Recombinant escherichia coli for efficiently preparing high-purity sialyllactose-n-tetrasaccharide a, and preparation method and application thereof

Abstract

The application provides a construction method and application of recombinant escherichia coli for efficiently preparing high-purity sialyllactose-N-tetraose a. The application precisely integrates genes encoding beta-1,3-N-acetylglucosamine glycosyltransferase, beta-1,3-galactosyltransferase and alpha-2,3-sialic acid glycosyltransferase in the genome of escherichia coli BL21 (DE3), knocks out endogenous competitive metabolic genes, and optimizes the metabolic pathways of precursor substances UDP-acetylglucosamine, UDP-galactose and CMP-N-acetylneuraminic acid, effectively reduces the generation of non-target byproducts including lactose-N-triose, lactose-N-tetraose and 3'-sialyllactose, and successfully constructs a recombinant chassis strain capable of efficiently producing high-purity sialyllactose-N-tetraose a. Fermentation culture of the constructed engineering bacteria can efficiently prepare high-purity sialyllactose-N-tetraose a under the premise of guaranteeing biosafety, and is suitable for the production demand in the food field.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant Escherichia coli for the efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a, its preparation method, and its application. Background Technology

[0002] Human milk oligosaccharides (HMOs) are the third largest solid component in breast milk after lactose and lipids, and are key bioactive molecules supporting gut microbiota homeostasis, immune system maturation, and nervous system development in infants. Sialized HMOs contain sialic acid residues at their terminals, a structure similar to the sialic acid structure of gangliosides and glycoproteins in the brain's nervous system, thus possessing biological functions that promote infant cognitive development and immune system maturation. Among them, sialylactose-N-tetrasaccharide a (LST-a) is a typical sialylated HMO obtained by modifying lactose-N-tetrasaccharide with α-2,3-sialyltransferase. Its terminal α-2,3-sialic acid structure can mimic receptors for pathogens such as influenza viruses, blocking their adhesion and exerting an immunoprotective effect. Therefore, this molecule can serve as a model for studying the immune and neural mechanisms of sialylated HMOs and holds promise as a candidate ingredient for functional foods, precision nutrition, and brain health interventions.

[0003] However, the natural content of sialyllactose-N-tetrasaccharide a in breast milk is extremely low. Traditional chemical synthesis is cumbersome and costly, while enzymatic synthesis relies on expensive glyconucleotide substrates, making large-scale production difficult. Compared to traditional chemical or enzymatic synthesis, microbial synthesis is considered an ideal path for the industrial production of sialyllactose-N-tetrasaccharide a due to its low cost, high efficiency, and environmental friendliness. However, current engineered strains generally suffer from low catalytic activity of β-1,3-N-acetylglucosamine transferase and β-1,3-galactosyltransferase, leading to the accumulation of large amounts of intermediates lactose-N-trisaccharide and lactose-N-tetrasaccharide. Simultaneously, the low catalytic efficiency and poor substrate specificity of α-2,3-sialyltransferase result in the production of non-target products such as 3'-sialyllactose during catalysis, severely impacting the yield and purity of sialyllactose-N-tetrasaccharide a. Under current technological conditions, the fermentation yield of engineered strains is below 10 g / L, far below the requirements for industrial production. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a recombinant Escherichia coli for the efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a, along with its preparation method and applications.

[0005] The technical solution adopted in this invention is: a recombinant Escherichia coli for the efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a, using Escherichia coli BL21(DE3) as the chassis host, heterologously integrating the gene encoding β-1,3-N-acetylglucosamine transferase. NgolgtAGene encoding β-1,3-galactosyltransferase SenlgtB and the gene encoding α-2,3-sialic acid glycosyltransferase PdST .

[0006] Preferably, the gene encoding β-galactosidase in the chassis host genome is knocked out. lacZ (ID: 8181469), encoding UDP-N-acetylglucosamine 2-epimerase gene wecB (ID: 8182212), encoding the UDP-glucose dehydrogenase gene ugd (ID: 8182577), encoding glucosamine-6-phosphate deaminase gene nagB (ID: 8180191), encoding N-acetylneuraminic acid aldolase gene nanA (ID: 8180860), encoding N-acetylmmannosamine-6-phosphate 2-epimerase gene nanE (ID: 8180858), encoding N-acetylneuraminic acid permease gene nanT (ID: 8180859) and the gene encoding N-acetylmannosamine kinase. nanK One or more of (ID: 8180857).

[0007] Preferably, the gene encoding uridine diphosphate glucose 4-epimerase in the chassis host genome is overexpressed. galE (ID: 945354), encoding glucosamine-6-phosphate synthase gene glmS (ID:8183713), encoding the phosphoglucosamine mutase gene glmM (ID: 8179939), encoding UDP-N-acetylglucosamine pyrophosphorylase gene glmU (ID:8183714), encoding UDP-N-acetylglucosamine 2-epimerase gene neuC (ID: 4494209), encoding N-acetylneuraminic acid synthase gene neuB (ID: 4494211) and the gene encoding CMP-N-acetylneuraminic acid synthase. neuA One or more of (ID:4494210).

