RNA sequences, inhibitors and related uses for treating myocardial remodeling diseases

Abstract

According to the RNA sequence for treating the myocardial remodeling disease, the inhibitor and the related application provided by the invention, a correlation test of the expression level of CMBAR in a human heart failure heart tissue and the expression level of a myocardial cell remodeling marker gene proves that the expression level of CMBAR in a heart failure heart tissue sample is obviously higher than that in a normal heart tissue; the expression of the CMBAR is positively correlated with the heart failure degree. On the basis, the CMBAR can be used as a drug target for screening, preventing and / or treating myocardial remodeling diseases; the CMBAR can be used as a therapeutic target for preventing and / or treating myocardial remodeling diseases or a diagnostic target for myocardial remodeling diseases. The CMBAR inhibitor is used as the medicine for preventing and / or treating the myocardial remodeling diseases, and a new way for treating the myocardial remodeling diseases is provided. On the basis, the CMBAR small interfering RNA can be used as an inhibitor of the CMBAR.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to RNA sequences, inhibitors, and related uses for treating myocardial remodeling diseases. Background Technology

[0002] The long-term accumulation of various cardiac damaging factors can eventually lead to myocardial remodeling and a decline in the heart's pumping function, clinically manifesting as heart failure. Heart failure has a high incidence and mortality rate worldwide, and despite continuous advancements in treatment methods, there are still few effective means to stop or control the process of myocardial remodeling.

[0003] The pathophysiological mechanisms of myocardial remodeling are mainly abnormal activation of the neuroendocrine system and hemodynamic disturbances. The neuroendocrine system, primarily including the abnormal activation of the sympathetic nervous system, participates in and promotes myocardial remodeling, forming the basis for the continuous progression and deterioration of heart failure. Hemodynamic disturbances manifest as decreased cardiac output and pulmonary or systemic congestion, the severity of which often corresponds to the symptoms and signs of heart failure. Pathological myocardial hypertrophy is one of the main causes of heart failure. Various external and internal stimuli, such as pressure overload, myocardial infarction, and hypertension, can cause myocardial hypertrophy, initially characterized by a smaller ventricular cavity and thicker ventricular walls. At the cellular level, this is mainly manifested as an increase in the surface area of ​​cardiomyocytes and increased expression of proteins such as atrial natriuretic peptide (ANP), brain natriuretic polypeptide (BNP), and β-myosin heavy chain (β-MHC). As the disease progresses, this eventually leads to the elongation and thinning of individual cardiomyocytes, ventricular wall dilation and thinning, resulting in systolic dysfunction and heart failure. Therefore, controlling the pathological myocardial remodeling process is of great significance for the treatment of heart failure. Summary of the Invention

[0004] The purpose of this invention is to provide a cell membrane-localized non-coding RNA sequence for the treatment of myocardial remodeling diseases and its application.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] The RNA sequence used to treat myocardial remodeling diseases is the RNA sequence shown in SEQ ID NO:1 of the sequence listing, and is abbreviated as CMBAR.

[0007] Based on the same inventive concept, the present invention also provides the use of RNA sequences for treating myocardial remodeling diseases in screening drug targets for the prevention and / or treatment of heart failure diseases.

[0008] Based on the same inventive concept, the present invention also provides the use of RNA sequences for treating myocardial remodeling diseases as therapeutic targets for the prevention and / or treatment of myocardial remodeling diseases.

[0009] The heart failure described refers to heart failure caused by stress overload conditions.

[0010] Based on the same inventive concept, the present invention also provides the use of primers for detecting RNA sequences used in the treatment of myocardial remodeling diseases, said primers comprising sequences as shown in SEQ NO. 10, SEQ NO. 11, SEQ NO. 26, and SEQ NO. 27. For example, test strips or kits can be prepared using said primers.

[0011] Based on the same inventive concept, the present invention also provides an inhibitor of the RNA sequence for treating myocardial remodeling diseases as described above, wherein the inhibitor is a small interfering RNA of the RNA sequence for treating myocardial remodeling diseases, and the nucleotide sequence of the small interfering RNA is shown in SEQ NO. 24 or SEQ NO. 25.

[0012] Based on the same inventive concept, the present invention also provides the use of the inhibitor of the RNA sequence used to treat myocardial remodeling diseases in the preparation of medicaments for the prevention and / or treatment of heart failure diseases.

[0013] Based on the same inventive concept, the present invention also provides the use of an adeno-associated virus carrying the small interfering RNA sequence for treating myocardial remodeling diseases in the prevention and / or treatment of myocardial remodeling diseases.

[0014] Furthermore, in the adeno-associated virus carrying CMBAR small interfering RNA, the vector of the adeno-associated virus is an adeno-associated virus vector with a myocardial-specific promoter.

[0015] Furthermore, the adeno-associated virus vector is the AAV9 vector.

[0016] Furthermore, the adeno-associated virus carrying CMBAR small interfering RNA is administered via intravenous injection.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The purpose of this invention is to provide a cell membrane-localized non-coding RNA sequence for treating myocardial remodeling diseases and its application. Through a correlation experiment between the expression level of CMBAR in heart failure tissue and the expression level of myocardial cell remodeling marker genes, it was confirmed that the expression level of CMBAR in heart failure tissue samples was significantly higher than that in normal heart tissue, indicating a positive correlation between CMBAR expression and the severity of heart failure. Based on this, CMBAR can be used as a drug target for screening for the prevention and / or treatment of myocardial remodeling diseases; and CMBAR can also serve as a therapeutic target for the prevention and / or treatment of myocardial remodeling diseases or as a diagnostic target for myocardial remodeling diseases.

[0019] This invention provides a novel approach to treating myocardial remodeling diseases by using CMBAR inhibitors as drugs for the prevention and / or treatment of these diseases. Based on this, CMBAR small interfering RNAs can be used as inhibitors of CMBAR. CMBAR (cardiomyocyte membrane β1AR-associated RNA, i.e., β1 receptor-associated RNA localized to the cardiomyocyte membrane) plays an important role in cardiac function, particularly in stress response and regulation of myocardial contraction. Cardiomyocyte membrane-localized β1 receptor-associated RNA (CMBAR) is closely related to the β1-adrenergic receptor (β1-AR) in the heart, which plays a crucial role in the excitation-contraction coupling process of the heart. Under pathological conditions, such as persistent hypertension or after myocardial infarction, excessive activation of β1-AR can promote pathological remodeling of cardiomyocytes, leading to abnormal changes in cardiac structure and function, and potentially developing into heart failure. This invention, by using CMBAR small interfering RNAs (siRNA and shRNA) as inhibitors of CMBAR, can exert its effects through the following mechanisms:

[0020] Specific downregulation of CMBAR expression: Small interfering RNAs can specifically bind to and degrade CMBAR mRNA, thereby reducing CMBAR expression levels. This helps to reduce the overactivation of β1-AR and mitigate its negative effects on cardiomyocytes.

[0021] Reduce myocardial remodeling: By inhibiting CMBAR, adverse remodeling processes caused by excessive activity of the β1-AR signaling pathway in cardiomyocytes, such as myocardial hypertrophy and fibrosis, can be reduced, thereby protecting the heart structure from damage.

