Application of androstenedione to regulation of MSMO1 expression in porcine ovarian granular cells

Abstract

The invention relates to application of androstenedione to regulation of MSMO1 expression in porcine ovarian granular cells, in particular to application to regulation of proliferation, apoptosis and / or E2 and Pg secretion of the porcine ovarian granular cells. According to the invention, 40nM androstenedione is screened as the optimal growth concentration of the porcine ovarian granular cells; 40nM androstenedione is added to promote proliferation of porcine ovarian granular cells and secretion of E2 and Pg and inhibit apoptosis of the porcine ovarian granular cells; the androstenedione has a common regulation effect on MSMO1 expression regulation and porcine ovarian granular cell functions. The method has good application value for researching mechanisms such as ovarian follicular atresia and follicular development, provides a clear and operable dose window and a potential intervention target spot for improving the reproductive performance of female animals, and provides a new technical means for optimizing the reproductive performance management of live pigs.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of androstenedione in regulating MSMO1 expression in porcine ovarian granulosa cells. Background Technology

[0002] In pig breeding, litter size is an important evaluation indicator, closely related to follicular development, especially the number of dominant follicles. Follicles are the basic functional units of the ovary, and their normal development depends on the precise coordination between oocytes and ovarian somatic cells. Granulosa cells (GCs) are a key cell group surrounding the oocyte; their proliferation and differentiation drive follicular growth, while excessive apoptosis leads to follicular atresia. Besides protecting the oocyte and facilitating bidirectional communication, granulosa cells also play a role in steroid synthesis and endocrine function; the estradiol (E2) and progesterone (Pg) they secrete are the main hormones determining female fertility in mammals. Therefore, elucidating the molecular mechanisms regulating granulosa cell proliferation, apoptosis, and secretory function holds promise for identifying and targeting key factors that improve the reproductive efficiency of female animals and female reproductive health.

[0003] Methylsterol Monooxygenase 1 (MSMO1) catalyzes a crucial step in the demethylation of lanosterol to zymosterol in the steroid biosynthesis pathway, and is an important enzyme in cholesterol production. Multiple studies have suggested that MSMO1 is closely related to follicular development. In a rat PCOS model, cholesterol synthesis genes such as HSD17B7, TM7SF2, IDI1, MSMO1, and SQLE are highly expressed. Similar high expression patterns have been observed during normal follicular development: in porcine follicles at peak oviposition (30 weeks), key genes in the steroid biosynthesis pathway, including MSMO1, FDFT1, DHCR24, LSS, CYP51A1, NSDHL, SQLE, and SC5D, are significantly upregulated. Studies in chicken models have further confirmed this phenomenon, finding that MSMO1, FDFT1, DHCR24, LSS, CYP51A1, and SQLE are closely related to steroid synthesis in the hypothalamic-pituitary-ovarian (HPO) axis. However, MSMO1 high expression occurs in two distinct follicular development states—the PCOS model with follicular dysfunction and the physiological stage of vigorous follicular development and high oocyte production.

[0004] Androstenedione (ASD) is a pivotal steroid hormone secreted by theca cells, and its metabolic fate determines the concentration balance of various sex hormones in the follicular microenvironment. ASD is metabolized into estrogen or androgen through different enzymatic pathways, and is therefore considered a core regulator of follicular development. When androgen concentrations exceed physiological limits, a series of pathological changes occur, the most significant being the appearance of polycystic ovary syndrome (PCOS)-related phenotypes, characterized by follicular arrest, decreased granulosa cell proliferation, and increased apoptosis. In vitro studies have shown the molecular mechanism by which excessive ASD can lead to dysfunction of bovine ovarian GCs: ASD accumulation, decreased levels of the cell proliferation marker gene PCNA, and increased levels of AMH and CTNNBIP1, ultimately resulting in GC cycle arrest. These studies suggest that hormone effects are bidirectional, but the key thresholds and underlying regulatory mechanisms remain unclear.

[0005] The existing technology lacks a description of the physiological window of ASD's role in follicular development, and the reason why both the PCOS model of follicular dysfunction and the physiological stage of high oocyte production during vigorous follicular development show high MSMO1 expression is still unclear.