[0008] Preferably, the gene encoding β-1,3-N-acetylglucosamine transferase NgolgtA Derived from Neisseria gonorrhoeae ( Neisseria gonorrhoeae ), the gene encoding β-1,3-galactosyltransferase SenlgtB Derived from intestinal Salmonella ( Salmonella enterica The gene encoding α-2,3-sialic acid glycosyltransferase PdSTDerived from Pasteurella multocida ( Pasteurella dagmatis ).

[0009] Preferably, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase NgolgtA is shown in SEQ ID No. 1, the nucleotide sequence encoding β-1,3-galactosyltransferase SenlgtB is shown in SEQ ID No. 2, and the nucleotide sequence encoding α-2,3-sialic acid glycosyltransferase PdST is shown in SEQ ID No. 3.

[0010] A method for efficiently constructing high-purity recombinant Escherichia coli containing sialyl lactose-N-tetrasaccharide a is presented, employing a two-step homologous recombination approach for gene editing to achieve traceless knockout. Specifically, based on the chassis host Escherichia coli, the method involves knocking out... and lacZ and integrated at the corresponding sites. nanE Knockout NgolgtA and integrated at the corresponding sites. wecB Knockout SenlgtB and integrated at the corresponding sites. ugd - neuC - neuB Knockout neuA and nagB and integrated at the corresponding sites. nanK Knockout PdST and integrate at this site nanA Knockout galE and at this site in integration nanT - glmS - glmM Finally, recombinant Escherichia coli that efficiently prepares high-purity sialyl lactose-N-tetrasaccharide a was obtained.

[0011] A method for preparing sialyl lactose-N-tetrasaccharide a involves culturing and fermenting recombinant Escherichia coli to obtain high-purity sialyl lactose-N-tetrasaccharide a.

[0012] Preferably, glycerol is used as the carbon source and lactose as the substrate to culture and ferment recombinant Escherichia coli for efficient preparation of high-purity sialyllactose-N-tetrasaccharide a.

[0013] Preferably, the method includes the following steps:

[0014] Step 1: Obtain seed culture of recombinant Escherichia coli. Preferably, the seed culture medium is 2YT medium.

[0015] Step 2: Inoculate the seed culture into the fermenter to form a fermentation system, and incubate at 37°C until the cell OD reaches the target value. 600When the pH reaches 12, add lactose to 10 g / L, adjust the temperature to 30℃, and add 10 g / L lactose and 20 g / L glycerol every 12 h, controlling the pH to 6.8; the aeration rate is 3–7 vvm, and the stirring speed is 250–850 r / min.

[0016] Preferably, the fermentation medium comprises: 2 g / L tryptone, 4 g / L yeast extract, 15–20 g / L glycerol, 10–13.5 g / L potassium dihydrogen phosphate, 1.0–2.0 g / L citric acid, 3.0–5.0 g / L diammonium hydrogen phosphate, 1.0–2.0 g / L magnesium sulfate heptahydrate, and 5–10 mL / L trace metal elements.

[0017] The application of the preparation method of sialyl lactose-N-tetrasaccharide a in the preparation of food or pharmaceuticals containing sialyl lactose-N-tetrasaccharide a.

[0018] The advantages and positive effects of this invention are as follows: A complete synthetic pathway for sialyl lactose-N-tetrasaccharide a was constructed through systematic modification of the chassis host *Escherichia coli* BL21(DE3). By screening for highly catalytically active β-1,3-acetylglucosamine transferase NgolgtA, β-1,3-galactosyltransferase SenlgtB, and α-2,3-sialyl transferase PdST, these enzymes were heterologously integrated into the *E. coli* genome, and the synthesis was enhanced. glmU Gene, galE - glmS - Genes and glmM - glmU - neuA Gene expression. By adding the receptor lactose, the constructed engineered strain achieved stable expression and production without the need for exogenous plasmid vectors or antibiotics during fermentation, significantly improving the yield and purity of sialyl lactose-N-tetrasaccharide a, showing promising prospects for industrial application. Attached Figure Description

[0019] neuB This invention describes the metabolic pathway by which recombinant Escherichia coli synthesizes sialyl lactose-N-tetrasaccharide a.