[0022] Improving cardiac function: In the long term, by regulating the expression level of CMBAR, normal cardiac contractile function can be maintained or restored, and the efficiency of cardiac pumping can be improved, which is of great significance for improving the quality of life of patients.

[0023] As a novel treatment approach, the use of adeno-associated virus (AAV) vectors containing myocardial-specific promoters for small interfering RNA (SRNA) targeted therapy offers a new treatment option for patients with myocardial remodeling who do not respond well to conventional treatments. Furthermore, due to the high specificity and low toxicity of AAV vectors, it holds promise as a safer and more effective treatment method. Attached Figure Description

[0024] Figure 1 The changes in CMBAR expression in human myocardial hypertrophy samples in Example 1 are shown.

[0025] Figure 2 The change in CMBAR expression in the heart tissue of TAC mice in Example 1.

[0026] Figure 3 This study analyzes the correlation between CMBAR expression and the expression levels of myocardial remodeling marker genes in human myocardial hypertrophy samples from Example 1.

[0027] Figure 4 This shows the localization of CMBAR within cardiomyocytes in Example 2.

[0028] Figure 5 This is a basic characteristic of CMBAR as a non-coding RNA in Example 2.

[0029] Figure 6 This is a schematic diagram of the CMBAR small interfering RNA virus structure in Example 3.

[0030] Figure 7 The effect of CMBAR gene knockdown on cardiac structure in a mouse ISO-induced myocardial model in Example 3.

[0031] Figure 8 The effect of CMBAR gene knockout on cardiac function EF and FS in the ISO-induced myocardial model of mice in Example 3.

[0032] Figure 9 This illustrates the effect of CMBAR gene knockout on the expression of marker genes for myocardial remodeling in the ISO-induced myocardial model of mice in Example 3.

[0033] Figure 10 This is the effect of CMBAR small interfering RNA on the cardiac structure of mice after TAC in Example 4.

[0034] Figure 11 This is the effect of CMBAR small interfering RNA on cardiac function in mice after TAC in Example 4.

[0035] Figure 12 This is the effect of CMBAR small interfering RNA on marker genes of myocardial remodeling after TAC in mice, as shown in Example 4.

[0036] Figure 13 This is the effect of human CMBAR siRNA on the relative expression level of CMBAR in AC16 human cardiomyocytes in Example 5. Detailed Implementation

[0037] The technical solution will be further described below with reference to the accompanying drawings and specific embodiments to aid in understanding the content of the present invention. The following experimental examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following experimental examples are conventional methods. Unless otherwise specified, the experimental materials used in the following experimental examples were purchased from conventional biochemical reagent companies. The quantitative experiments in the following experimental examples were all repeated three or more times, and the results were averaged.

[0038] Example 1: Changes in CMBAR expression in myocardial remodeling and heart failure

[0039] 1. Establishment of a pathological myocardial hypertrophy model in mice using transarterial angina (TAC) surgery.

[0040] C57BL / 6 mice (wild-type (WT) mice) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., SPF grade.

[0041] Male C57BL / 6 mice aged 6–8 weeks were anesthetized, and their trachea was exposed. The mice were intubated and connected to a ventilator for mechanical ventilation. Respiratory parameters were: tidal volume of 9–11 mL (based on lung expansion), respiratory ratio of 1:1, and respiratory rate of 90–100 breaths per minute. The mice were placed in a supine position on a temperature-controlled mat (30°C) on the operating table. The surgical area was cleaned, and the procedure was performed under a binocular stereomicroscope. A midline incision was made in the anterior chest, extending from the suprasternal notch to the level of the second rib. The mediastinum was retracted 4–6 mm using a retractor. The thymus was separated using toothless microforceps to expose the aortic arch. A 25–27G needle (1.2–1.6 mm in diameter) was used to ligate the aorta at the midpoint between the right and left common carotid arteries using No. 5 silk suture (this can cause approximately 60% stenosis). The aorta and the ligation needle were ligated. After secure ligation, the needle was removed. Increased pulsation was observed near the heart of the aortic arch. The chest was closed layer by layer, and the skin was sutured. Erythromycin eye ointment was applied to the surgical incision site, and 0.5 mL of physiological saline was injected subcutaneously. After the mice regained spontaneous breathing, they were weaned off the ventilator and extubated, and then moved to a heating pad for continued observation until they regained consciousness. The sham surgery group (Sham) underwent open-chest surgery but without aortic arch ligation.

[0042] 2. Detection indicators

[0043] Tissue RNA extraction and detection

[0044] RNA extraction:

[0045] RNA was extracted from clinical heart failure patient case samples and the aforementioned mouse model tissue samples. 1 ml of Trizol reagent was added to the tissue samples, and the mixture was repeatedly pipetted. The homogenate was then incubated at room temperature for 5 min.

[0046] After the nucleic acids and proteins have fully dissociated, add 0.2 ml of chloroform to each 1 ml of Trizol reagent homogenate, tighten the cap, and shake vigorously by hand for 15 seconds. Then let it stand at room temperature for 2–3 minutes. Centrifuge at 10,000 g for 10 minutes at 4°C. Carefully aspirate the upper aqueous phase (colorless) into a new test tube.

[0047] Calculate the volume of the aspirated aqueous phase. Add an equal volume of pre-cooled isopropanol to the aspirated aqueous phase, tighten the cap, and gently shake to mix. Incubate at room temperature for 10 minutes to allow the RNA to precipitate completely. Centrifuge at 10,000g for 10 minutes at 4°C. Discard the supernatant and retain the precipitate.

[0048] Add 1 ml of 75% ethanol to each centrifuge tube to rinse, tighten the cap, and gently shake the tube to remove residual isopropanol and salt. Centrifuge at 7,500 g for 5 min at 4°C. Discard the supernatant and allow the precipitate to air dry at room temperature for 5-10 min until semi-dry to obtain RNA.

[0049] Open the tube cap, dry the RNA precipitate, and dissolve it in an appropriate amount of RNase-free water. Detect the RNA purity and concentration, and reverse transcribe it into cDNA. Use specific primers to detect CMBAR levels.

[0050] RNA reverse transcription reaction:

[0051] Using the Takara RT kit, the specific method is as follows:

[0052] The reverse transcription reaction is as follows:

[0053]

[0054] Mix well, react at 37℃ for 15 min; at 85℃ for 5 s, place on ice to obtain cDNA after reverse transcription; dilute 10 μL of the cDNA 20 times to 200 μL, store at -20℃ for the next step of real-time quantitative PCR detection.

[0055] Real-time quantitative PCR detection of RNA expression in cells:

[0056] Real-time quantitative PCR detection was performed using Takara's SYBR Green Cell assay. The specific steps are as follows:

[0057] The PCR reaction system was constructed as follows:

[0058]

[0059] Mix well. The reaction procedure is as follows:

[0060] Pre-denaturation: 95℃, 5 min;

[0061] Denaturation: 94℃, 5 seconds;

[0062] Annealing: 60℃, 30 seconds;

[0063] Extension: 72℃, 30 seconds; 40 cycles in total;

[0064] After the reaction is complete, the PCR melting curve is obtained, and the purity of the product is determined based on the uniformity of the melting curve.