[0006] Therefore, evaluating the effect of ASD-regulated MSMO1 expression on the function of porcine ovarian granulosa cells and revealing the ASD-MSMO1 regulatory mechanism clarifies the operable dose window and potential intervention targets for improving follicular function and maternal fertility. Summary of the Invention

[0007] The first technical problem to be solved by this invention is to provide the application of androstenedione in regulating MSMO1 expression in porcine ovarian granulosa cells.

[0008] The technical solution adopted by the present invention to solve its first technical problem is the application of androstenedione in regulating MSMO1 expression in porcine ovarian granulosa cells. Specifically, the application is in regulating the proliferation, apoptosis and / or E2 and Pg secretion of porcine ovarian granulosa cells.

[0009] Furthermore, the application includes any of the following:

[0010] 1) In vitro, the addition of androstenedione inhibited MSMO1 expression and promoted the proliferation of porcine ovarian granulosa cells;

[0011] 2) In vitro, the addition of androstenedione inhibited MSMO1 expression and suppressed apoptosis in porcine ovarian granulosa cells;

[0012] 3) In vitro, the addition of androstenedione to inhibit MSMO1 expression can promote E2 secretion from porcine ovarian granulosa cells.

[0013] 4) In vitro, the addition of androstenedione to inhibit MSMO1 expression can promote Pg secretion from porcine ovarian granulosa cells.

[0014] Furthermore, the functional phenotype of inhibiting the proliferation of porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery after the addition of androstenedione to ovarian granulosa cells.

[0015] The functional phenotype that promotes apoptosis in porcine ovarian granulosa cells after MSMO1 addition tends to be restored upon the addition of androstenedione to ovarian granulosa cells.

[0016] The functional phenotype of inhibiting E2 secretion by porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery upon the addition of androstenedione to ovarian granulosa cells.

[0017] The functional phenotype of inhibiting Pg secretion by porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery upon the addition of androstenedione to ovarian granulosa cells.

[0018] Furthermore, the concentration of androstenedione was 40 nM.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This invention uses porcine ovarian granulosa cells as material. Through in vitro culture techniques, different concentration gradients of androstenedione (ASD) were added to the culture medium. Using CCK8 and ELISA techniques, 40 nM was identified as the optimal growth concentration for porcine ovarian granulosa cells. The effects of adding 40 nM ASD on the proliferation and E2 and Pg secretion of porcine ovarian granulosa cells, as well as its inhibitory effect on apoptosis, were systematically investigated using qRT-PCR, EdU, Western blotting, and flow cytometry.

[0021] This invention found that adding 40 nM ASD to porcine ovarian granulosa cells can inhibit MSMO1 expression, while promoting the proliferation of porcine ovarian granulosa cells and the secretion of E2 and Pg and inhibiting apoptosis, indicating that MSMO1 may be involved in the regulation of porcine follicle development.

[0022] This invention uses porcine ovarian granulosa cells as material and employs gene overexpression technology to upregulate the expression level of MSMO1 in porcine ovarian granulosa cells. It was found that MSMO1 inhibits the proliferation of porcine ovarian granulosa cells and the release of E2 and Pg, and promotes their apoptosis.

[0023] This invention found that when 40 nM ASD and MSMO1 were added simultaneously to porcine ovarian granulosa cells, the overexpression of MSMO1 could antagonize the promoting effect of ASD on the function of porcine ovarian granulosa cells. Attached Figure Description

[0024] Figure 1Adding concentration gradient screening and comparison images to porcine ovarian granulosa cells for ASD;

[0025] In this study, A represents the effect of different concentrations of ASD on the proliferation of PGCs as assessed by CCK-8 assay; B and C represent the concentrations of E2 and Pg in the cell culture medium after 72 hours of treatment with different concentrations of ASD, as determined by ELISA.

[0026] Figure 2 Comparison of the effects of adding 40 nM ASD on marker genes of steroid hormone production in porcine ovarian granulosa cells;

[0027] Among them, AH represents the qRT-PCR analysis of steroid hormone synthesis marker genes after 72 hours of treatment of porcine ovarian granulosa cells with 40 nM ASD.

