Pigeon fibroblast cell strain x4 and its use
By inducing pigeon tumors with chemical mutagens to isolate pigeon fibroblast cell line X4, the problem of cell line shortage in pigeon virus research was solved, and pigeon virus was effectively isolated and amplified, thus promoting in-depth research on pigeon diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-04-07
AI Technical Summary
The lack of commercially available specific pathogen-free duck embryo and pigeon-derived cell lines suitable for pigeon virus research makes it difficult to isolate pigeon viruses, thus limiting research on pigeon viral diseases and vaccine development.
By inducing tumors in American King pigeons using the chemical mutagen diethylnitrosamine, pigeon fibroblast cell line X4 was isolated and cultured from the liver tumors. A cell line suitable for pigeon virus infection and amplification was established using stepwise enzymatic digestion and differential adhesion.
It provides a cell line suitable for pigeon virus research, capable of infecting a variety of avian viruses, and is used for virus isolation, amplification, pathogenic mechanism research, and vaccine development. It also demonstrates for the first time the risk of cross-species transmission of IBDV, thus promoting in-depth research on pigeon diseases.
Smart Images

Figure CN121472137B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of animal cell engineering, and particularly relates to a pigeon fibroblast cell strain X4 and application thereof. BACKGROUND
[0002] With the rapid development of China's economy and the improvement of people's living standards, pigeons have become the fourth largest domestic poultry after chickens, ducks and geese in China. In recent years, with the rapid development of pigeon breeding industry, the large-scale breeding of meat pigeons has gradually replaced the family scattered breeding mode. The types and incidence of pigeon diseases are increasing, which has gradually become one of the bottlenecks restricting the development of this industry. Pigeon viral diseases mainly include pigeon Newcastle disease, pigeon pox, pigeon avian influenza and pigeon adenovirus disease, which have the characteristics of multiple infections and great harm. Compared with other poultry disease research, the current research on pigeon disease is not deep enough.
[0003] The isolation of pigeon viruses is mostly through chicken-derived cell lines, chicken embryos or duck embryos. However, there is no commercial specific pathogen free (SPF) duck embryo at home and abroad at present, and the use of conventional duck embryos to isolate pigeon viruses has the problems of endogenous virus interference, which affects the isolation of pigeon viruses; some pigeon-derived viruses cannot adapt to chicken-derived cell lines or chicken embryos, which limits the research of pigeon viral diseases. Using cell lines with safety and consistency for product preparation is the best alternative to egg embryos and primary cells. Considering animal welfare and other factors, using in vitro biological systems instead of in vivo animal model systems to identify cells suitable for virus growth is favored by researchers and enterprises.
[0004] Currently, there are some avian cell lines. Chicken fibroblast cell line DF-1 is a spontaneously immortalized cell line prepared by continuous passage, screening of proliferative stable and morphologically uniform fibroblasts without exogenous gene transduction (US Patent Application US5672485 and US6207415). US Patent Application US6255108 introduces immortalization genes and anti-apoptosis genes into duck fibroblasts by vector pDAMT, screens with G418, passes the resistant cells, and proliferates the surviving cells to obtain duck fibroblast cell line TDF-2A. PCT International Application WO97 / 08307 establishes quail fibroblast cell line QT-6 by inducing quail fibrosarcoma with chemical mutagen methylcholanthrene. QT6 subclone establishes quail fibrosarcoma cell line QT-VC. Chinese Patent Application CN104152403A combines the methods of adherence, differential enzyme digestion and monoclonal screening to establish goose epithelial cell line from primary goose embryo tissue. Chinese Patent Application CN104726409A uses liposome transfection to introduce eukaryotic expression plasmid encoding hTERT and Marker genes into primary cultured duck embryo liver cells, screens the hTERT positive clones with G418, and continuously cultures for more than 50 passages to obtain immortalized duck embryo liver cell line. So far, there is no related report on cell lines derived from pigeons at home and abroad. SUMMARY
[0005] To develop pigeon cell lines, the present application uses chemical mutagen diethyl nitrosamine to induce tumors in American king pigeons, isolates and cultures cells from liver tumors, uses stepwise enzyme digestion and differential adherence method to obtain a cell in shuttle or star-shaped polybulb shape, named X4. Cell X4 has good proliferation and differentiation capacity after freezing, recovery and passage. PCR and sequencing identification prove that cell X4 is a fibroblast cell derived from pigeons. Viral infection experiment accidentally finds that pigeon fibroblast cell X4 can be infected by infectious bursal disease virus (IBDV).