[0065] The primer sequences for real-time quantitative PCR are shown in Table 1:

[0066] Table 1. Primer sequences for CMBAR and marker genes of myocardial remodeling

[0067]

[0068]

[0069] Figure 1 The expression level of CMBAR in cardiac tissue of patients with heart failure; Figure 2 The expression level of CMBAR in the heart tissue of TAC mice; Figure 3 A correlation analysis of CMBAR levels in human cardiac tissue with the expression levels of marker genes for myocardial remodeling showed that CMBAR expression was positively correlated with the expression of genes related to myocardial remodeling.

[0070] Figure 1 Note:

[0071] Relative CMBAR mRNA levels ( / GAPDH): The relative expression level of CMBAR mRNA (relative to GAPDH). CMBAR stands for cardiomyocyte membrane β1AR associated RNA; mRNA is messenger ribonucleic acid. GAPDH stands for glyceraldehyde-3-phosphate dehydrogenase, an enzyme that plays a crucial role in glycolysis, catalyzing the conversion of glyceraldehyde-3-phosphate to 1,3-diphosphoglycerate. In molecular biology research, GAPDH is often used as a housekeeping gene. Housekeeping genes are genes whose expression is relatively stable across different samples, used to correct for technical variations in experiments, such as RNA extraction efficiency, reverse transcription efficiency, and PCR amplification efficiency.

[0072] Healthy: Healthy heart (based on cases of accidental death in a car accident).

[0073] HF: Heart failure samples are taken from heart failure patients who have undergone heart transplantation (left ventricular ejection fraction less than 40%).

[0074] Figure 2 Note:

[0075] SHAM: The sham surgery group (Sham) underwent open-chest surgery but did not perform aortic arch ligation.

[0076] TAC: The TAC mouse experimental group refers to mice with myocardial hypertrophy and heart failure established through transverse aortic constriction (TAC) surgery. TAC surgery is a commonly used experimental method to simulate the pathological changes in human heart disease caused by hypertension, especially myocardial hypertrophy and heart failure.

[0077] Figure 3 Note:

[0078] Relative BNP mRNA levels ( / GAPDH): The relative expression level of brain natriuretic peptide (BNP) messenger ribonucleic acid (mRNA). This measurement of relative expression levels is commonly used to assess changes in BNP gene expression under specific conditions, particularly in studies of cardiovascular diseases such as myocardial remodeling and heart failure.

[0079] Relative β-MHC mRNA levels ( / GAPDH): The relative expression level of β-myosin heavy chain (β-MHC) messenger ribonucleic acid (mRNA). This measurement of relative expression levels is commonly used to assess changes in β-MHC gene expression under specific conditions, particularly in studies of cardiovascular diseases such as myocardial remodeling and heart failure.

[0080] R 2 Coefficient of determination: measures the proportion of variance explained by the model relative to the total variance.

[0081] P: P-value is a statistical concept used to assess whether the result of a hypothesis test is statistically significant. Specifically, the P-value represents the probability of the observed sample outcome (or a more extreme outcome) occurring if the null hypothesis is true.

[0082] CMBAR RNA levels in cardiac tissue during heart failure, such as Figure 1As shown, the CMBAR RNA level results in the heart tissue of TAC mice are as follows: Figure 2 As shown in the figure, the correlation analysis results between CMBAR RNA levels in cardiac tissue of patients with heart failure and myocardial remodeling markers BNP and β-MHC are as follows: Figure 3 As shown, the results indicate that CMBAR expression increases in cardiac tissue during myocardial remodeling due to heart failure and stress overload, and is correlated with myocardial remodeling markers.

[0083] Example 2: Localization analysis and basic characteristics of CMBAR in cardiomyocytes

[0084] 1. The independent existence, fragment size and sequence, coding ability and conservatism of CMBAR.

[0085] Northern blotting revealed the presence of CMBAR, transcript numbered NONMMUT026710.2, approximately 2.4 kb in size. The 5' and 3' ends of this transcript were identified using RACE. The coding potential of CMBAR was predicted using the coding potential Calculator 2 (CPC2) and coding potential Assessment Tool (CPAT). The results showed that CMBAR's protein-coding potential is comparable to that of known lncRNAs. Nor Similar to ad and Hotair, CMBAR is a novel lncRNA. CMBAR exhibits high sequence conservation across different species, with 70% sequence similarity.

[0086] 2. Fluorescence in situ hybridization

[0087] Collect cells and wash them three times with PBS for 5 min each time; fix them with 4% tissue cell fixative at room temperature for 15 min; wash them three times with PBS for 5 min each time (1 ml per well); add 100 μl of prehybridization solution (50% formamide, 2×SSC, 1×Denhardt's solution, 10 mM EDTA, pH=8.0, 100 μg / ml tRNA from baker's syeast, 0.01% Tween-20) to each well and incubate at 55℃ for 1–1.5 h; remove the probes and thaw them on ice. Dilute the probe concentration to 1–10 ng / ul using hybridization solution (50% formamide, 2×SSC, 1×Denhardt's solution, 10 mM EDTA, pH=8.0, 100 μg / ml tRNA from baker's yeast, 5% dextran sulfate, 0.01% Tween-20); denature the diluted probe at 75°C for 10 min, then warm to room temperature; add 100 μl of denaturing hybridization solution to each well and incubate at 55°C for at least 16–20 h. Wash twice with preheated wash buffer 1 (50% formamide, 2×SSC, 0.01% Tween-20) for 30 min each time, and incubate at 55°C. Discard the supernatant and wash with preheated wash buffer 2 (2×SSC, 0.01% Tween-20) for 30 min, and incubate at 55°C. Discard the supernatant and wash with preheated wash buffer 3 (0.2×SSC, 0.01% Tween-20) for 30 min, and incubate at 55°C. Stain the cell membrane with DiO for 20 min, wash three times with PBS for 5 min each time, and observe with laser scanning confocal microscopy or super-resolution microscopy.

[0088] 3. RNA IP experiment

[0089] Wash cells three times with PBS; collect cells with a scraper and resuspend cells in 10 ml PBS. Centrifuge at 1000 rpm for 5 min; discard the supernatant and extract cell membrane components using a cell membrane extraction kit; lyse cells with 1 ml lysis buffer (50 mM Tris-HCl + 150 mM NaCl + 0.5% NP-40 + 1 mM PMSF + 1× protease inhibitor + 2 mM VRC + 40 U / ml RNase inhibitor), and sonicate; transfer the supernatant to a 1.5 ml EP tube, add 20 μl of protein A / G beads, incubate at 4 °C for 30 min, discard the beads, and retain the cell supernatant to remove non-specific binding. Divide the supernatant into two equal parts, add 2 μg of IgG and 2 μg of β1AR antibody to each, and incubate at 4 °C for 4 h; then add 30 μl of protein A / G beads and incubate at 4 °C for 1 h; finally, discard the supernatant and retain the beads. The mixture was washed three times at 5000 rpm with the lysis buffer described above. The beads were then eluted with the elution buffer and treated at room temperature for 10 min. RNA was extracted and the molecular enrichment level was determined.