[0028] Figure 3 Comparative graph showing the effects of ASD on proliferation and apoptosis in porcine ovarian granulosa cells;

[0029] In this table, A is a representative image (400x) of EdU detection after 72 hours of treatment with 40 nM ASD; B is a quantitative analysis of EdU positivity rate; C-D are flow cytometry assessments of cell cycle distribution; EG is qRT-PCR and Western Blot analysis of cell proliferation marker genes; HI is flow cytometry analysis of apoptosis; and JL is qRT-PCR and Western Blot analysis of apoptosis marker genes.

[0030] Figure 4 A comparative graph showing the effect of adding ASD to porcine ovarian granulosa cells on MSMO1.

[0031] AC represents the MSMO1 gene qRT-PCR and Western Blot analysis.

[0032] Figure 5 A comparative diagram showing the effects of the constructed pcDNA3.1-MSMO1 on MSMO1 in porcine ovarian granulosa cells;

[0033] AC represents the MSMO1 gene qRT-PCR and Western Blot analysis.

[0034] Figure 6 A comparative diagram showing the effects of MSMO1 overexpression on granulosa cell proliferation, apoptosis, and the functions of steroid hormone synthesis marker genes, E2 secretion, and Pg secretion.

[0035] In this table, AB represents the E2 and Pg contents in the cell culture medium after overexpressing the MSMO1 gene, respectively; CJ represents the qRT-PCR analysis of steroid hormone synthesis marker genes; and KL represents the qRT-PCR analysis of cell proliferation marker genes and apoptosis marker genes, respectively.

[0036] Figure 7 Figure showing the effect of MSMO1 overexpression antagonism against ASD on steroid production marker genes and E2 and Pg secretion in porcine ovarian granulosa cells;

[0037] Where AB represents the E2 and Pg content in the cell culture medium; C represents the qRT-PCR analysis of steroid hormone synthesis marker genes.

[0038] Figure 8 Figure showing the effect of MSMO1 overexpression antagonizing ASD on the proliferation and apoptosis of porcine ovarian granulosa cells;

[0039] In this study, A represents the CCK-8 assay for PGC activity; BD represents the qRT-PCR and Western blot analysis of MSMO1 and cell proliferation marker genes; EF represents the flow cytometry analysis of apoptosis; and GI represents the qRT-PCR and Western blot analysis of apoptosis marker genes. Detailed Implementation

[0040] Many specific details of the invention are set forth in the following description to enable those skilled in the art to implement and fully understand the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make various modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0042] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the reagents and other materials used in this embodiment are all commercially available products.

[0043] Example 1: Culture and transfection of ovarian granulosa cells

[0044] Ovarian tissue (n=30) from Duroc, Landrace, and Large White commercial pigs (180 days old, 110 kg) was isolated from a slaughterhouse in Changsha County, Changsha City, Hunan Province. The tissue was preserved in physiological saline at 37℃, supplemented with 100 IU / mL penicillin (Solarbio) and 100 mg / mL streptomycin (Solarbio), and transported to the laboratory within 1 hour. Follicular fluid from healthy follicles with a diameter of 3-5 mm was centrifuged at 1000 rpm for 10 minutes at room temperature. The cell pellet was resuspended in DMEM / F12 (Gibco) medium containing 15% fetal bovine serum (Gibco), 100 IU / mL penicillin, and 100 μg / mL streptomycin. Cell culture was performed in a 37℃, 5% CO2 incubator. Granulosa cells were divided into control and experimental groups, with a seeding density of 10-1. 5 pcs / cm 2 After culturing for 24 hours, the granulocytes were washed with PBS and the culture medium was changed. Lipofectamine was used. TM 3000 (Thermo Fisher Scientific) transfected pcDNA3.1-MSMO1 into granulosa cells, or replaced the medium with media containing 0 nM, 2.5 nM, 5 nM, 10 nM, 20 nM, 40 nM, 80 nM, and 160 nM ASD, respectively.

[0045] The detection method is as follows:

[0046] (1) Quantitative Real-time PCR (qRT-PCR)

[0047] Total RNA was extracted from granulocytes using TRIzol reagent (TaKaRa), and its concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Total RNA (500 ng) was reverse transcribed into cDNA. RT-qPCR was performed using a StepOne Real-Time PCR system (Applied Biosystems). Relative mRNA levels were normalized, and 2... -ΔΔCt Algorithm calculation.