[0006] The present application provides a pigeon fibroblast cell strain, named pigeon fibroblast cell X4, with preservation number CGMCC No. 46754.
[0007] The pigeon fibroblast cell strain is isolated from pigeon liver tumors induced by intramuscular injection of diethyl nitrosamine into pigeons.
[0008] The present application also provides the application of the pigeon fibroblast cell strain in isolation of viruses or virus amplification, wherein the virus is a virus capable of infecting birds.
[0009] The pigeon fibroblast cell strain can be used in screening or preparing a vaccine for preventing viral infection of poultry.
[0010] In the application, the viruses include Pigeon adenovirus (PiAdV), Pigeon circovirus (PiCV), Pigeon herpesvirus 1 (PHV1), Pigeon newcastle disease virus (PNDV), Pigeonpox virus (PPV), Avian influenza virus (AIV), or Infectious bursa disease virus (IBDV).
[0011] In the application, the poultry includes pigeons and chickens.
[0012] The application further provides a method for preparing pigeon fibroblast cells, which comprises the following steps: (1) inducing a pigeon to form a tumor by intramuscular injection of diethyl-nitrosamine at a dose of 20-100 mg / kg of the pigeon body weight once a week for 50 weeks; and (2) isolating pigeon fibroblast cells from the tumor.
[0013] In some embodiments of the method, in step (1), the diethyl-nitrosamine is injected at a dose of 20 mg / kg of the pigeon body weight in the first week, 50 mg / kg of the pigeon body weight in the second week, and 100 mg / kg of the pigeon body weight per week starting from the third week; and in step (2), a tumor tissue block is taken from the pigeon, washed, cut into tissue fragments with a size of 1-2 mm3, and then digested with a hydrolytic enzyme after washing the tissue fragments, the obtained cells are cultured, and the pigeon fibroblast cells are isolated.
[0014] In the method, the tumor tissue block or the tissue fragments can be washed with Hank's balanced salt solution, phosphate buffered saline (PBS, pH 7.4), or serum-free cell culture medium. The tissue fragments can be digested with collagenase, hyaluronidase, or trypsin. The activity of the hydrolytic enzyme can be neutralized by adding fetal bovine serum or complete medium, the digested tissue fragments are blown with a pipette, the undigested tissue fragments are removed through a cell strainer or a filter screen, and the cells are collected by centrifugation.
[0015] Experiments prove that the pigeon fibroblast cell X4 can be infected by the infectious bursal disease virus (IBDV). The pigeon fibroblast cell X4 infected by the IBDV shows cell rounding, shrinkage, and other cell pathologies. Figure 6). Immunofluorescence staining confirmed the sensitivity of pigeon fibroblast X4 to IBDV infection Figure 7 IBDV mainly causes acute and highly contagious disease in young chickens (3-8 weeks old), which invades the central immune organ of chickens, the bursa of Fabricius, leading to immunosuppression, increased susceptibility to other pathogens, and reduced vaccine reactivity. The present application first found that IBDV can infect cells derived from pigeons, indicating the risk of cross-species transmission of IBDV.
[0016] Pigeon fibroblast X4 can be used for virus isolation or amplification, virus pathogenesis research, and development of antiviral drugs and vaccines, and the virus can be pigeon adenovirus, pigeon circovirus, pigeon herpesvirus, pigeon Newcastle disease virus, pigeon poxvirus, pigeon avian influenza virus, or infectious bursal disease virus (IBDV). The present application first provides a cell strain (line) derived from pigeons, which has good application prospects in pigeon disease research.