[0090] 4. Northern blot

[0091] (1) RNA extraction and detection

[0092] (2) Probe preparation

[0093] 1) Probes were prepared using PCR. The PCR reaction system is as follows:

[0094]

[0095]

[0096] The PCR reaction procedure is as follows:

[0097]

[0098] 2) Probe agarose gel electrophoresis.

[0099] (3) Electrophoresis

[0100] Denaturing gel electrophoresis with 1% formaldehyde was performed overnight at a constant voltage of 25V. The sample loading volume was 15 μg and the volume was 50 μl.

[0101] (4) Transfer membrane

[0102] Place the gel in a petri dish, rinse once with distilled water, add several times the volume of 20X SSC and shake at room temperature for 2×15 min to remove excess formaldehyde; transfer the membrane using the upward capillary method for 20 h, remove the membrane, mark it, rinse in 2X SSC for several min, and bake at 80°C for 2 h to fix it.

[0103] (5) Hybridization

[0104] Pre-hybridization: Add 10.0 ml of DIG Easy Hyb to a hybridization tube and pre-hybridize in a hybridization oven at 50°C for 2 hours; Probe denaturation: Denature the probe at 100°C for 10 minutes in a PCR instrument, then immediately cool in an ice-water bath for 5 minutes; Hybridization: Drain the pre-hybridization solution, add the freshly denatured probe to 10 ml of DIG Easy Hyb, and mix well. Hybridize overnight in a hybridization oven at 50°C.

[0105] (6) Hybridization washing and signal detection

[0106] After hybridization, at room temperature, wash the membrane 2×5 min for 2 times with 100 ml 2X SSC / 0.1% SDS; at 68℃, wash 2×15 min for 100 ml 0.1X SSC / 0.1% SDS; equilibrate the membrane in 100 ml washing buffer for 2-5 min; block the membrane in 100 ml blocking solution for 1 h (gently shake on a shaker); react the membrane with antibody in 20 ml antibody solution for 30 min (gently shake on a shaker); remove the antibody solution, wash the membrane 2×15 min for 100 ml washing buffer; add 1 ml CSPD to the front side (nucleic acid side) of the membrane, react at 15-25℃ for 5 min in the absence of air, remove excess liquid, incubate at 37℃ for 10 min; expose, develop, fix, develop, and record the results using X-ray film in a darkroom.

[0107] 5. Rapid amplification of cDNA ends (RACE) technology

[0108] According to Takara The RACE 5′ Kit was used for 5′ RACE experiments. PCR primers

[0109] 5′-RACE GATTACGCCAAGCTTGGGCAGGGTTTCTTTCGAGTCTTATC;

[0110] 3′-RACE GATTACGCCAAGCTTTGTGCAAACCAGAACTCTCTCAACG

[0111] (1) Synthesis of cDNA

[0112]

[0113]

[0114] 1) Mix the above system thoroughly and centrifuge. Incubate at 72°C for 3 min, then cool to 42°C for 2 min. After cooling, centrifuge at 13000 rpm for 10 s and collect the precipitate.

[0115] 2) Add 1 μl of SMARTer II A oligonucleotide to each reaction. Incubate at 72°C for 3 min, then cool to 42°C for 2 min. After cooling, centrifuge at 13000 rpm for 10 s and collect the precipitate.

[0116] 3) Add 1 μl of SMARTer II A oligonucleotide to each reaction.

[0117] 4) 5′-RACE cDNA synthesis:

[0118]

[0119] 5) Add the above mixture to the denatured RNA, and the total volume of the synthesis reaction is 20 μl.

[0120] 6) Gently mix the liquid in the tube and centrifuge. Collect the precipitate at the bottom and incubate at 42°C for 90 minutes.

[0121] 7) Heat shock at 70℃ for 10 minutes.

[0122] 8) Dilute the first-strand cDNA product with Tricine-EDTA buffer.

[0123] (2) Rapid amplification of cDNA ends

[0124] 1) PCR reaction system:

[0125]

[0126] 2) PCR reaction conditions:

[0127]

[0128]

[0129] 3) Ligate the PCR product into a vector and sequence it.

[0130] The results showed that CMBAR significantly co-localized with the DiO cell membrane dyes DiO or WGA in HL1 cardiomyocytes, and the full-length CMBAR transcribed in vitro had the ability to bind to lipids; CMBAR was significantly enriched by the β1AR receptor and co-localized with β1AR in cardiomyocytes, as shown in the results. Figure 4 As shown.

[0131] Figure 4 Notes

[0132] Pepper-control: Pepper staining in the control group. Pepper can perform simple and effective imaging and tracking of a variety of RNAs in living cells, and it hardly interferes with the transcription, localization and translation of the target RNA.

[0133] Pepper-CMBAR: CMBAR's pepper color rendering.

[0134] DiO: Dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate, a fluorescent dye commonly used for labeling and tracing cell membranes.

[0135] Merge: This refers to combining different fluorescence channels or images from the previous two columns to form a composite image. This allows for simultaneous observation of the distribution of multiple markers within the cell.

[0136] Pepper530: This refers to the image displayed after staining with Pepper530.

[0137] WGA refers to wheat germ lectin, a glycoprotein used for cell membrane labeling and neuronal staining. WGA can be coupled with fluorescent dyes to observe cell membrane morphology and neuronal structure, and is particularly suitable for colocalization studies.

[0138] TG: triglycerides, used to assess the risk of cardiovascular disease.

[0139] DAG: Diacylglycerol, also plays an important role in the occurrence and development of cardiovascular diseases, such as atherosclerosis and hypertension.

[0140] PA: Phosphatidic Acid. Phosphatidic acid is an important lipid signaling molecule that plays a key role in cell signaling, lipid metabolism, and membrane structure.

[0141] PS (phosphatidylserine) is an important phospholipid widely distributed in cell membranes. PS participates in the process of myocardial fibrosis by influencing fibroblast activation and collagen synthesis. PS can promote the production of inflammatory factors, participate in myocardial inflammatory responses, and further affect myocardial remodeling.

[0142] PE (phosphatidylethanolamine) is a common phospholipid widely distributed in cell membranes, especially on the membranes of organelles such as mitochondria and endoplasmic reticulum. During cardiomyocyte hypertrophy, altered PE metabolism and distribution may affect cell membrane stability and function; PE participates in myocardial fibrosis by influencing fibroblast activation and collagen synthesis; and PE participates in myocardial inflammatory responses, further impacting myocardial remodeling.

[0143] PC (phosphatidylcholine) is a common phospholipid widely distributed in cell membranes, especially in the outer layer. PC participates in intracellular lipid metabolism, particularly in hepatocytes and cardiomyocytes, playing a crucial role in fatty acid transport and phospholipid synthesis. Changes in PC levels and distribution may be associated with cardiac hypertrophy. During cardiomyocyte hypertrophy, altered PC metabolism and distribution may affect cell membrane stability and function. PC participates in myocardial fibrosis by influencing fibroblast activation and collagen synthesis. PC can promote the production of inflammatory factors, participate in myocardial inflammatory responses, and influence myocardial remodeling.