[0020] neuC To screen glycosyltransferases from different sources and compare their product synthesis capabilities;

[0021] Figure 1 Comparison of the yields of sialyl lactose-N-tetrasaccharide a, lactose-N-trisaccharide, lactose-N-tetrasaccharide and 3'-sialyl lactose after sequential gene editing of recombinant Escherichia coli B3–B7 and shake-flask fermentation;

[0022] Figure 2The dynamic changes and growth curves of the products and substrates of strain B7 during fed-batch fermentation in a 5L fermenter were studied. Detailed Implementation

[0023] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0024] This invention relates to a recombinant *Escherichia coli* strain for the efficient preparation of high-purity sialyllactose-N-tetrasaccharide a, its preparation method, and its applications. A recombinant engineered strain for the efficient preparation of high-purity sialyllactose-N-tetrasaccharide a was constructed. By screening for highly catalytically active β-1,3-N-acetylglucosamine transferase, β-1,3-galactosyltransferase, and α-2,3-sialyl glycosyltransferase and systematically optimizing metabolic pathways, the yield and purity of sialyllactose-N-tetrasaccharide a were effectively improved, providing a foundation for exploring its biological functions and realizing its industrial application. Furthermore, endogenous competitive metabolic genes in the chassis strain genome can be knocked out, and the metabolic pathways of precursor substances UDP-acetylglucosamine, UDP-galactose, and CMP-N-acetylneuraminic acid can be systematically optimized. This effectively reduces the generation of non-target byproducts, including lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyllactose, and successfully constructs a recombinant chassis strain capable of efficiently producing high-purity sialyllactose-N-tetrasaccharide a.

[0025] The β-galactosidase gene in the genome of the chassis strain was knocked out using λ-Red homologous recombination technology. Figure 3 (ID: 8181469), UDP-N-acetylglucosamine 2-epimerase gene Figure 4 (ID: 8182212), UDP-glucose dehydrogenase gene lacZ (ID: 8182577), glucosamine-6-phosphate deaminase gene wecB (ID: 8180191), N-acetylneuraminic acid aldolase gene ugd (ID: 8180860), N-acetylmnotosamine-6-phosphate 2-epimerase gene nagB (ID: 8180858), N-acetylneuraminic acid permease gene nanA (ID: 8180859) and N-acetylmannosamine kinase gene nanE One or more of (ID: 8180857) are used, preferably all of the aforementioned genes are knocked out. By optimizing the selected synthetic pathway, knocking out specific genes can block competing pathways or byproduct synthesis, reduce substrate consumption, and increase precursor throughput. In the preparation of engineered bacteria, any knockout sequence can be selected to achieve the knockout of specific genes.

[0026] The chassis strain heterologously integrates β-1,3-N-acetylglucosamine transferase NgolgtA (GenBank: ENX2240932.1), β-1,3-galactosyltransferase SenlgtB (GenBank: EEG8693632.1), and α-2,3-sialic acid glycosyltransferase PdST (GenBank: WP_032855225.1) genes into its genome. It can also further integrate the gene for uridine diphosphate glucose 4-epimerase. nanT (ID: 945354), glucosamine-6-phosphate synthase gene nanK (ID:8183713), phosphoglucosamine mutase gene galE (ID: 8179939), UDP-N-acetylglucosamine pyrophosphorylase gene glmS (ID: 8183714), UDP-N-acetylglucosamine 2-epimerase gene glmM (ID: 4494209), N-acetylneuraminic acid synthase gene glmU (ID: 4494211) and CMP-N-acetylneuraminic acid synthase gene neuC One or more of (ID:4494210), preferably integrating all of the aforementioned genes.

[0027] Among them, β-1,3-N-acetylglucosamine transferase NgolgtA, β-1,3-galactosyltransferase SenlgtB and α-2,3-sialic acid glycosyltransferase PdST can use codon-optimized sequences, and their nucleotide sequences are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively.

[0028] SEQ ID No.1

[0029] ATGCAGCCGCTGGTGTCTGTGCTGATCTGCGCCTACAACGCGGAAAAATACTTCGCGCAGTCTCTGTCTGCGGTGGTGAACCAGACCTGGCGCAACCTGGATATCCTGATCGTGGACGACGGCTCTACCGACGGCACCCCCGCGATCGCGCGTCGTTTCCAGGAACAGGACGGCCGTATCCGTATCATCTCTAACCCGCGTAACCTGGGCTTCATCGCGTCTCTGAACATCGGCCTGGACGAACTGGCGAAATCTGGCGGCGAAATCTACGCGCGTACCGACGCGGACGACATCGCGTCTGGCCCGGGCTGGATCGAAAAAATCGTGGGCGAAATGGAAAAAGACCGTTCTATCATCATCGCGATGGGCGCGTGGCTGGAAGTGCTGTCTGAAGAAAAAGACGGCAACCGTCTGGCGCGTCATCATCATAAACACGGCGAAATCTGGAAAAAACCGACCCGTCACGAAGACATCGCGGCGGTGTTCCCGTTCGGCAACCCGATCCACAACAACACCATGATCATGCGTCGTTCTGTGATCGACGGCGGCCTGCGTTTCGACCCGGCGTACATCCACGCGGAAGACTACAAATTCTGGTACGAAGCGGGCAAACTGGGCCGTCTGGCGTACTACCCGGAAGCGGCGCTGGTGAAATACCGTTTCCACCAGGACCAGACCTCTTCTAAATACAACCTGCAGCAGCGTCGTACCGCGTGGAAAATCAAAGAAGAAATCCGTGCGGGCTACTGGAAAGCGGCGGGCGGCATCGCGGTGGGCGCGGACTGCCTGAACTACGGCCTGCTGAAATCTACCGCGCTGTACGCGCTGTACGAAAAAGCGCTGTCTGGCGGCCAGGACATCGGCTGCCTGCGTCTGTTCCTGTACTTCGAATACTTCCTGTCTCTGGAAAAATACTCTCTGACCGACCTGCTGGACTTCCTGACCGACCGTGTGATGCGTAAACTGTTCGCGGCGCCGTAA