[0017] The pigeon fibroblast cell strain provided by the present application has been deposited for patent, and the deposit information is as follows:
[0018] Biological material: X4
[0019] Scientific description: Pigeon liver fibroblast cells
[0020] Deposit number: CGMCC No. 46754
[0021] Date of deposit: November 21, 2025
[0022] Depository: China General Microbiological Culture Collection Center (CGMCC)
[0023] Address: No. 3, Yikhuan, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 . Photograph of the liver of a 50-week-old American king pigeon injected intramuscularly with a chemical mutagen diethyl nitrosamine, showing diffuse white tumor nodules on the liver.
[0025] Figure 2 . Microscope photograph of primary pigeon tumor cells isolated from the tumor nodules of the liver (400 times magnification).
[0026] Figure 3 . Microscope photograph of cell X4 isolated from primary pigeon tumor cells (400 times magnification).
[0027] Figure 4. Agarose gel electrophoresis map of PCR identification of cell source of cell X4; M is molecular weight marker DL2000; lane 1 is PCR product of primers L48841 and H15149 using DNA of chicken LMH cells as template; lane 2 is PCR product of primers L48841 and H15149 using DNA of cell X4 as template.
[0028] Figure 5 . Agarose gel electrophoresis map of RT-PCR identification of cell type of cell X4; M is molecular weight marker DL2000; lane 1 is PCR product of gene amplification primers pV-1F / pV-1R of vimentin, lane 2 is PCR product of gene amplification primers pV-2F / pV-2R of vimentin, lane 3 is PCR product of gene amplification primers pV-3F / pV-3R of vimentin; lane 4 is PCR product of gene amplification primers pFi-1F / pFi-1R of fibronectin, lane 5 is PCR product of gene amplification primers pFi-2F / pFi-2R of fibronectin; lane 6 is PCR product of gene amplification primers pEP-1F / pEP-1R of epithelial cell adhesion molecule, lane 7 is PCR product of gene amplification primers pEP-2F / pEP-2R of epithelial cell adhesion molecule.
[0029] Figure 6 . Result of infection of pigeon fibroblast cell X4 with infectious bursal disease virus (IBDV); left panel is microscope photograph (400 times magnification) of pigeon fibroblast cell X4 without inoculation of IBDV (blank control); right panel is microscope photograph (400 times magnification) of pigeon fibroblast cell X4 72 h after infection with IBDV, showing cell rounding and crinkled cytopathic effect.
[0030] Figure 7 . Immunofluorescence staining result of pigeon fibroblast cell X4 after infection with IBDV; from top to bottom, the first row is microscope photograph (400 times magnification) of chicken DF-1 cell infected with IBDV (positive control), the second row is microscope photograph (400 times magnification) of pigeon fibroblast cell X4 without inoculation of IBDV (negative control), and the third row is microscope photograph (400 times magnification) of pigeon fibroblast cell X4 24 h after infection with IBDV. DETAILED DESCRIPTION
[0031] The technical solutions of the present application are described in detail below in conjunction with examples. The following examples are only used to explain and illustrate the present application, and should not be regarded as limiting the scope of the present application.
[0032] Biological materials used in the following examples:
[0033] Chicken-derived LMH cells are an epithelial-like cell line established from chicken hepatocarcinoma, which is available for purchase under the cell number ATCC CRL-2117 at the American Type Culture Collection (ATCC). DF-1 cells are a passable chicken embryo fibroblast cell line, which is available for purchase under the cell number ATCC CRL-3586 at the American Type Culture Collection (ATCC). The infectious bursal disease virus (IBDV) BJQ902 strain is described in the known document “Zhang Z, Li L, Jing X, et al. Proliferation of infectious bursal disease virus BJQ902 strain in DF-1 cell line. Chinese Journal of Animal Husbandry and Veterinary Medicine. 2016; 43(10): 2775-2779.” and is available from the Beijing Academy of Agriculture and Forestry Sciences Institute of Animal Husbandry and Veterinary Medicine for necessary verification experiments only. Anti-IBDV antibody is a monoclonal antibody obtained by immunizing BALB / c mice with the VP2 protein of the chicken infectious bursal disease virus BJQ902 strain according to the conventional method, provided by the Beijing Academy of Agriculture and Forestry Sciences Institute of Animal Husbandry and Veterinary Medicine.