[0144] PG: Prostaglandins. Prostaglandins are a class of lipid mediators derived from arachidonic acid, possessing various physiological and pathological functions. Prostaglandins can regulate vasodilation and vasoconstriction, affecting blood pressure and blood flow. They participate in inflammatory responses, promoting the release of inflammatory mediators and the recruitment of inflammatory cells. Prostaglandins can influence cell proliferation and differentiation, playing a crucial role in tissue repair and regeneration. They can affect the progression of cardiac hypertrophy. Prostaglandins can influence coronary artery remodeling by regulating the function of vascular endothelial cells and smooth muscle cells.

[0145] CL: Cardiolipin. Cardiolipin is a special type of phospholipid, mainly found in the inner mitochondrial membrane, and is crucial for mitochondrial function and stability. It accounts for approximately 20% of the total phospholipids in the inner mitochondrial membrane. Cardiolipin plays a vital role in maintaining the structure and function of the mitochondrial membrane, participating in key processes such as the electron transport chain, ATP synthesis, and calcium ion homeostasis. Metabolic changes in cardiolipin are associated with myocardial fibrosis by affecting fibroblast activation and collagen synthesis. During myocardial remodeling, alterations in mitochondrial function may lead to energy metabolism disorders and oxidative stress.

[0146] Yeast transfer RNA (YRNA) is an important RNA molecule whose main function is to translate codons on mRNA into corresponding amino acids during protein synthesis.

[0147] PI: Phosphatidylinositol.

[0148] PIP stands for Phosphatidylinositol Phosphate. Phosphatidylinositol phosphate is an important class of phospholipid molecules that play a crucial role in cell signaling, membrane structure, and function.

[0149] PIP2: Phosphatidylinositol 4,5-bisphosphate. This is an important phospholipid molecule that is widely distributed in cell membranes and plays a key role in various cell signaling pathways.

[0150] PIP3: Phosphatidylinositol 3,4,5-trisphosphate. This is an important phospholipid molecule involved in various cellular signaling pathways, playing a key role, particularly in the PI3K / Akt signaling pathway.

[0151] Cholesterol: Cholesterol usually refers to the cholesterol content in cell membranes and intracellular lipids.

[0152] SM: Sphingomyelin. Sphingomyelin is an important phospholipid molecule widely distributed in cell membranes, especially in the outer layer. Changes in sphingomyelin levels during myocardial remodeling can affect cardiomyocyte proliferation, apoptosis, and fibrosis. High levels of ceramides may lead to apoptosis and inflammatory responses, thereby exacerbating myocardial damage.

[0153] Sulfatide: Sulfated cerebrosides are glycosphingolipids containing sulfate groups, mainly found in cell membranes, especially in the nervous system and cardiomyocytes.

[0154] Blank: Blank control group.

[0155] HL-1: The HL-1 cell line is an immortalized cardiomyocyte line derived from mouse atrial myocytes, and is widely used in research on cardiomyocyte function and myocardial remodeling.

[0156] Crosslinking: cross-linking.

[0157] PM isolation: Plasma Membrane Isolation.

[0158] IgG: Immunoglobulin G.

[0159] β1AR: The β1-adrenergic receptor (β1AR) is an important G protein-coupled receptor (GPCR) in cardiomyocytes, which is involved in regulating cardiac contractility and heart rate.

[0160] antibody: antibody.

[0161] Pull down: Pull-down experiment, a technique used to study macromolecular interactions.

[0162] RNA detection: RNA detection, quantitative and qualitative analysis of RNA in cells or tissues.

[0163] Density: density.

[0164] Distance (pixels): Distance (pixels).

[0165] AVCM: Adult ventricular cardiomyocytes. Primary ventricular myocytes of adult mice.

[0166] CMBAR is an independent transcript approximately 2.4 kb in size, with weak coding ability and strong interspecies conservation. In HL1 cardiomyocytes, RNA fluorescence in situ hybridization staining was performed using a Cy3 (red)-labeled CMBAR probe, and the cell membrane was labeled with the cell membrane dye DiO (green). Confocal microscopy revealed that CMBAR distribution and DiO showed significant co-localization. PM components were isolated and RNA extracted. qPCR was used to detect CMBAR and GAPDH levels, and the proportion of CMBAR in PM RNA and total cellular RNA was compared, revealing significant enrichment of CMBAR on PM. Since PM is rich in lipid components, we transcribed the full-length CMBAR in vitro and tested its ability to bind to lipids. Membrane lipid strip experiments showed that CMBAR can bind to phosphatidylinositol (PIP), phosphatidylserine (PS), and phosphatidic acid (PA). These findings suggest that CMBAR has membrane localization characteristics and can bind to β1AR. Results are as follows: Figure 5 As shown.

[0167] Figure 5 Notes

[0168] NONMMUT026710.22464nt: NON indicates that this is a non-coding RNA; MMU is an abbreviation for mouse species; T026710 is a specific number used to uniquely identify this non-coding RNA sequence. Each non-coding RNA has a unique number in the database for easy retrieval and citation; 2464 indicates that this non-coding RNA is 2464 nucleotides long; nt stands for nucleotide, the basic building block of RNA.

[0169] 5'RACE product 1441bp: This indicates a PCR product of 1441 base pairs obtained by rapid amplification of cDNA ends (5'RACE) at the 5' end.

[0170] 3'RACE product 1350bp: This indicates a PCR product of 1350 base pairs obtained by rapid amplification of cDNA ends (3'RACE) technology.

[0171] bp: an abbreviation for "base pairs". In genetics and molecular biology, it is used to measure the length of DNA or RNA segments.

[0172] NONMMUT026710.2: "NON" indicates non-coding RNA, "MMU" indicates mouse (Mus musculus), "T026710" is the unique number of this RNA, and ".2" indicates the version number of this sequence.

[0173] Norad: is a long non-coding RNA (lncRNA).

[0174] Hotair is an abbreviation for "HOX transcript antisense intergenic RNA," a type of long non-coding RNA (lncRNA). Hotair participates in the regulation of gene expression, affecting processes such as cell proliferation, differentiation, and apoptosis.

[0175] CPC2, short for Coding Potential Calculator 2, is a computational tool used to assess the coding potential of RNA sequences. In myocardial remodeling studies, CPC2 is often used to distinguish between coding and non-coding RNAs, helping to identify potential functional non-coding RNAs.

[0176] Coding Probability: This refers to the probability that an RNA sequence encodes a protein.

[0177] CPAT: an abbreviation for "Coding-Potential Assessment Tool", is a computational tool used to assess the coding potential of RNA sequences.

[0178] Homo sapiens: This is the scientific name for modern humans in scientific classification.

[0179] Gorillagorilla: This is the scientific name for the western gorilla in scientific classification.

[0180] Mus musculus: is the scientific name for mice.

[0181] Sus scrofa: This is the scientific name for domestic pigs in scientific classification.

[0182] Ovis aries: is the scientific name for sheep in scientific classification.

[0183] CMBAR is a cell membrane-localized RNA. A: RNA fluorescence in situ hybridization imaging (NONMMUT026710, red) and cell membrane DiO staining (green). N=3. B: qPCR detection of the relative enrichment of GAPDH and CMBAR in PM fractions. N=4. **P<0.01. C: Membrane lipid strip assay showing CMBAR interaction with lipids.