[0048] GAPDH was used as an internal control for gene detection. The full-length sequences of the following genes were obtained from the NCBI database: MSMO1, GAPDH, STAR, CYP11A1, 3β-HSD, CYP17A1, CYP19A1, HSD17B1, HSD17B2, HSD17B3, PCNA, CDK4, CCNE1, BAX, BCL2, caspase3, p21, CDC20, caspase9, and BAK1. The qRT-PCR primers used in this invention were designed using Primer6 and synthesized by Beijing Qingke Biotechnology (Hunan) Co., Ltd., as detailed below:

[0049] qRT-PCR-MSMO1 Forward: 5'- TTGGCTGTGCTGTGATTGAGGA -3' (SEQ ID No. 1);

[0050] Reverse: 5'- AGGGTTTCCAGAGGGTTGCAT -3' (SEQ ID No. 2);

[0051] qRT-PCR-GAPDH Forward: 5'- GCAAGTTCCACGGCACAGTCA -3' (SEQ ID No. 3);

[0052] Reverse: 5'- CGCTCCTGGAAGATGGTGATGG -3' (SEQ ID No. 4);

[0053] qRT-PCR-STAR Forward: 5'- AGATGTGGGCAAGGTGTTCC -3' (SEQ ID No. 5);

[0054] Reverse: 5'- GCAGCCAACTCATGGGTGA -3' (SEQ ID No. 6);

[0055] qRT-PCR-CYP11A1 Forward: 5'- GACCCCGCCTTCTTCTCAA -3' (SEQ ID No. 7);

[0056] Reverse: 5'- CAGCCAAAGCCCAAGTTCC -3' (SEQ ID No. 8);

[0057] qRT-PCR-3β-HSD Forward: 5'- GGAGCCCATTCATCTTTGCC -3' (SEQ ID No. 9);

[0058] Reverse: 5’- CAGAAGCCCCATTCCTTGC -3’(SEQ ID No.10);

[0059] qRT-PCR-CYP17A1 Forward:5’- TCCAAGCCAAGACGAACGC -3’(SEQ ID No.11);

[0060] Reverse: 5’- CCCCAAAGATGTCCGCAAC -3’(SEQ ID No.12);

[0061] qRT-PCR-CYP19A1 Forward:5’- CGTCTGTGCCGATTCCATC -3’(SEQ ID No.13);

[0062] Reverse: 5’- GTCCACGTAGCCCAAGTCATT -3’(SEQ ID No.14);

[0063] qRT-PCR-HSD17B1 Forward:5’- ACTCCGTGCTGGATGTGAACCT -3’(SEQ ID No.15);

[0064] Reverse: 5’- ACAACCGCCAGACTCTCGCATA -3’(SEQ ID No.16);

[0065] qRT-PCR- HSD17B2 Forward:5’- TCACAGGTGGCGATTCTGGGAT -3’(SEQ IDNo.17);

[0066] Reverse: 5’- TCTGCTGCGAGTTGGTGATGTC -3’(SEQ ID No.18);

[0067] qRT-PCR- HSD17B3 Forward:5’- GCTGCTGGTGTGCCTGGTTTAC -3’(SEQ IDNo.19);

[0068] Reverse: 5’- TCACTGCCCACTGTCCCATTGA -3’(SEQ ID No.20);

[0069] qRT-PCR-PCNA Forward:5’- ATCAGCTCCAGCGGCGTGAA -3’(SEQ ID No.21);

[0070] Reverse: 5’- AATTGCGGTCGCAGCGGTAC -3’(SEQ ID No.22);

[0071] qRT-PCR-CDK4 Forward:5’- GGGTCAGCTCGCTACTCAACTC -3’(SEQ ID No.23);

[0072] Reverse: 5’- GGGAGTGCCCAAAGCTCTGAAA -3’(SEQ ID No.24);

[0073] qRT-PCR-CCNE1 Forward:5’- GGAGAAGAAGGAAAGGGATGC -3’(SEQ ID No.25);

