting the IFN pathway under both basal and cytokine-stimulated conditions.

[0130] Example 5. GPNMB activates the IFN signaling pathway in GBM cells through interaction with JAK1.

[0131] 1. Experimental methods and procedures

[0132] 1) Specific steps for cell transfection:

[0133] After the 293T / GBM cells reached an appropriate density, replace 5 mL of serum-free medium. Gently mix 20 µL of lipo2000 / lipo3000 with the required plasmid in the serum-free medium, let stand for 15 min, then add the medium. Incubate at 37℃ and 5% CO2 for 6 h, then replace with 10 mL of serum-free medium and continue culturing for 48 h. Subsequently, perform co-immunoprecipitation (Co-IP) experiments.

[0134] 2) Specific steps of the co-immunoprecipitation (Co-IP) experiment:

[0135] For co-immunoprecipitation (Co-IP) experiments, cells (293T / GBM cells) were transfected with two different tagged plasmids for 48 h, and then lysed using NP40 lysis buffer (Beyotime, China) containing protease inhibitors. After centrifugation at 15,000 rpm for 15 min at 4 °C, the samples were first pre-cleaned with protein A / G magnetic beads for 1 h, and the supernatant was collected and incubated overnight at 4 °C with the corresponding tagged magnetic beads (Beyotime, China). After washing and incubation three times, the samples were resuspended in 1×SDS loading buffer, denatured by heating, and then analyzed by Western blot.

[0136] 3) Specific steps for constructing the GPNMB–Y525F mutant plasmid:

[0137] Site-directed mutagenesis of GPNMB at tyrosine 525 (Y525F) was performed using the Mut Express Universal Rapid Mutagenesis Kit (Vazyme, C216–01, Nanjing, China). Mutagenic primers were designed according to the manufacturer's guidelines, and the mutagenesis procedure was strictly followed in accordance with the kit's operating instructions. The designed sequence is as follows:

[0138] name SEQ NO. Sequences(5'→3') GPNMB–Fc2–F 1 ACAAGGAATTCAACCCAATAGAAAATAGTCCTGGGAA GPNMB–Fc2–R 2 ATTGGGTTGAATTCCTTGTGTTTTTTGTACACCAAGA

[0139] 4) The specific steps of Western blot are the same as step 2 of the experimental materials and methods in Example 1.

[0140] 5) Specific steps of immunofluorescence assay (IF):

[0141] 5×10 4 Cells were seeded in confocal microplates and cultured overnight. After reaching normal cell condition, subsequent experiments were performed. Cells were washed twice with PBS and then fixed with 4% paraformaldehyde for 10–15 min at room temperature. They were then washed twice with PBS and blocked with a PBS mixture containing 0.3% Triton X-100 and 5% BSA at room temperature for 1–2 h. Samples were incubated overnight at 4°C with primary antibody (Flag-Tag: #14793, Cell Signaling Technology; HA-Tag: #3724, Cell Signaling Technology). After washing three times with PBS, cells were incubated at room temperature with anti-rabbit / anti-mouse secondary antibody (Thermo Fisher Scientific, USA) for 2 h. Cells were then exposed to a DAPI-containing anti-fluorescence quenching mounting medium (Beyotime, China) for 15 min. Fluorescence images were acquired using a confocal microscope (Zeiss, Germany).

[0142] 6) Specific steps for structural modeling:

[0143] To predict potential protein-protein interaction structures, we used AlphaFold3 to accurately predict the structures of biomolecular interactions. The amino acid sequences of the target proteins were obtained from the UniProt database (https: / / www.uniprot.org / ) and saved in FASTA format. Structure prediction was performed using a publicly available implementation of AlphaFold3. For each protein complex, at least five independent models were generated and ranked according to the following confidence metrics: pLDDT (predicted local distance difference test): assessing the confidence of local structures; PAE (predicted alignment error): assessing the accuracy of relative positions across domains and interfaces; IpTM (interface prediction template modeling score): assessing the confidence of predicted interaction interfaces. The predicted structures were analyzed and visualized using the Protein Viewer extension in Visual Studio Code. The structural interfaces, including potential hydrogen bonds and hydrophobic interactions, were directly examined in the visualization environment. Among all predicted models, the model with the highest combined ipTM+pTM score was selected for subsequent analysis and annotation.

[0144] 7) Specific steps of in vitro kinase experiments:

[0145] IP assays were performed after transient plasmid transfection. Samples were resuspended in 40 µL of 1×kinase buffer and supplemented with 200 µM ATP and substrate. The mixture was incubated at 30 °C for 30 min, followed by termination of the reaction with 20 µL of 3×SDS sample buffer. After brief vortexing, the mixture was centrifuged for 30 s. Samples were then denatured by heating in a 95 °C metal bath for 5 min and finally analyzed by Western blot.