[0034] Some reagents used in the following examples:
[0035] Diethyl nitrosamine (chemical formula: (C2H5)2NNO, CAS number: 55-18-5) and collagenase type IV were purchased from Sigma-Aldrich. 0.25% trypsin-EDTA, 0.25% trypsin, Hank’s balanced salt solution (HBSS), Waymouth medium, fetal bovine serum and non-essential amino acids were purchased from the American Gibco Life Sciences Company. DAPI (4', 6-diamidino-2 phenylindole) was purchased from the Thermo Fisher Scientific Company.
[0036] Unless specific techniques are indicated in the examples, the techniques or conditions described in the literature in the art or according to the product instructions are followed. Unless the manufacturer is indicated in the examples, all reagents or instruments used in the examples are considered to be available for purchase on the market. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which the present application belongs.
[0037] Example 1. Obtaining of pigeon fibroblast X4
[0038] 1. Culture of primary cells
[0039] The American king pigeons, male, 3.5 months old, were from a pigeon farm in Hebei province and were raised in an air-conditioned room. The American king pigeons were injected with diethyl nitrosamine once a week. In the first week, the pigeons were injected at a dose of 20 mg / kg of pigeon body weight, in the second week, the pigeons were injected at a dose of 50 mg / kg of pigeon body weight, and from the third week, the pigeons were injected at a dose of 100 mg / kg of pigeon body weight every week, for a total of 50 weeks. After the injection was completed, the pigeons were in a dying state. The pigeons were euthanized, and the liver was dissected. The pigeon liver was enlarged, and there were diffuse white tumor nodules on the liver, two of which were about the size of a soybean Figure 1 ).
[0040] The tumor nodules were isolated from the pigeon liver, and the tumor tissue pieces were transferred to a dish containing phosphate buffered saline (PBS, pH 7.4) for washing, then transferred to a 50 mL centrifuge tube, and cut into 1-2 mm3size tissue fragments with scissors; the tissue fragments were washed with phosphate buffered saline (PBS, pH 7.4) until no blood stains were observed, the supernatant was discarded, and a digestion solution (1 mg / mL of collagenase type IV / PBS) was added to digest the tissue fragments at 37°C for 30 min; the digested material was collected, and fetal bovine serum was added to stop the digestion; the remaining undigested tissue was added to the digestion solution (1 mg / mL of collagenase type IV / PBS) and continued to be digested at 37°C for 30 min; the digested tissue fragments were blown and the digestion suspension was centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and Waymouth medium (Gibco) was added and blown evenly, then filtered through a 70 μm cell sieve to remove undigested tissue fragments, and fetal bovine serum was added to a final concentration of 20%, and the cells were cultured at 37°C in a 5% CO2 incubator and observed Figure 2 ).
[0041] 2. Purification and subculture of cells
[0042] The cells isolated from the liver tumor of a king pigeon in the United States formed a monolayer after being cultured in a 37°C, 5% CO2 incubator for several days. When the cells were first cultured, round epithelioid cells and macrophages were observed. The cells that would soon be detached were collected in a centrifuge tube containing complete culture medium (based on Waymouth medium, supplemented with 10% fetal bovine serum and 1% non-essential amino acids) by stepwise digestion with 0.25% trypsin-EDTA (Gibco), and fresh 0.25% trypsin-EDTA (Gibco) was added to the cell bottle for re-digestion; the first detached cells were centrifuged at 1000 rpm for 5 min and inoculated into a culture bottle; the collected cell suspension was inoculated into a culture bottle using differential adhesion purification, and after being left to stand at 37°C for 30 min, the non-adherent cells were removed to further enrich the fibroblasts. The cells were subcultured every 4-5 days, and after several passages, the epithelioid cells and macrophages gradually decreased. After multiple rounds of digestion and differential adhesion purification, cells in a spindle or star-shaped polylobal shape were isolated (Fig. 1) Figure 3 ), which were named X4. The cell X4 had good proliferation and differentiation capacity after being frozen, thawed, and subcultured.