[0184] Example 3: Effect of CMBAR knockdown on ISO-induced myocardial hypertrophy

[0185] 1. CMBAR Small Interfering RNA Design

[0186] like Figure 6 As shown, CMBAR small interfering RNA (sequence: GCAAUUGCUACUGUGUAUATT) was constructed into the adeno-associated virus vector AAV9, which has a myocardial-specific promoter, to construct the CMBAR small interfering RNA viral vector AAV9-cTNT-shCMBAR. Virus construction, packaging, and purification were outsourced to Hanheng Biotechnology.

[0187] Figure 6 Notes

[0188] AAV9 ITR: Indicates the inverted terminal repeat sequence of adeno-associated virus type 9.

[0189] cTNT Promoter: This refers to the promoter of cardiac troponin T (cTNT).

[0190] shCMBAR: This refers to a short hairpin RNA that targets CMBAR (a β1 receptor-associated RNA localized to the cardiomyocyte membrane).

[0191] WPRE stands for "Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element." It is used in myocardial remodeling studies to enhance mRNA stability in gene expression vectors and improve the expression efficiency of target genes, especially when using viral vectors (such as AAV) for gene delivery.

[0192] Poly A: This stands for polyadenylated tail, a continuous adenosine (A) sequence typically added to the 3' end of mRNA. In myocardial remodeling studies, the PolyA tail can increase mRNA stability and translation efficiency, ensuring effective expression of target genes in cells.

[0193] AAV9 ITR: Represents the inverted terminal repeat sequence of adeno-associated virus type 9. In myocardial remodeling studies, AAV9 ITR is an important component of viral vectors, responsible for viral DNA replication and packaging, ensuring the efficient delivery and integration of exogenous genes.

[0194] 2. Mouse CMBAR small interfering RNA virus tail vein injection

[0195] C57 mice were injected via tail vein with CMBAR small interfering RNA virus (1*10). 12 vg / each).

[0196] ISO-induced myocardial remodeling model mice

[0197] One week after tail vein injection of AAV virus, mice were subcutaneously injected with ISO at a dose of 60 mg / kg / day. Three weeks later, the cardiac function and structure of the mice were evaluated and analyzed.

[0198] 4. Ultrasound analysis of mouse cardiac function

[0199] Small animal ultrasound was used to analyze the structure and function of the mouse heart. Mice were anesthetized in a small animal anesthesia machine (2% isoflurane mixed with 0.5 L / min oxygen). After anesthesia, hair was removed from the mouse chest using a depilatory agent. The mice were placed on a warming platform with an embedded ECG monitor, and electrode gel was applied to their limbs. Cardiac function was tested using a Vevo 770B 30MHz ultrasound probe (randomly configured). Two-dimensional images of the mouse heart were acquired from the short axis using B-Model. The system's built-in software was used to obtain echocardiographic cardiac function indicators: systolic interventricular septal thickness (IVSs); diastolic left ventricular posterior wall thickness (LVPWd); systolic left ventricular posterior wall thickness (LVPWs); and diastolic left ventricular internal diameter (LVD). Left ventricular end-systolic internal diameter (LVIDd) and left ventricular end-systolic internal diameter (LVIDs); left ventricular end-diastolic volume (LVVold) and left ventricular end-systolic volume (LVVols); left ventricular ejection fraction (EF) is calculated using the volume formula EF = [(LVVold - LVVols) / LVVold] × 100%, and fractional shortening (FS) is calculated using the formula FS = [(LVIDd – LVIDs) / LVIDd] × 100%.

[0200] 5. Pathological analysis of mouse heart tissue

[0201] Mice were euthanized by cervical dislocation, and their hearts were removed, weighed, and photographed. The mice's hearts were then fixed in tissue fixative, and after 48 hours, they were embedded in paraffin and frozen section embedding medium, respectively, and then sectioned for HE staining, MTT staining, and WGA staining, respectively.

[0202] 6. Detection of marker genes for myocardial remodeling in mice

[0203] RNA was extracted from mouse hearts, reverse transcribed, and then real-time quantitative PCR was performed to detect the expression of mouse myocardial remodeling-related genes (ANP, BNP, and β-MHC).

[0204] Tissue RNA extraction

[0205] Approximately 15 mg of heart tissue was cut and added to a 1.5 mL EP tube containing 1 mL of Trizol reagent. The tissue was thoroughly homogenized using an electric homogenizer and allowed to stand at room temperature for 5 minutes. Then, 1 / 5 volume of chloroform (0.2 mL / 1 mL Trizol) was added, and the EP tube was vigorously shaken for 15 seconds. The mixture was allowed to stand at room temperature for 2–3 minutes. The mixture was then centrifuged at 12000 g and 4 °C for 15 minutes. The supernatant was collected and transferred to a new EP tube. An equal volume (0.5 mL) of isopropanol was added, and the mixture was gently shaken for 15 seconds. The mixture was allowed to stand at room temperature for 10 minutes. The mixture was then centrifuged at 12000 g and 4 °C for 10 minutes. The supernatant was discarded, and the precipitate was collected. 1 mL of chloroform was added to the precipitate. Centrifuge the EP tube several times by inverting it with 75% (volume) ethanol at 7500g and 4℃ for 5 min, and discard the supernatant. Let it air dry at room temperature for 5-10 min until semi-dry to obtain RNA. Add an appropriate amount of sterile DEPC water to redissolve the RNA. Take 1 μL of the dissolved RNA and use an ultra-micro UV spectrophotometer (Q5000) to determine the concentration and quality (concentration >200 ng / uL, 260 / 280 controlled between 1.9 and 2.0). Store at -80℃ for later use.

[0206] RNA reverse transcription reaction:

[0207] Using Takara RT kit

[0208] The specific method is as follows:

[0209] The reverse transcription reaction is as follows:

[0210]

[0211] Mix well, react at 37℃ for 15 min; at 85℃ for 5 s, place on ice to obtain cDNA after reverse transcription; dilute 10 μL of the cDNA 20 times to 200 μL, store at -20℃ for the next step of real-time quantitative PCR detection.

[0212] Real-time quantitative PCR detection of RNA expression in cells:

[0213] Real-time quantitative PCR was performed using Takara's SYBR.

[0214] The specific steps are as follows:

[0215] The PCR reaction system was constructed as follows:

[0216]

[0217] Mix well. The reaction procedure is as follows:

[0218] Pre-denaturation: 95℃, 5 min;

[0219] Denaturation: 94℃, 5 seconds;

[0220] Annealing: 60℃, 30 seconds;

[0221] Extension: 72℃, 30 seconds; 40 cycles in total;

[0222] After the reaction, PCR melting curves were obtained, and product purity was determined based on the uniformity of the melting curves. The primer sequences for real-time quantitative PCR detection of myocardial remodeling marker genes are shown in Table 2.