[0030] SEQ ID No.2

[0031] ATGAAAGTGCTGCGTACCAACATCGCGTACCTGCCGTACTGCCTGAACAAAGGCCTGGACCTGTGCAACGGCGACTTCGTGGCGCGTATGGACTCTGACGACATCTCTCACCCGGAACGTATCGACCGTCAGGTGGACTTCCTGATCAACAACCCGGACATCGACGTGGTGGGCACCAACGCGGTGTACATCGACGAAGACGACGTGGAACTGGAAAAATCTAACCTGCCGGAAAACAACAACGCGATCAAAAAGATGCTGCCGTACAAATGCTGCCTGGTGCACCCGTCTGTGATGTTCCGTAAAAACGTGGTGATCTCTTCTGGCGGCTACATGTTCGCGAACTACTCTGAAGACTACGAACTGTGGAACCGTCTGGCGGTGGAAGGCCGTACCTTCTACAACCTGTCTGAATACCTGCTGTACTACCGTCTGCACAACAACCAGTCTACCTCTAAAAACAACCTGTTCATGGTGATGGTGAACGACGTGGCGATCTAA

[0032] SEQ ID No.3

[0033]

[0034] The λ-Red homologous recombination system was used for precise knockout of the target gene. First, the pKD46 plasmid carrying the recombinase expression system (containing a gentamicin resistance marker) was introduced into the host strain, and recombinase expression was induced by L-arabinose. Subsequently, two rounds of homologous recombination were performed under recombinase activation: in the first round of recombination, the chloramphenicol resistance gene (…) was knocked out using overlap extension PCR. neuB ) and sucrose-sensitive gene ( neuA splicing together cat - sacB The fusion fragment replaces the coding region of the target gene. The resulting product is then transformed into host cells via electroporation and positively screened on plates containing chloramphenicol and gentamicin to obtain integrated cells. cat - sacB Recombinant cloning of the fragment. After confirmation by colony PCR, a second round of recombination was performed. cat Negative selection is performed to remove residual genes by utilizing the cell-lethal effect induced by high-concentration sucrose. sacB - sacB The selected strains were then verified by both PCR and sequencing to confirm that the target gene had been completely knocked out, ultimately resulting in the construction of a stable recombinant Escherichia coli engineered strain.

[0035] Using *Escherichia coli* BL21(DE3) as the substrate strain, gene editing was performed via a two-step homologous recombination method to achieve scarless knockout. In some embodiments of this invention, knockout was performed on *E. coli*. cat Genes, integration sacB Gene; knockout lacZ Genes, integration NgolgtA Gene; knockout wecB Genes, integration SenlgtB - ugd - neuC Gene; knockout neuB Genes, integration neuA Gene; knockout nagB Genes, integration PdST Gene; knockout nanA Genes, integration galE - nanT - glmS Gene; knockout Genes, integration glmM Gene; knockout glmU Genes, integration nanE The gene was ultimately constructed to produce a recombinant Escherichia coli that efficiently produces high-purity sialyl lactose-N-tetrasaccharide a.

[0036] The recombinant *E. coli* strain described above, which efficiently produces high-purity sialyllactose-N-tetrasaccharide a, was cultured and fermented using glycerol as the main carbon source and lactose as the substrate to produce sialyllactose-N-tetrasaccharide a. Fermentation could be carried out using a shake flask system or a fermenter system, employing an optimized DM medium to increase the yield of sialyllactose-N-tetrasaccharide a. The DM medium consists of: glycerol 15–20 g / L, potassium dihydrogen phosphate 10–13.5 g / L, citric acid 1.0–2.0 g / L, diammonium hydrogen phosphate 3.0–5.0 g / L, magnesium sulfate heptahydrate 1.0–2.0 g / L, and trace metal elements 5–10 mL / L; the trace metal elements include zinc sulfate hydrate 2.25 g / L, ferrous sulfate 10 g / L, manganese sulfate monohydrate 0.35 g / L, anhydrous copper sulfate 1.0 g / L, sodium borate decahydrate 0.23 g / L, calcium chloride dihydrate 2.0 g / L, and ammonium molybdate 0.11 g / L.