[0043] 3. Pigeon origin identification of cells
[0044] The cells X4 that had grown into a monolayer were discarded, the culture medium was washed away with sterile phosphate buffered saline (PBS, pH 7.4), and the cells were digested with 0.25% trypsin (Gibco). 1 mL of the digested cells, about 5x10^6 / mL, was used to extract the genomic DNA of the cells using the HyperMB Extracting Animal Tissue / Cell Genomic PCR Direct Amplification Kit (Shenguo Bioengineering Co., Ltd., Catalog No. B690020) according to the operating instructions. The genomic DNA of the cells was used as the template, and the primers L14841-F and H15149-R were used to perform polymerase chain reaction (PCR) according to the following reaction system and reaction procedure. After the reaction, the PCR products were detected by 1.5% agarose gel electrophoresis. Chicken-derived LMH cells were used as a positive control, and the experimental steps were the same as those for cell X4.
[0045] The nucleotide sequences of the primers are as follows:
[0046] L14841-F: 5'-AAAAAAGCTTCCATCCAACATCTCAGCATGATGAAA-3' (SEQ ID NO: 1)
[0047] H15149-R: 5'-AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA-3' (SEQ ID NO: 2)
[0048] PCR reaction system: 2x Taq Plus Master Mix II, 25 μL; upstream primer (10 μM), 2.5 μL; downstream primer (10 μM), 2.5 μL; cell genomic DNA, 4 μL; ddH2O, 16 μL. PCR reaction procedure: 95℃ 5 min; (95℃ 30 s, 55℃ 30 s, 72℃ 30 s) 30 cycles; 72℃ 7 min.
[0049] The results are shown in Figure 4 As shown in the results, a 377 bp target fragment was amplified from the genomic DNA of cell X4, which was consistent with the expected size of the target fragment. The PCR product of cell X4 was sequenced, and the determined sequence was subjected to BLAST comparison (https: / / blast.ncbi.nlm.nih.gov / ). The comparison results showed that the nucleotide sequence of the PCR product of cell X4 had 100% homology with the nucleotide sequence of pigeon cytochrome b gene (GenBank: AY509674.1), so it was determined that cell X4 was a pigeon-derived cell.
[0050] The nucleotide sequence of the PCR product of cell X4 is as follows:
[0051] AAAAAAGCTTCCATCCAACATCTCAGCATGATGAAACTTTGGGTCCCTACTAGGCATTTGCTTGCTAACTCAAATCCTAACCGGCTTACTACTCGCCGCACATTACACTGCAGACACCACCCTAGCCTTTTCATCCGTTGCACACACATGCCGAAACGTACAGTACGGCTGGCTAATCCGAAACCTCCATGCAAACGGAGCCTCATTTTTCTTCATCTGTATTTACCTACACATCGGACGAGGACTCTACTACGGATCCTACCTCTACAAAGAGACTTGAAACACAGGAGTCGTCCTCCTACTAACCCTTATAGCCACTGCATTCGTAGGATATGTCCTACCCTGAGGACAAATATCATTCTGAGGGGCTGCAGTTT (SEQ ID NO: 3)
[0052] 4. Type identification of cells
[0053] The cells X4 grown into a single layer were discarded with the culture solution, the cells were washed once with sterile phosphate buffer solution (PBS, pH 7.4), 0.25% trypsin (Gibco) was added for digestion, 1 mL of the digested cells, about 5x10^6 / mL cells, were taken, and total RNA of the cells was extracted using an RNA Easy Fast animal tissue / cell total RNA extraction kit (Tiangen, catalog number: DP451) according to the instructions of the kit. Reverse transcription was performed using a HiScript III 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Novoprotein, item number: R312) according to the instructions of the kit, and cDNA was obtained. The cDNA of the cells X4 was used as a template for PCR to detect the coding genes of vimentin, fibronectin and epithelial cell adhesion molecule EPCAM, respectively, wherein vimentin and fibronectin are specific proteins of fibroblasts, and epithelial cell adhesion molecule EPCAM is a specific protein of epithelial cells.