[0223] Table 2

[0224]

[0225]

[0226]

[0227] The results of heart size, HE staining, MTT staining, and WGA staining in mice after ISO injection are as follows: Figure 7 As shown, the results indicate that ISO induced myocardial hypertrophy, myocardial fibrosis, and increased cardiomyocyte area in mice injected with the control virus (NC), while injection with CMBAR small interfering RNA virus effectively alleviated these conditions.

[0228] Figure 7 Notes

[0229] AAV9 injection: Adeno-associated virus type 9 (AAV9) vector is delivered into experimental animals via injection.

[0230] ISO injection (60 mg / kg, Daily): Inject 60 mg / kg of isoproterenol (ISO) daily.

[0231] Echo: refers to echocardiography.

[0232] -1w: the previous week.

[0233] 0w: 0 weeks.

[0234] 3w: 3 weeks.

[0235] Sacrifice: refers to the act of euthanasia or the killing of laboratory animals.

[0236] Ctrl: Control group.

[0237] ISO: Isoproterenol.

[0238] AAV-shNC: Indicates adeno-associated virus (AAV) carrying negative control short hairpin RNA (shRNA).

[0239] AAV-shCMBAR: This indicates an adeno-associated virus (AAV) carrying a short hairpin RNA (shRNA) targeting CMBAR (a β1 receptor-associated RNA localized to the myocardial cell membrane).

[0240] H&E: indicates hematoxylin and eosin staining.

[0241] MTT stands for 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. In myocardial remodeling studies, the MTT assay is commonly used to assess cell viability and proliferation capacity. It quantifies cell number and activity by measuring the ability of living cells to reduce MTT to form purple formazan crystals.

[0242] WGA stands for Wheat Germ Agglutinin. In myocardial remodeling studies, WGA is commonly used to label cell membranes, particularly the cell membranes of cardiomyocytes. Using fluorescently labeled WGA, researchers can clearly observe and analyze morphological and structural changes in cardiomyocytes, such as cell size and boundaries.

[0243] HW / BW (mg / g): This represents the ratio of heart weight to body weight.

[0244] Cross sectional area (μm) 2 ): This indicates the cross-sectional area, with the unit being square micrometers.

[0245] pCaMKII: Represents phosphorylated calcium / calmodulin-dependent kinase II (CaMKII). In myocardial remodeling studies, pCaMKII levels are frequently used to assess CaMKII activation status because CaMKII plays a crucial role in cardiomyocyte signaling, contractile function, and remodeling. Elevated levels of phosphorylated CaMKII are generally associated with myocardial remodeling and cardiac dysfunction.

[0246] CaMKII stands for Ca2+ / Calmodulin-dependent protein kinase II. In myocardial remodeling research, CaMKII is an important signaling molecule involved in regulating cardiomyocyte contraction, ion channel function, and gene expression. Activation of CaMKII is closely related to myocardial remodeling and cardiac dysfunction.

[0247] pHDAC4 Ser246: Represents the phosphorylated form of histone deacetylase 4 (HDAC4) at serine 246. In myocardial remodeling studies, the level of pHDAC4 Ser246 is used to assess the activation status of HDAC4. HDAC4 phosphorylation is generally associated with its nuclear export and functional regulation, influencing gene expression and myocardial remodeling processes in cardiomyocytes.

[0248] HDAC4 stands for Histone Deacetylase 4. In myocardial remodeling research, HDAC4 is an important epigenetic regulator involved in regulating gene expression. HDAC4 affects cardiomyocyte growth, differentiation, and apoptosis through deacetylation; its activity and subcellular localization play a crucial role in myocardial remodeling.

[0249] GAPDH stands for Glyceraldehyde-3-phosphate dehydrogenase. In myocardial remodeling studies, GAPDH is often used as an internal reference gene in experiments such as western blot and qPCR to correct sample loading and standardize the expression levels of target proteins or RNA, ensuring the accuracy and comparability of experimental results.

[0250] Relative ANP mRNA levels ( / Gapdh): Represents the relative expression level of ANP mRNA relative to GAPDH.

[0251] Relative BNP mRNA levels ( / Gapdh): Represents the relative expression level of BNP mRNA relative to GAPDH.

[0252] Relative β-MHC mRNA levels ( / Gapdh): Represents the relative expression level of β-myosin heavy chain (β-MHC) mRNA relative to GAPDH.

[0253] Results of mouse cardiac function analysis as follows Figure 8As shown, NC mice injected with ISO showed a significant decrease in ventricular ejection fraction (EF) and fractional shortening (FS), indicating a decline in cardiac function. However, injection of CMBAR small interfering RNA virus could counteract the decline in cardiac function caused by ISO.

[0254] Analysis of expression of marker genes for myocardial remodeling after TAC in mice, such as Figure 9 As shown, the expression of myocardial remodeling marker genes (ANP, BNP and β-MHC) was significantly increased after ISO injection in NC mice, indicating the initiation of pathological myocardial remodeling, while injection of CMBAR small interfering RNA virus could counteract ISO-induced pathological myocardial remodeling.

[0255] Example 4: Design of CMBAR small interfering RNA and its effect on the phenotype of mice after TAC (transmissible intravenous administration).

[0256] 1. Construction of CMBAR small interfering RNA viral vector: Same as in Example 3. The sequence of CMBAR small interfering RNA is: GCAAUUGCUACUGUGUAUATT.

[0257] 2. Tail vein injection of CMBAR small interfering RNA in TAC mice

[0258] WT mice underwent TAC surgery, following the same procedure as in Example 1. Three days later, CMBAR small interfering RNA virus (1*10) was injected via the tail vein. 12 (vg / animal), the experimental procedure was the same as in Example 3. Echocardiography was performed five weeks later.

[0259] 3. Ultrasound analysis of mouse cardiac function, same as in Example 3.

[0260] 4. Pathological analysis of mouse heart tissue, same as in Example 3.

[0261] 5. Detection of marker genes for myocardial remodeling in mice, same as in Example 3.

[0262] Results of heart size, HE staining, MTT staining, and WGA staining in mice after TAC are as follows: Figure 10 As shown, the results indicate that TAC in mice injected with the control virus (NC) resulted in myocardial hypertrophy, myocardial fibrosis, and increased cardiomyocyte area, while injection with CMBAR small interfering RNA virus effectively alleviated these conditions.

[0263] Figure 10 Notes

[0264] TAC surgery stands for Transverse Aortic Constriction. In myocardial remodeling research, TAC surgery is a commonly used method. By partially blocking aortic blood flow, it increases left ventricular afterload, inducing myocardial hypertrophy and remodeling. This surgical model is frequently used to study the mechanisms of myocardial remodeling and evaluate potential treatment strategies.

[0265] AAV injection: refers to the injection of adeno-associated virus (AAV).

[0266] 0w: 0 weeks.

[0267] 3d: 3 days.

[0268] 5w: 5 weeks.

[0269] Echo Sacrifice: This refers to the euthanasia or sacrifice of experimental animals after echocardiography (Echo). In myocardial remodeling studies, cardiac structure and function are first assessed using echocardiography, and then animals are sacrificed at specific time points to collect tissue samples for further pathological and molecular biological analysis. This method helps to comprehensively assess the progress of myocardial remodeling and the effectiveness of treatments.

[0270] Cross sectional area (μm) 2 ): Represents the cross-sectional area, with the unit being square micrometers (μm2).