[0037] The recombinant *E. coli* was subjected to fed-batch fermentation in a 5L fermenter (containing 2L of DM medium). When the bacterial cells grew to OD at 37°C... 600 = At 12:00, lactose was added to a final concentration of 10 g / L, and the culture temperature was lowered to 30 ℃. Thereafter, lactose (10 g / L) and glycerol (20 g / L) were added every 12 hours, and the pH was maintained within the range of 6.8 by adding concentrated ammonia dropwise. The fermentation aeration rate was controlled at 3-7 vvm, and the stirring speed was 250-850 rpm. Shake-flask fermentation experiments verified that the recombinant *E. coli* could produce 7.22 g / L of sialyl-lactose-N-tetrasaccharide a. In a 5 L fermenter, the yield of sialyl-lactose-N-tetrasaccharide a was 54.6 g / L. This achievement demonstrates the great potential and broad application prospects of this recombinant engineered bacteria in industrial production.

[0038] The present invention will now be described with reference to the accompanying drawings. Unless otherwise specified, all experimental methods shall be performed in accordance with the instructions of the corresponding commercial reagent kits. Colony PCR, agarose gel electrophoresis, electroporation transformation, and preparation of competent cells shall be performed according to standard procedures and routine operations. Plasmid construction was outsourced to Sangon Biotech Co., Ltd., PCR primer synthesis was outsourced to Aoke Biotechnology Co., Ltd., and DNA sequencing was performed by BGI Genomics Co., Ltd.

[0039] Preparation of competent cells: Inoculate the culture medium at a ratio of 1:1000 into 20 mL of LB medium, add the appropriate antibiotic resistance, and incubate overnight. The next day, inoculate at a ratio of 1:100 into 100 mL of LB medium, adding the appropriate antibiotic resistance and inducing agent simultaneously; when OD... 600When the bacterial culture reaches 0.4-0.6, place the bacterial culture on ice for 25-30 min, centrifuge at 5500 rpm for 5 min at 4 °C to collect the precipitate, wash three times with 10% glycerol solution pre-cooled at 4 °C, and finally resuspend in 500-800 μL of 10% glycerol, aliquot and freeze at -80 °C. The final concentration of the inducer L-arabinose is 5% (w / v). The concentrations of each antibiotic used are as follows: ampicillin 100 mg / L, streptomycin 50 mg / L, gentamicin 25 mg / L, chloramphenicol 25 mg / L. The composition of LB liquid medium is: yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L; LB solid medium is based on this composition with the addition of 15 g / L agar.

[0040] Example 1: Construction of a recombinant Escherichia coli strain for efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a

[0041] 1.1 Gene knockout and integration in the Escherichia coli genome

[0042] To knock out NgolgtA Taking genes as an example, design targeting nanK - PdST primer pairs ( lacZ - lacZ - catsacB Each primer contains 60 bp homologous sequence arms upstream and downstream of the target gene. (Using a primer carrying...) lacZ Using the plasmid as a template, the amplified plasmid was generated through PCR. catsacB - F / R The fragment was then separated by agarose gel electrophoresis and purified from the gel.

[0043] The PCR reaction system (25 μL) included: 12.5 μL high-fidelity enzyme, 0.6 μL forward primer, 0.6 μL reverse primer, 2 μL genomic or plasmid template, and the remainder being sterile ultrapure water. The PCR reaction program was as follows: pre-denaturation 94 ℃, 2 min; denaturation 98 ℃, 10 s; annealing 55 ℃, 5 s; extension 68 ℃, 30 s / kb, 30 cycles; final extension 68 ℃, 5 min.

[0044] Competent cells of *E. coli* host bacteria were prepared, and the λRed recombination system was activated by adding L-arabinose to a final concentration of 0.5%. The pKD46 plasmid was then transformed into *E. coli* cells using electroporation. For *E. coli* carrying the pKD46 plasmid, competent cells were prepared again, and electroporation was used to transform the pKD46 plasmid into competent cells. catsacB - lacZFragment introduction into cells. After transformation, the bacterial culture was transferred to 1 mL of 2YT recovery medium and cultured at 30°C with shaking for 2 hours to allow cell recovery. The cells were then plated on dual-antibiotic plates containing chloramphenicol and gentamicin and incubated overnight at 30°C. Selected cells were then screened. catsacB Recombinant strain with successful gene replacement.