[0054] Three pairs of PCR primers for detecting the coding gene of vimentin (NCBI: XM_005507944.3) were pV-1F / pV-1R (the length of the amplified fragment was 419 bp), pV-2F / pV-2R (the length of the amplified fragment was 492 bp) and pV-3F / pV-3R (the length of the amplified fragment was 509 bp). The nucleotide sequences of the primers were as follows:
[0055] pV-1F: CGCTCCCGGATTACAAAG (SEQ ID NO: 4)
[0056] pV-1R: CCAGCTCGGCCACCAGGAT (SEQ ID NO: 5)
[0057] pV-2F: AACACCCTGCAGTCCTTCC (SEQ ID NO: 6)
[0058] pV-2R: ACGGCCGATAGTGTCTTGGTA (SEQ ID NO: 7)
[0059] pV-3F: GATTAACATGCCTATTCCAACC (SEQ ID NO: 8)
[0060] pV-3R: AACACATCAAGAGCCATTTTC (SEQ ID NO: 9)
[0061] The two pairs of PCR primers for detecting the fibronectin (NCBI: XM_065073843.1) encoding gene were pFi-1F / pFi-1R (the length of the amplified fragment was 429 bp) and pFi-2F / pFi-2R (the length of the amplified fragment was 470 bp), respectively. The nucleotide sequences of the primers were as follows:
[0062] pFi-1F: GGTGTCCGGAGGGTGGTGGTTA (SEQ ID NO: 10)
[0063] pFi-1R: CATTGCTCGCTCCGTTGTGG (SEQ ID NO: 11)
[0064] pFi-2F: CCCTTGCCTCCTCGGTTAGA (SEQ ID NO: 12)
[0065] pFi-2R: AGGCCTGAGATGTGGAATGTGGTC (SEQ ID NO: 13)
[0066] The two pairs of PCR primers for detecting the epithelial cell adhesion molecule EPCAM (NCBI: XM_065058740.1) encoding gene were pEP-1F / pEP-1R (the length of the amplified fragment was 517 bp) and pEP-2F / pEP-2R (the length of the amplified fragment was 450 bp), respectively. The nucleotide sequences of the primers were as follows:
[0067] pEP-1F: AGGCCGTCGTGAGAAACCAAAAGA (SEQ ID NO: 14)
[0068] pEP-1R: TTCAAAGTAGTAGGCCACATCAGC (SEQ ID NO: 15)
[0069] pEP-2F: TTAGGAGAACTGACAAACAAGATG (SEQ ID NO: 16)
[0070] pEP-2R: ACTACTACAATGACAGCAATGAGG (SEQ ID NO: 17)
[0071] PCR reaction system: 2x Taq Plus Master Mix II, 25 μL; upstream primer (10 μM), 2.5 μL; downstream primer (10 μM), 2.5 μL; cell cDNA, 4 μL; ddH2O, 16 μL. PCR reaction procedure: 95℃, 5 min; (95℃ 30 s, 55℃ 30 s, 72℃ 60 s) 30 cycles; 72℃, 7 min. After the reaction, the PCR product was detected by 1% agarose gel electrophoresis.
[0072] The results are shown in Table 1. Figure 5 As shown in Table 1, from the cDNA of cell X4, the primer pair pV-1F / pV-1R amplified a vimentin gene fragment of about 420 bp, the primer pair pV-2F / pV-2R amplified a vimentin gene fragment of about 500 bp, the primer pair pV-3F / pV-3R amplified a vimentin gene fragment of about 500 bp, which were consistent with the expected size of the target fragment; the primer pair pFi-2F / pFi-2R amplified a fibronectin gene fragment of about 500 bp, which was consistent with the expected size of the target fragment; and the two primer pairs of the epithelial cell adhesion molecule gene did not amplify a fragment.
[0073] The X4-vimentin fragment amplified by the primer pair pV-2F / pV-2R (hereinafter referred to as X4-vimentin fragment) and the X4-fibronectin fragment amplified by the primer pair pFi-2F / pFi-2R (hereinafter referred to as X4-fibronectin fragment) were sequenced. The results showed that the X4-vimentin fragment had 100% homology with the nucleotide sequence of pigeon vimentin mRNA with NCBI accession number XM_005507944.3; the X4-fibronectin fragment had 100% homology with the nucleotide sequence of the III type domain translation variant X3 mRNA of pigeon fibronectin containing 3B with NCBI accession number XM_065073843.1, so it was determined that cell X4 was a pigeon fibroblast.