[0074] Reverse: 5’- AACAGGGGTTTTCACAGGCT -3’(SEQ ID No.26);

[0075] qRT-PCR-BAX Forward:5’- CCTTTTGCTTCAGGGTTTCAT -3’(SEQ ID No.27);

[0076] Reverse: 5’- GACACTCGCTCAACTTCTTGGT -3’(SEQ ID No.28);

[0077] qRT-PCR-BCL2 Forward:5’- TGGACAACATCGCCCTGTGGAT -3’(SEQ ID No.29);

[0078] Reverse: 5’- GCATCCCAGCCTCCGTTATCCT -3’(SEQ ID No.30);

[0079] qRT-PCR-caspase3 Forward:5’- GACCATAGCAAAAGGAGCAGTT -3’(SEQ IDNo.31);

[0080] Reverse: 5’- TGTCCGTCTCAATCCCACAG -3’(SEQ ID No.32);

[0081] qRT-PCR-p21 Forward: 5’- CAGGACTGCGATGCACTGATGG -3’ (SEQ ID No.33);

[0082] Reverse: 5’- ACACGTTCCCAGGCGAAGTCA -3’ (SEQ ID No.34);

[0083] qRT-PCR-p27 Forward: 5’- AGCGACCTGCCACAGACGATT -3’ (SEQ ID No.35);

[0084] Reverse: 5’- TCTGCTCCACTGAAGCCGAGTT -3’ (SEQ ID No.36);

[0085] qRT-PCR-CDC20 Forward: 5’- GACATTCACGCAGCACCAAGGA -3’ (SEQ ID No.37);

[0086] Reverse: 5’- CCCTCCAGTTGCCAGGACATTG -3’ (SEQ ID No.38);

[0087] qRT-PCR-caspase9 Forward: 5’- GGACAGACAAAGATGCGGAGGC -3’ (SEQ IDNo.39);

[0088] Reverse: 5’- GCAGGCGAAGCAGGCTGAATT -3’ (SEQ ID No.40);

[0089] qRT-PCR-BAK1 Forward: 5’- ACATCAACCGGCGATACGACTC -3’ (SEQ ID No.41);

[0090] Reverse: 5’- CCTGGAGGCGATCTTGGTGAAG -3’ (SEQ ID No.42).

[0091] (2) Western blot (WB) analysis

[0092] Granulocytes were washed with PBS and lysed in RIPA lysis buffer (Beyotime). Total protein (20 ng) was then separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore). The membrane was blocked at room temperature for 2 hours (5% skim milk powder dissolved in Tris-buffered saline-Tween). The membrane was then incubated overnight at 4°C with primary antibodies (1:1000): BAX (Zenbio), BCL2 (Huabio), PCNA (Huabio), CDK4 (Huabio), CCNE (Abclonal), and GAPDH (Proteintech). Subsequently, the membrane was washed three times with TBST (10 min each time) and incubated with the corresponding secondary antibody (Biodragon) at room temperature for two hours. Finally, the signal was detected using a gel imaging system (Bio-Rad) and analyzed using ImageJ software.

[0093] (3) Flow cytometry

[0094] Porcine granulocytes were cultured in six-well plates, with 4 × 10⁴ cells per well. 5 Cells were treated with an overexpression plasmid and collected after 72 h, or treated with ASD for 72 h, followed by digestion with 0.25% trypsin and termination of digestion with DMEM / F12 containing 15% fetal bovine serum. Cells were collected in 70% cold ethanol, fixed overnight at 4°C, washed twice with PBS, and stained with 50 mg / mL propidium iodide for 30 min. Finally, cell cycle and apoptotic status of granulocytes were analyzed using flow cytometry (Becton Dickinson).

[0095] (4) EdU staining and CCK8 counting

[0096] Granulosa cells were seeded in 96-well plates (2 × 10³ cells / well), treated with overexpression plasmids or ASD, and harvested after 72 h. Cells were stained with 50 mM EdU for 2 h, Hoechst dye for 15 min at 25°C, and washed three times with PBS. Cells were observed using a Nikon TE2000 microscope (Nikon), and data were analyzed using ImageJ software.