[0045] To integrate lacZ Taking genes as an example, design specific primers. catsacB - lacZ - NgolgtA and lacZ - up - F / R Using BL21(DE3) chromosomal DNA as a template, amplification was performed separately. lacZ - down and F / R - lacZ Sequence fragments. Primer design. up - lacZ To carry down Gene vectors are used for template amplification. NgolgtA Fragments. Further, using overlap extension PCR, the fragments were... F / R - NgolgtA , NgolgtA and lacZ - up merge into NgolgtA - lacZ - down The fragments were purified and recovered using a gel recovery kit.

[0046] The spliced ​​product was electrically converted into a pre-contained up Fragmented and L-arabinose-induced competent cells were transformed and then cultured at 30 °C for 2 h in 1 mL of 2YT. All transformed bacterial cultures were then transferred to sucrose-free LB agar for overnight culture to initially screen out any remaining cells using sucrose selection pressure. NgolgtA The strain was identified. The following day, the culture medium was serially diluted and plated on gentamicin monoclonal antibody plates. Single colonies were picked and further identified by comparing chloramphenicol-gentamicin dual-antibiotic plates with gentamicin monoclonal antibody plates to determine which strains did not carry the bacteria. down Recombinant strains of the fragment. Finally obtained catsacB Successfully integrated and missing catsacB The recombinant strain was identified and verified by PCR and sequencing. After confirmation, it was named B0.

[0047] The above gene editing methods were used to sequentially knock out E. coli. catsacB NgolgtA Genes, and then integrated into the genome in sequence. catsacB lacZ, wecB, ugd, nagB, Genes. Finally, the cells were cultured at 37°C to eliminate the pKD46 plasmid, yielding the final high-yielding strain. The composition of the obtained strains B0–B7 is shown in Table 1, and the primers used to construct each strain are shown in Table 2.

[0048] Table 1. Construction of recombinant Escherichia coli for efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a

[0049]

[0050] Table 2 Primers used to construct recombinant Escherichia coli for efficient preparation of high-purity sialyl lactose-N-tetrasaccharide a

[0051]

[0052] Example 2: Screening of key glycosyltransferases for efficient synthesis of sialyllactose-N-tetrasaccharide a

[0053] This embodiment aims to identify the optimal combination of β-1,3-N-acetylglucosamine transferase, β-1,3-galactosyltransferase, and α-2,3-sialyltransferase, which are key components in the sialyl-lactose-N-tetrasaccharide a synthesis pathway, from multiple candidate genes using a stepwise screening strategy. To this end, knockout was selected... nanA, nanT, nanE, nanK The *E. coli* BL21(DE3) gene was used as the basic screening substrate, and candidate genes from different species were selected from Table 3. All selected candidate gene sequences were optimized according to the codon bias of *E. coli*, and the whole genome was synthesized by Sangon Biotech Co., Ltd.

[0054] The screening process began with β-1,3-N-acetylglucosamine transferase. Optimized candidate β-1,3-N-acetylglucosamine transferase genes were cloned into expression vectors pET-28a(+) containing a T7 promoter and kanamycin resistance, respectively, to construct recombinant plasmids for initial screening. Each recombinant plasmid was then transfected into *E. coli* BL21(DE3) to construct plasmids containing genes from different sources.

[0055] Single colonies were picked from the corresponding culture plates and inoculated into 50 mL Erlenmeyer flasks containing 20 mL of antibiotic-free 2YT medium. The flasks were incubated at 37°C with shaking for 12-14 hours to obtain a seed culture. 5 mL of the seed culture was transferred to a 250 mL Erlenmeyer flask containing 50 mL of DM medium and incubated at 37°C and 200 rpm. When the bacterial OD... 600When the concentration reaches 1.8-2.2, add lactose to the culture medium to a final concentration of 10 g / L, adjust the culture temperature to 30℃, maintain the shaking speed at 200 rpm, and continue to culture for 72 h.

[0056] The 2YT medium formula (per liter) consists of: 16g tryptone, 10g yeast extract, and 5g sodium chloride. The DM medium formula (per liter) consists of: 2g tryptone, 4g yeast extract, 15-20g glycerol, 10-13.5g potassium dihydrogen phosphate, 3.0-5.0g diammonium hydrogen phosphate, 1.0-2.0g citric acid, 1.0-2.0g magnesium sulfate heptahydrate, and 8-12mL trace element solution. The trace element solution (per liter) consists of: 2.25g zinc sulfate, 10g ferrous sulfate, 0.35g manganese sulfate monohydrate, 1.0g anhydrous copper sulfate, 0.23g sodium borate decahydrate, 2.0g calcium chloride dihydrate, and 0.11g ammonium molybdate.