[0074] The nucleotide sequence of the X4-vimentin fragment is as follows:
[0075] AACACCCTGCAGTCCTTCCGACAGGATGTTGACAATGCCTCTCTGGCACGTCTTGATCTGGAGCGCAAAGTTGAGTCTCTGCAAGAGGAGATTGTCTTCTTGAAGAAGCTTCATGATGAGGAAATCCGAGAACTCCAGGCCCAACTCCAGGAACAGCACATCCAAATTGATATGGATGTTTCCAAGCCTGATCTTACTGCTGCCCTGCGTGACGTTCGCCAACAGTACGAAAGCGTTGCTGCTAAGAACCTTCAGGAAGCTGAAGAGTGGTACAAGTCCAAATTTGCAGATCTCTCCGAAGCTGCTAATAGGAACAACGACGCCCTGCGCCAGGCCAAACAAGAAGCCAATGAATACCGCAGGCAGATTCAGTCTCTCACCTGCGAAGTTGATGCTCTTAAGGGAAGCAATGAATCCCTGGAGCGCCAGATGCATGAAATGGAGGAGAATTTTGCTGTTGAAGCTGCTAACTACCAAGACACTATCGGCCGT (SEQ ID NO: 18)
[0076] The nucleotide sequence of the X4-fibronection fragment is as follows:
[0077] CCCTTGCCTCCTCGGTTAGAGTGTGCTGCAGCAGGTCCTCAGAGCCTGAAGCTGAAATGGGGAGACAGCAGTTCCAAGCTTCACGCTACCGATGACATGGTCTATATCTTGCAGATAGAAGACAGAAATAAAAGGTTTATTCCCATTTATAGGGGACCAAGTCACACGTACAAGATACAGAGGCTGACAGAATCCACTTGTTACTCATTCAGAATACAGGCGGTCAATGATGCAGGGGAGGGACCTTTCTCAGAAGTCTGTACTTTCTGCACAACTAAGTCAGTCCCACCTGCTATCAAAGCCCCTCGAGTGACACAGTTGGGAGGAAACGCCTGTGAAATTACCTGGGAAATGGTCCCACCCATCAAGGGAGATCCTGTTAGTTACACTCTGCAGGTACTGGTTGGGAGAGAATCTGAATACAAGCAGGTGTACAAGGGAGAAGAGACCACATTCCACATCTCAGGCCT (SEQ ID NO: 19)
[0078] 5. Cell preservation
[0079] The cell X4 was sent to the China General Microbiological Culture Collection Center (CGMCC) for preservation, with the preservation number CGMCC No. 46754, the preservation name X4, and the preservation date November 21, 2025.
[0080] Example 2. Verification of the sensitivity of pigeon fibroblast cell X4 to infectious bursal disease virus (IBDV) infection
[0081] 1. Infecting pigeon fibroblast cell X4 with IBDV
[0082] When the pigeon fibroblast cell X4 grew to 80% monolayer, the culture solution was aspirated; the pigeon fibroblast cell X4 was inoculated with the infectious bursal disease virus (IBDV) BJQ902 strain at an amount of 10 MOI (multiplicity of infection), and adsorbed at 37°C for 1 h; the cell surface unadsorbed virus solution was washed away with 5 mL of Hank's balanced salt solution (HBSS); the Waymouth medium (Gibco) containing 2% fetal bovine serum was supplemented, and the cells were cultured at 37°C. At the same time, a blank control was set, which was the pigeon fibroblast cell X4 without inoculation of IBDV. The results showed that on the 3rd day of infection of the pigeon fibroblast cell X4 with IBDV, the cells began to round and shrink, and cytopathic effect (CPE) appearedFigure 6 The cell morphology of the blank control was normal (Fig. 1, right). The cell morphology of the IBDV infected cell was abnormal (Fig. 1, left). Figure 6
[0083] The IBDV infected cell X4 showing cytopathic effect 6 days after infection was stored in a freezer at -80°C. The IBDV containing cell was thawed and frozen 3 times, and the cell supernatant was obtained. The harvested IBDV was measured for TCID50 on DF-1 cells (ATCC CRL-3586), and the TCID50 of the virus was 10 7.3 TCID50 was measured according to the method described in "Fundamentals and Experimental Techniques of Medical Virology" (Huang Cengxiang, ed., Science Press).