[0146] 2. Experimental Results

[0147] This invention performed GPNMB interactome analysis in U251 / GPN and LN229 / GPN cells. In four independent co-immunoprecipitation (Co-IP) experiments, a total of 241 stably binding proteins were identified. Figure 9 (A). After eliminating non-specifically binding IgG-related proteins, this invention defines a GPNMB-specific interactome consisting of 119 proteins ( Figure 9 Functional annotation of these proteins showed that they were enriched in glycosyl modification pathways, consistent with the glycoprotein nature of GPNMB, and also significantly enriched in IFN signaling, innate immunity, and stress response-related categories. Figure 9(See section B). Notably, among these proteins, this invention identified JAK1, a key regulator of the IFN-STAT signaling pathway. Further Co-IP experiments in 293T cells validated the interaction between GPNMB and JAK1. Figure 9 (C), while immunofluorescence experiments in T98G cells confirmed the co-localization of the two (C). Figure 9 China D and Figure 10 Structural modeling further suggests that the intracellular domains of GPNMB mediate its binding to JAK1. Figure 5 (E). The cytoplasmic tail of GPNMB contains a highly conserved YXXI motif (Y, tyrosine; X, any amino acid; I, isoleucine), which is considered to be the hemiimmune receptor tyrosine activation motif (hemITAM). [3, 4] This motif has been shown to be associated with tumorigenicity and stemness induction in bladder and breast cancer. [5-7] Similar to classic ITAM, hemITAM signaling depends on the phosphorylation of tyrosine residues and is typically mediated by Src family kinases. [8, 9] Based on this, the present invention hypothesizes that phosphorylation of GPNMB on hemITAM may provide a docking site for STAT activation. Consistent with this hypothesis, the present invention detects tyrosine phosphorylation of GPNMB ( Figure 10 (B) and observed the direct interaction between GPNMB and STAT1 / STAT3 ( Figure 9 This result is further supported by structural modeling (F). Figure 10 (C and D). Cross-species sequence alignment showed that tyrosine 525 (Y525) in this motif is highly evolutionarily conserved. Figure 10 The presence of phenylalanine (Y525F) in GPNMB highlights its functional importance. Mutating Y525 to phenylalanine (Y525F) significantly reduced the tyrosine phosphorylation level of GPNMB. Figure 10 (F). In vitro kinase assays further confirmed that JAK1 can phosphorylate GPNMB at the Y525 site (F). Figure 10 More importantly, the Y525F mutation significantly weakens the interaction between GPNMB and STAT1 and STAT3. Figure 5 (G and H). In summary, these findings paint a mechanistic model: GPNMB promotes the binding and activation of STAT proteins by interacting with JAK1 and providing an additional docking platform at its conserved intracellular Y525 site, thereby driving IFN signaling transduction in GBM cells.

[0148] Example 6. Inhibiting tumor growth in vivo by targeting GPNMB with antibodies.

[0149] 1. Experimental methods and procedures

[0150] 1) The specific steps for cell transfection are the same as step 1 of the experimental materials and methods in Example 5.

[0151] 2) The specific steps of the co-immunoprecipitation (Co-IP) experiment are the same as step 2 of the experimental materials and methods in Example 5.

[0152] 3) The specific steps of Western blot are the same as step 2 of the experimental materials and methods in Example 1.

[0153] 4) Specific steps for obtaining GPNMB–ECD protein:

[0154] This experiment utilizes the pFUSE–hIgG1–Fc2 vector, which is widely used in biological research to facilitate the expression and secretion of fusion proteins. As a control, the empty Fc2 plasmid is also used in this invention. The designed sequence is as follows:

[0155] name SEQ NO. Sequences(5'→3') GPNMB–Fc2–F 3 AAGTCTTGCACTTGTCACGAATTCCAAACGATTTCATGATGTGCTGG GPNMB–Fc2–R 4 GAGTTTTGTCAGATCTAACCATGGCGCCTCCGTTTTGCCATCCTTAAAGGCG

[0156] The Fc2–GPN expression plasmid, containing the extracellular region of GPNMB, was obtained by double digestion of the vector with EcoRI and NcoI. This plasmid and the empty Fc2 vector were then transfected into 293T cells. To promote effective secretion of the target protein, the transfected cells were cultured under serum-free conditions. After 48 h, the culture supernatant was collected, and Western blot analysis was performed using anti-human IgG–Fc (HRP-labeled goat antibody) to confirm the correct expression and secretion of the target protein. After confirming the detection results, the culture supernatant of 293T–Fc2 and 293T–GPNMB–Fc2 cells cultured under serum-free conditions was collected. The target proteins (Fc2 and Fc2–GPN) were then concentrated and purified from the culture medium using ultrafiltration. Finally, the purified protein samples were stored at -20°C for subsequent cell processing.