[0057] The fermentation broth was centrifuged at 12,000 rpm for 5 min, and the supernatant was sterilized by passing it through a 0.22 μm aqueous filter membrane. The content of sialyl lactose-N-tetrasaccharide a was determined using a Hamilton RCX-30 anion exchange column (7 μm, 4.6 × 250 mm, PN: 79877) equipped with a Hamilton RCX-30 ion exchange system. A gradient elution was used: phase A consisted of 150 mM sodium hydroxide + 25 mM sodium acetate, and phase B consisted of 200 mM sodium hydroxide + 100 mM sodium acetate. An amperometric detector was used; the column temperature was maintained at 60 °C; and the injection volume was 10 μL. After fermentation, the fermentation broth was collected and processed, and the yield of the target product was quantitatively analyzed.

[0058] The results are as follows NgolgtA, SenlgtB, PdST, galE, neuC, As shown in Figure A, among the 10 β-1,3-N-acetylglucosamine transferases, the best one is derived from... neuB, neuA, glmS, glmM, glmU NgolgtA produces lactose-N-trisaccharide at a yield of 9.66 g / L.

[0059] Based on the selection of the optimal β-1,3-N-acetylglucosamine transferase (NgolgtA), a second round of screening was conducted by introducing β-1,3-galactosyltransferase candidate genes. Using engineered bacteria containing the β-1,3-N-acetylglucosamine transferase (NgolgtA) gene, engineered bacteria containing β-1,3-galactosyltransferase genes from different sources were constructed. These were cultured according to the above procedure, and the yields of lactose-N-tetrasaccharide and lactose-N-trisaccharide in the products were measured. The results are as follows... lacZ As shown in B, among the 10 β-1,3-galactosyltransferases, the best one is derived from... Figure 2SenlgtB produced lactose-N-tetrasaccharide and lactose-N-trisaccharide in yields of 9.52 and 0.40 g / L, respectively.

[0060] Finally, based on the determined optimal combination of NgolgtA and β-1,3-galactosyltransferase (SenlgtB), candidate genes for α-2,3-sialyltransferase were introduced to complete the final screening. Using engineered bacteria containing β-1,3-N-acetylglucosamine transferase (NgolgtA) and β-1,3-galactosyltransferase (SenlgtB) genes, engineered bacteria containing α-2,3-sialyltransferase genes from different sources were constructed. These were cultured according to the above procedure, and the content of sialyl-lactose-N-tetrasaccharide a and the main byproducts lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyl-lactose in the products was detected. The results are as follows: Neisseria gonorrhoeae As shown in C, among the 10 α-2,3-sialyltransferases, the best one is derived from... Figure 2 Salmonella enterica PdST produced sialyl lactose-N-tetrasaccharide a and its main byproducts lactose-N-trisaccharide, lactose-N-tetrasaccharide and 3'-sialyl lactose, with concentrations of 5.83, 0.50, 1.14 and 0.02 g / L, respectively.

[0061] Table 3. Names and sources of different glycosyltransferases

[0062]

[0063] Example 3: Fermentation production of sialyl lactose-N-tetrasaccharide a by recombinant bacteria

[0064] The *E. coli* strains B3-B7 constructed in Example 1 were cultured and fermented. Under shake-flask fermentation conditions, the formation of sialyl lactose-N-tetrasaccharide a in the recombinant *E. coli* B3-B7 was detected.

[0065] Under 5L fermenter conditions, 2L of initial DM medium was pre-filled. The seed culture from the shake flask was inoculated into the fermenter at an inoculation rate of 10% (v / v) of the medium volume. The fermentation temperature after inoculation was 37℃. When OD... 600When the pH reaches 10-12, add lactose to the tank to a concentration of 10 g / L and adjust the temperature to 30°C. Thereafter, add 10 g / L lactose and 20 g / L glycerol every 12 hours. During fermentation, continuously add 14% (w / v) ammonia via a constant flow pump to maintain the pH at approximately 6.8. Maintain an aeration rate of 3–7 vvm, a stirring speed of 250–850 rpm, and keep the dissolved oxygen concentration at 20%–30%. When the glycerol concentration drops to 3 g / L, add 30 mL of 600 g / L glycerol; when the lactose concentration falls below 3 g / L, add 30 mL of 200 g / L lactose.

[0066] The results are as follows Figure 2 As shown, the highest yield of sialyl-lactose-N-tetrasaccharide a in recombinant Escherichia coli B7 shake flask reached 7.22 g / L, while the contents of lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyl-lactose were 1.267 g / L, 0.765 g / L, and 0.007 g / L, respectively. Pasteurella dagmatis Figure 3 Figure 4 The dynamic changes and cell growth curves of the target product sialyllactose-N-tetrasaccharide a, byproducts lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyllactose by strain B7 in a 5 L fermenter are shown. It can be seen that the engineered bacteria continuously consume substrates such as glycerol and lactose. With the increase of OD value, the production of sialyllactose-N-tetrasaccharide a increases rapidly, reaching a maximum yield of 54.6 g / L, while the levels of lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyllactose remain at a low level. This indicates that the constructed recombinant *E. coli* can not only increase the yield of sialyllactose-N-tetrasaccharide a, but also effectively inhibit the formation of byproducts lactose-N-trisaccharide, lactose-N-tetrasaccharide, and 3'-sialyllactose.