[0084] The IBDV infected cell X4 showing cytopathic effect 6 days after infection was stored in a freezer at -80°C. The IBDV containing cell was thawed and frozen 3 times, and the cell supernatant was obtained. The harvested IBDV was measured for TCID50 on DF-1 cells (ATCC CRL-3586), and the TCID50 of the virus was 10 3.9 .
[0085] The above results show that the pigeon fibroblast cell X4 can be infected by infectious bursal disease virus (IBDV), and can be used for virus isolation or amplification, virus pathogenesis research, and development of antiviral drugs and vaccines.
[0086] 2. Immunofluorescence detection of IBDV infected pigeon fibroblast cell X4
[0087] The infectious bursal disease virus (IBDV) BJQ902 strain was diluted 1:100 with serum-free cell culture medium, and 100 μL was inoculated into a 24-well plate of pigeon fibroblast X4 monolayers. The pigeon fibroblast X4 cells infected with IBDV were cultured for 24 h, and the cell culture medium in the 24-well plate was discarded. 0.5 mL of PBS (pH 7.4) was added to each well to gently wash the cell surface and discard the PBS as much as possible. 0.5 mL of cold acetone ethanol (the volume ratio of acetone to ethanol was 1:1) was added to each well, and the plate was placed at room temperature for 10 min of fixation. The fixing solution was discarded. The cell surface was washed with 0.5 mL of PBS (pH 7.4) for 5 times. 0.5 mL of blocking solution (containing 2% bovine serum albumin in PBS) was added to each well, and the plate was placed at room temperature for 30 min of blocking. 250 μL of anti-IBDV antibody (a monoclonal antibody obtained by immunizing BALB / c mice with the VP2 protein of the IBDV BJQ902 strain, prepared by the Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agricultural and Forestry Sciences) diluted 1:1000 with the blocking solution was added to each well, and the plate was placed at room temperature for 1 h. The anti-IBDV antibody was discarded, and the cell surface was washed with 0.5 mL of PBS (pH 7.4) for 5 times, and the washing solution was discarded as much as possible. 250 μL of secondary antibody (AF488-labeled goat anti-mouse IgG, ThermoFisher, item number 11017) diluted 1:1000 with the blocking solution was added to each well, and the plate was placed at room temperature for 1 h. The secondary antibody was discarded, and the cell surface was washed with 0.5 mL of PBS (pH 7.4) for 5 times, and the washing solution was discarded as much as possible. 1:1000 diluted DAPI (4', 6-diamidino-2 phenylindole) was added to each well, and the plate was placed at room temperature for 5 min of light protection. The cell surface was washed with 0.5 mL of PBS (pH 7.4) for 5 times. At the same time, DF-1 cells (ATCC CRL-3586) infected with the IBDV BJQ902 strain were used as a positive control, and pigeon fibroblast X4 cells not infected with IBDV were used as a negative control, and the experimental procedures were the same as above. Finally, the cells were placed under an inverted fluorescence microscope, and observed with blue excitation light (wavelength 490 nm).
[0088] The results showed that the pigeon fibroblast X4 cells infected with IBDV exhibited strong green fluorescence with complete cell morphology (the bottom row); Figure 7 The cells not infected with IBDV were not colored and the field was dark (the middle row). Figure 7
Claims
1. Pigeon fibroblast cell line, named Pigeon Fibroblast X4, with accession number CGMCC No. 46754.
2. The use of the pigeon fibroblast cell line of claim 1 in the isolation or amplification of viruses, wherein the virus is infectious bursal disease virus.
Citation Information
Patent Citations
Method for establishing goose embryo epithelial cell line and established goose embryo epithelial cell line
CN104152403A
Preparation method and applications of immortalized duck embryo hepatic cell line
CN104726409A
Immortalized cell lines for virus growth
US5672485A
Immortalized cell lines and methods of use
US6207415B1
Immortal avian cells
US6255108B1