[0157] 5) Specific steps of the transfer experiment:

[0158] For migration experiments, transfected cells (1×10⁻⁶) 5 Cells were seeded in serum-free medium in the upper chamber and medium containing 10% FBS in the lower chamber. After incubation for 24 h, cells were fixed with 4% paraformaldehyde for 15 min, stained with crystal violet for 5–10 min, and photographed under a microscope (Leica). Five fields of view were randomly selected from each chamber for observation.

[0159] 6) Specific steps of the Glembatumumab treatment regimen:

[0160] Glembatumumab (Synonyms) was purchased from MedChemExpress (MCE). 5 mg of Glembatumumab was dissolved in 10 mL of PBS buffer to a final concentration of 0.5 mg / mL. One aliquot of 1 mL solution were then stored at –80°C. One week after tumor implantation, each mouse was weighed at approximately 20 µg. Tumor growth was monitored by bioluminescence imaging following two weekly intraperitoneal injections of 100 µg of Glembatumumab.

[0161] 7) The specific steps of the clone formation experiment are the same as step 6 of the experimental materials and methods in Example 2.

[0162] 8) The specific steps for constructing the in situ transplantation model are the same as step 8 of the experimental materials and methods in Example 2.

[0163] 2. Experimental Results

[0164] Since GPNMB is a membrane receptor, and dimerization is a recognized characteristic of receptor activation, this invention first investigated whether GPNMB dimerizes. To this end, GPNMB with both Flag and HA tags was co-expressed, and Co-IP experiments were performed. The results confirmed that GPNMB can indeed form dimers. Figure 11 Interestingly, when wild-type and mutant GPNMB were co-expressed, the degree of dimerization was significantly reduced, suggesting that JAK1 phosphorylation of GPNMB may promote its dimerization. Figure 11 Based on this observation, this invention hypothesizes that disrupting GPNMB dimerization may inhibit its function. To verify this hypothesis, this invention constructs a fusion protein of the GPNMB extracellular domain and the Fc fragment ( ). Figure 12 A). After cell treatment, this construct was found to inhibit STAT3 phosphorylation ( Figure 12 (B and C). Furthermore, both Transwell migration and colony formation assays showed that GPNMB–Fc significantly reduced the migration and proliferation abilities of GBM cells. Figure 12 (D and E). In an orthotopic transplantation mouse GBM model, this invention further evaluated the therapeutic potential of the humanized monoclonal antibody Glembatumumab targeting GPNMB. Notably, Glembatumumab treatment induced potent antitumor activity and significantly inhibited the in vivo growth of GBM cells (D and E). Figure 11Therefore, GPNMB may be a potential target for GBM treatment, especially when the GPNMB–JAK–STAT axis is overactivated. This invention identifies GPNMB as a previously unrecognized upstream regulator of the JAK–STAT pathway in GBM. The findings of this invention emphasize that JAK1-mediated phosphorylation at GPNMB–Y525 provides a docking platform for STAT proteins, thereby promoting the activation of STAT as a transcription factor and driving the transcription of genes associated with GBM progression. Figure 11 These results reveal a new dimension of GBM biology and suggest that the GPNMB–JAK–STAT axis is a promising therapeutic direction.

[0165] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of glycoprotein nonmetastatic melanoma protein B (GPNMB) in the preparation of drugs for the diagnosis or treatment of gliomas.

2. The use as described in claim 1, wherein the glioma is a highly active glioma.

3. The use as described in claim 1 or 2, comprising detecting the expression level of GPNMB in a sample by means of an antibody that specifically binds to GPNMB.

4. The use as described in claim 3, wherein, The antibody is a monoclonal antibody that specifically binds to GPNMB; preferably Glembatumumab.

5. A diagnostic kit for diagnosing glioma, comprising reagents for detecting GPNMB expression levels in a sample.

6. The diagnostic kit of claim 5, wherein the kit comprises an antibody targeting GPNMB; preferably, the antibody is a polyclonal antibody or a monoclonal antibody.

7. The diagnostic kit of claim 6, wherein the antibody is Glembatumumab.

8. A pharmaceutical composition for treating glioma, comprising an antibody targeting GPNMB and pharmaceutically acceptable excipients.

9. The pharmaceutical composition of claim 8, wherein, The antibody is Glembatumumab.