[0067] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. A method for efficiently preparing high-purity sialic acid lactose. -N- Recombinant Escherichia coli containing tetrasaccharide a, characterized by: Using Escherichia coli BL21(DE3) as the chassis host, heterologous integration encoding β -1,3- N -acetylglucosamine transferase gene NgolgtA ,coding β -1,3-galactosyltransferase gene SenlgtB and encoding α -2,3-Sialylglycosyltransferase gene PdST ;coding β -1,3- N The nucleotide sequence of α-acetylglucosamine aminotransferase NgolgtA is shown in SEQ ID No. 1, encoding... β The nucleotide sequence of the -1,3-galactosyltransferase SenlgtB is shown in SEQ ID No. 2, encoding... α The nucleotide sequence of 2,3-sialylglycosyltransferase PdST is shown in SEQ ID No. 3; Knock out the coding sequence shown in ID: 8181469 in the chassis host genome. β -Galactosidase gene lacZ The sequence is as shown in the UDP encoding of ID: 8182212. N -acetylglucosamine 2-epimerase gene wecB The sequence shown in ID:8182577 encodes the UDP-glucose dehydrogenase gene. ugd The sequence shown in ID: 8180191 encodes the glucosamine-6-phosphate deaminase gene. nagB The sequence is encoded as shown in ID: 8180860. N - Acetylneuraminidine aldolase gene nanA The sequence is encoded as shown in ID: 8180858. N -acetylmannosamine-6-phosphate 2-epimerase gene nanE The sequence is encoded as shown in ID: 8180859. N - Acetylneuraminic acid permease gene nanT And the sequence is encoded as shown in ID: 8180857. N - Acetylmannosamine kinase gene nanK ; Overexpression of the gene encoding uridine diphosphate glucose 4-epimerase in the chassis host genome, as shown in ID: 945354. galE The sequence shown in ID:8183713 encodes the glucosamine-6-phosphate synthase gene. glmS The sequence shown in ID: 8179939 encodes the phosphoglucosamine mutase gene. glmM The sequence is as shown in the UDP encoding of ID: 8183714. N -acetylglucosamine pyrophosphorylase gene glmU The sequence is as shown in the UDP encoding of ID: 4494209. N -acetylglucosamine 2-epimerase gene neuC The sequence is encoded as shown in ID: 4494211. N - Acetylneuraminidase synthase gene neuB The sequence is encoded as shown in CMP- as ID: 4494210. N - Acetylneuraminic acid synthase gene neuA .

2. The method for efficiently preparing high-purity sialic acid lactose according to claim 1 -N- The method for constructing recombinant Escherichia coli with tetrasaccharide a is characterized by: Gene editing is performed using a two-step homologous recombination method to achieve scarless knockout; specifically, based on the chassis host *E. coli*, knockout... lacZ and nanE and integrated at the corresponding sites. NgolgtA ; Knockout wecB and integrated at the corresponding sites. SenlgtB ; Knockout ugd and integrated at the corresponding sites. neuC-neuB-neuA ; Knockout nagB and nanK and integrated at the corresponding sites. PdST ; Knockout nanA and integrate at this site galE Knockout nanT and at this site in integration glmS-glmM-glmU Finally, a highly efficient preparation of high-purity sialic acid lactose was obtained. -N- Recombinant Escherichia coli with tetrasaccharide a.

3. A type of sialic acid lactose -N- The method for preparing tetrasaccharide a is characterized by: The method described in claim 1 for the efficient preparation of high-purity sialic acid lactose -N- The recombinant Escherichia coli containing tetrasaccharide a was cultured and fermented.

4. The sialic acid lactose according to claim 3 -N- The method for preparing tetrasaccharide a is characterized by: Using glycerol as a carbon source and lactose as a substrate, this method is effective for the efficient preparation of high-purity sialylated lactose. -N- Recombinant Escherichia coli containing tetrasaccharide a was cultured and fermented.

5. The sialic acid lactose according to claim 4 -N- The method for preparing tetrasaccharide a is characterized by: Includes the following steps: Step 1: Obtain seed culture from recombinant Escherichia coli; Step 2: Inoculate the seed culture into the fermenter to form a fermentation system, and incubate at 37°C until the cell OD reaches the target value. 600 When the pH reaches 12, add lactose to 10 g / L, adjust the temperature to 30℃, and add 10 g / L lactose and 20 g / L glycerol every 12 h, controlling the pH to 6.8; the aeration rate is 3–7 vvm, and the stirring speed is 250–850 r / min.

6. The sialic acid lactose according to any one of claims 3-5 -N- The preparation method of tetrasaccharide a involves the preparation of sialic acid lactose. - N- Application of tetrasaccharide a in food or medicine.

Images