[0097] Granulosa cells were seeded in 96-well plates at a density of 2 × 10³ cells per well. After treating cells with the overexpression plasmid ASD for 72 hours, 10 μL of CCK8 reagent was added to each well, and the cells were incubated at 37°C for 3 hours. Finally, the absorbance was measured at 450 nm.

[0098] (5) Enzyme-linked immunosorbent assay (ELISA)

[0099] Following the procedure outlined in the Elabscience ELISA kit for porcine estrogen (Estrogen, E2) or progesterone (Pg), add 50 μL of different concentrations of standards to the standard wells and 50 μL of the sample to be tested to the sample wells. Then add 100 μL of horseradish peroxidase (HRP) and incubate at 37°C for 60 min. After washing, add 50 μL each of substrates A and B and incubate at 37°C for 15 min. Finally, add the stop solution and measure the OD value at 450 nm.

[0100] Example 2: Screening the optimal concentration of ASD in porcine ovarian granulosa cells and systematically evaluating its effects on cell proliferation, apoptosis, and E2 and Pg secretion.

[0101] To further elucidate the regulatory effect of ASD on ovarian function and its optimal working concentration, seven ASD concentration gradients (2.5, 5, 10, 20, 40, 80, 160 nM) were applied to cultured PGCs in vitro, with ddH2O added to the culture medium as a control. Figure 1 As shown in the CCK-8 assay, all seven concentrations of ASD significantly promoted the proliferation activity of PGCs, with the strongest promoting effect observed at the 72-hour treatment time point. Figure 1 A). After treating PGCs with seven different ASDs for 72 hours, the cell culture medium was analyzed by ELISA. The results showed that the promoting effect of ASD on sex hormone secretion in PGCs exhibited a typical dose-dependent characteristic. At a concentration of 40 nM, ASD had the strongest promoting effect on E2 and Pg secretion, while the promoting effect decreased at higher concentrations. Figure 1 (BC). This suggests the existence of an optimal working concentration window. Based on the combined results of CCK-8 and ELISA, 40 nM ASD and 72-hour treatment were selected as the standard conditions for subsequent molecular mechanism studies. To reveal the molecular basis of ASD promoting sex hormone synthesis, qRT-PCR analysis was performed on ASD-treated PGCs. Figure 2As shown, compared with the control group, ASD treatment significantly upregulated the mRNA levels of marker genes involved in steroid hormone synthesis, including steroidogenic acute regulatory protein (STAR), 3β-hydroxysteroid dehydrogenase (3β-HSD), cytochrome P450 family 17 subfamily A member 1 (CYP17A1), cytochrome P450 family 19 subfamily A member 1 (CYP19A1), 17β-hydroxysteroid dehydrogenase 1 (HSD17B1), 17β-hydroxysteroid dehydrogenase 2 (HSD17B2), and 17β-hydroxysteroid dehydrogenase 3. (17β-hydroxysteroid dehydrogenase 3,HSD17B3) ( Figure 2 These results indicate that ASD helps regulate the synthesis and secretion of steroid hormones by progesterone-producing cells (PGCs). To elucidate the biological basis of ASD's role in promoting sex hormone synthesis, the specific effects of ASD on PGC proliferation were further investigated.

[0102] like Figure 3 As shown, EdU detection revealed that, compared to the control group, the EdU-positive cell rate of PGCs significantly increased after 72 hours of treatment with 40 nM ASD ( Figure 3 AB). Further flow cytometry revealed the characteristics of cell cycle changes induced by ASD. ASD treatment significantly reduced the proportion of cells in G1 phase while increasing the proportion of cells in G2 phase (AB). Figure 3 To elucidate the molecular basis of this accelerated cell cycle, the expression of key cell cycle regulatory genes was analyzed. qRT-PCR and Western blotting results showed that the addition of ASD upregulated the mRNA and protein levels of pro-proliferation genes, including CDK4, PCNA, and CCNE1, and downregulated the mRNA level of the anti-proliferation gene p21. Figure 3 These results indicate that ASD promotes the proliferation of PGCs. In addition to promoting proliferation, the effect of ASD on the apoptosis process of PGCs was also examined. Flow cytometry analysis showed that, compared with the control group, ASD treatment significantly reduced the apoptosis rate of PGCs (EF). Figure 3 HI). Further analysis was conducted on the mRNA and protein expression of key apoptosis-regulating genes. qRT-PCR and WB results showed that ASD treatment led to downregulation of the mRNA and protein levels of pro-apoptotic genes caspase9 and BAX, downregulation of the mRNA level of FAS, and upregulation of the mRNA and protein levels of the anti-apoptotic gene BCL2. Figure 3 JL). Therefore, it is believed that ASD can promote the proliferation of PGCs and inhibit their apoptosis, thereby promoting the synthesis of sex hormones.

[0103] Example 3: Effect of ASD on MSMO1 in porcine ovarian granulosa cells

[0104] To investigate the effect of ASD on MSMO1 in porcine ovarian granulosa cells, qRT-PCR and WB were used to detect the expression level of MSMO1 in the cells.

[0105] like Figure 4 As shown, compared with the control group, the mRNA and protein levels of MSMO1 in the ASD group were significantly downregulated. Therefore, it is believed that ASD can inhibit the expression of the MSMO1 gene in PGCs. Figure 4 AC).

[0106] Example 4: Construction and Validation of MSMO1 Overexpression Vector

[0107] To investigate the effects of MSMO1 gene overexpression on ovarian granulosa cell function, the MSMO1 overexpression vector (pcDNA3.1-MSMO1) was transfected into porcine ovarian granulosa cells to explore the effects of MSMO1 overexpression on ovarian granulosa cell proliferation, apoptosis, and E2 and Pg secretion. The MSMO1 overexpression vector was constructed as follows: First, the CDS region (protein-coding region) of MSMO1 was amplified by PCR. After sequencing verification, a normal plasmid was extracted. Then, the normal plasmid and pcDNA3.1 vector were double-digested, ligated, transformed, and single-clone selection was performed for sequencing verification. Finally, an endotoxin-free plasmid was extracted. The extracted endotoxin-free plasmid was double-digested to verify the successful construction of the MSMO1 overexpression vector (all steps were performed by GenePharma). Overexpression was performed using the pcDNA3.1-MSMO1 plasmid, with pcDNA3.1-NC used as a control.

[0108] like Figure 5 As shown, qRT-PCR and WB results revealed a significant upregulation of MSMO1 mRNA and protein levels. This indicates that the MSMO1 overexpression vector was successfully constructed. Figure 5 AC).

[0109] Example 5: Effects of MSMO1 overexpression on proliferation, apoptosis, and E2 and Pg secretion function of porcine ovarian granulosa cells

[0110] porcine ovarian granulosa cells were transfected with pcDNA3.1-MSMO1 and pcDNA3.1-NC, respectively. The effects of MSMO1 overexpression on granulosa cell proliferation, apoptosis-related genes, and E2 and Pg secretion were detected using qRT-PCR and ELISA, respectively. Figure 6 As shown, ELISA results indicated a significant downregulation of E2 and Pg levels in the culture medium. Figure 6 AB). Meanwhile, qRT-PCR results indicated that the mRNA expression of STAR, CYP11A1, 3β-HSD, CYP17A1, CYP19A1, HSD17B1, HSD17B2, and HSD17B3 was significantly downregulated. Figure 6 CJ). These results indicate that MSMO1 overexpression inhibits the synthesis and secretion of steroid hormones in PGCs. To further investigate the mechanism by which MSMO1 affects the synthesis and secretion of steroid hormones in PGCs, qRT-PCR was used to determine the effect of MSMO1 overexpression on the mRNA levels of proliferation and apoptosis marker genes, including CDK4, PCNA, CCNE1, CDC20, p21, p27, FAS, BAX, caspase3, caspase9, BAK1, and BCL2. MSMO1 overexpression downregulated the mRNA expression levels of pro-proliferation genes CDK4, PCNA, CCNE1, and CDC20, and upregulated the mRNA expression levels of anti-proliferation genes p21 and p27. Simultaneously, MSMO1 overexpression upregulated the mRNA expression levels of pro-apoptotic genes FAS, BAX, caspase3, caspase9, and BAK1, and downregulated the mRNA expression level of the anti-apoptotic gene BCL2. Figure 6 Therefore, it is believed that overexpression of MSMO1 can inhibit the proliferation of PGCs and the synthesis and secretion of steroid hormones, and promote their apoptosis.

[0111] Example 6: Adding ASD reversed the negative effect of MSMO1 overexpression on porcine ovarian granulosa cells and restored their function.

[0112] To further confirm that MSMO1 participates in the signaling axis of ASD-regulated PGC function, three treatment groups were set up: DM (ddH2O + pcDNA3.1-MSMO1), AM (ASD + pcDNA3.1-MSMO1), and AP (ASD + pcDNA3.1-NC). ELISA results showed that the DM group had the lowest concentrations of E2 and Pg in the cell culture medium, while there was no significant difference between the AM and AP groups. Figure 7AB). qRT-PCR detection of steroid hormone biosynthesis marker genes (STAR, CYP11A1, 3β-HSD, CYP17A1, CYP19A1, HSD17B1, HSD17B2, HSD17B3) revealed a gradient in expression levels: highest in AP, intermediate in AM, and lowest in DM. Figure 7 C). This suggests that ASD enhances steroid production in PGCs, while MSMO1 overexpression antagonizes this process. To further elucidate the molecular mechanism by which MSMO1 overexpression antagonizes ASD-promoted steroid hormone synthesis and release in PGCs, cell proliferation was detected using CCK8 assays. The results showed that cell proliferation was highest in AP, intermediate in AM, and lowest in DM. Figure 8 A). At the molecular level, the mRNA and protein levels of MSMO1 and proliferative genes (CDK4, PCNA, CCNE1) were all "highest AP, intermediate AM, and lowest DM," while the mRNA level of the anti-proliferative gene (p21) showed "highest DM, intermediate AM, and lowest AP." Figure 8 (BD). Apoptosis detection showed that the apoptosis rate was highest in DM, and there was no significant difference between AM and DM. Figure 8 EF). The expression of pro-apoptotic genes caspase9 and BAX mRNA and protein was consistent with this, as was the level of FAS mRNA. The mRNA and protein levels of the anti-apoptotic gene BCL2 were "highest in AP, intermediate in AM, and lowest in DM" (EF). Figure 8 In summary, MSMO1 overexpression can antagonize the effects of ASD on the steroid synthesis and secretion, proliferation, and anti-apoptosis of PGCs.

[0113] The above description is merely a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principles of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. Application of androstenedione in regulating MSMO1 expression in porcine ovarian granulosa cells, characterized in that, The specific application is in regulating the proliferation, apoptosis, and / or E2 and Pg secretion of porcine ovarian granulosa cells.

2. The application of androstenedione in regulating MSMO1 expression in porcine ovarian granulosa cells according to claim 1, characterized in that, The application includes any of the following: 1) In vitro, the addition of androstenedione inhibited MSMO1 expression and promoted the proliferation of porcine ovarian granulosa cells; 2) In vitro, the addition of androstenedione inhibited MSMO1 expression and suppressed apoptosis in porcine ovarian granulosa cells; 3) In vitro, the addition of androstenedione to inhibit MSMO1 expression can promote E2 secretion from porcine ovarian granulosa cells. 4) In vitro, the addition of androstenedione to inhibit MSMO1 expression can promote Pg secretion from porcine ovarian granulosa cells.

3. The application according to claim 2, characterized in that: The functional phenotype of inhibiting the proliferation of porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery after the addition of androstenedione to ovarian granulosa cells. The functional phenotype that promotes apoptosis in porcine ovarian granulosa cells after MSMO1 addition tends to be restored upon the addition of androstenedione to ovarian granulosa cells. The functional phenotype of inhibiting E2 secretion by porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery upon the addition of androstenedione to ovarian granulosa cells. The functional phenotype of inhibiting Pg secretion by porcine ovarian granulosa cells caused by the addition of MSMO1 showed a trend of recovery upon the addition of androstenedione to ovarian granulosa cells.

4. The application according to any one of claims 2 to 3, characterized in that: The concentration of androstenedione was 40 nM.

Images