[0271] Results of mouse cardiac function analysis as follows Figure 11 As shown, NC mice showed a significant decrease in ventricular ejection fraction (EF) and fractional shortening (FS) after TAC, indicating a decline in cardiac function. However, injection of CMBAR small interfering RNA virus could counteract the decline in cardiac function caused by TAC.

[0272] Analysis of expression of marker genes for myocardial remodeling after TAC in mice, such as Figure 12 As shown, the expression of myocardial remodeling marker genes (ANP, BNP and β-MHC) was significantly increased after TAC injection in NC mice, indicating the occurrence of pathological myocardial remodeling. However, injection of CMBAR small interfering RNA virus could counteract TAC-induced pathological myocardial remodeling.

[0273] This invention, through animal experiments and analysis of cardiac tissue samples from clinical heart failure patients, draws the following conclusions: 1. The expression level of CMBAR in cardiac tissue of heart failure patients is positively correlated with the degree of heart failure; 2. CMBAR knockdown therapy treats myocardial hypertrophy caused by ISO and prevents the occurrence of heart failure; 3. CMBAR expression increases in myocardial remodeling caused by pressure overload, and CMBAR small interfering RNA can alleviate myocardial hypertrophy and decreased cardiac function caused by aortic coarctation through intravenous administration.

[0274] Example 5: Knockdown effect of human CMBAR small interfering RNA

[0275] (1) Culture human cardiomyocyte line AC16 and transfect it with CMBAR small interfering RNA (as shown in Table 3).

[0276] 24 hours before transfection, cells were passaged and seeded into 12-well plates, with the degree of growth and polymerization controlled to reach 50-70% at the time of transfection. 1 μg of the target plasmid DNA, 4 μL of P3000, and 2 μL of Lipofectamine 3000 were resuspended in 100 μL of Opti-MEM per well and incubated at room temperature for 5 min. The incubated plasmid and liposome suspension were then mixed gently by pipetting and incubated at room temperature for 15 min. The mixture was then evenly added to the cells, gently mixed, and incubated at 37°C and 5% CO2 for 8 h. The transfected culture medium was discarded, and normal cell culture medium was added. Cells were incubated at 37°C and 5% CO2 for 48 h, after which cell expression of the target gene was detected.

[0277] Table 3

[0278] name sequence Serial Number Human CMBAR small interfering RNA1 AAUUAAAGCUCCAGACUGUTT SEQ NO.24 Human CMBAR small interfering RNA2 GUUGAAACGAUAUACACUATT SEQ NO.25

[0279] (2) RNA was extracted from mouse heart, reverse transcribed, and then real-time quantitative PCR was performed to detect the expression of CMBAR in AC16 cells.

[0280] Extraction of cellular RNA

[0281] Add 1 mL of Trizol reagent to each well of a 12-well plate, lyse, and transfer to a 1.5 mL EP tube; let stand at room temperature for 5 min; add 1 / 5 volume of chloroform (0.2 mL / 1 mL Trizol), shake vigorously for 15 s, and let stand at room temperature for 2–3 min; centrifuge at 12000 g, 4 °C for 15 min, and transfer the upper aqueous phase to a new EP tube; add an equal volume (0.25 mL) of isopropanol, shake gently for 15 s, and let stand at room temperature for 10 min; centrifuge at 12000 g, 4 °C for 10 min, discard the supernatant and keep the precipitate; add 1 mL of... Centrifuge the EP tube several times by inverting it with 75% (volume) ethanol at 7500g and 4℃ for 5 min, and discard the supernatant. Let it air dry at room temperature for 5-10 min until semi-dry to obtain RNA. Add an appropriate amount of sterile DEPC water to redissolve the RNA. Take 1 μL of the dissolved RNA and use an ultra-micro UV spectrophotometer (Q5000) to determine the concentration and quality (concentration >200 ng / uL, 260 / 280 controlled between 1.9 and 2.0). Store at -80℃ for later use.

[0282] RNA reverse transcription reaction:

[0283] Using Takara RT kit

[0284] The specific method is as follows:

[0285] The reverse transcription reaction is as follows:

[0286]

[0287] Mix well, react at 37℃ for 15 min; at 85℃ for 5 s, place on ice to obtain cDNA after reverse transcription; dilute 10 μL of the cDNA 20 times to 200 μL, store at -20℃ for the next step of real-time quantitative PCR detection.

[0288] Real-time quantitative PCR detection of RNA expression in cells:

[0289] Real-time quantitative PCR was performed using Takara's SYBR.

[0290] The specific steps are as follows:

[0291] The PCR reaction system was constructed as follows:

[0292]

[0293] Mix well. The reaction procedure is as follows:

[0294] Pre-denaturation: 95℃, 5 min;

[0295] Denaturation: 94℃, 5 seconds;

[0296] Annealing: 60℃, 30 seconds;

[0297] Extension: 72℃, 30 seconds; 40 cycles in total;

[0298] After the reaction was completed, the PCR melting curve was obtained, and the gene expression level was calculated.

[0299] Table 4

[0300]

[0301]

[0302] like Figure 13 As shown, the expression level of CMBAR in AC16 human cardiomyocytes was detected using two pairs of qPCR primers. The results showed that both siRNA-1 and siRNA-2 could significantly reduce the expression of CMBAR in human cardiomyocytes.

[0303] Relative CMBAR levels in AC16( / GAPDH): The relative expression levels of CMBAR in AC16 human cardiomyocytes compared to GAPDH.

[0304] In summary, we have discovered for the first time that the cardiomyocyte membrane-localized lncRNA CMBAR interacts with β1AR, revealing a novel RNA localization and function. We elucidated the changes of CMBAR in myocardial remodeling caused by heart failure and stress overload, and found that targeting CMBAR effectively alleviates myocardial remodeling induced by persistent adrenaline signaling activation and stress overload, providing a potential therapeutic target for myocardial remodeling caused by adrenaline signaling and stress overload. This invention reveals the effectiveness of CMBAR in screening drug targets for the prevention and / or treatment of heart failure; confirms the effectiveness of CMBAR small interfering RNAs, as shown in SEQ NO. 24 or SEQ NO. 25, in the preparation of drugs for the prevention and / or treatment of heart failure; and demonstrates the effectiveness of its use in drugs for the prevention and / or treatment of myocardial remodeling diseases.

[0305] The above are merely embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention are included within the scope of the claims of the present invention.

Claims

1. An RNA sequence for treating myocardial remodeling diseases, characterized in that, The sequence is shown in SEQ NO.

1.

2. The use of the RNA sequence for treating myocardial remodeling diseases as described in claim 1 in screening drug targets for the prevention and / or treatment of heart failure diseases.

3. The use of the RNA sequence for treating myocardial remodeling diseases as described in claim 1 as a therapeutic target for the prevention and / or treatment of myocardial remodeling diseases.

4. The use of the RNA sequence for treating myocardial remodeling diseases as described in claim 2 as a therapeutic target for the prevention and / or treatment of myocardial remodeling diseases, characterized in that, The heart failure described refers to heart failure caused by stress overload conditions.

5. The use of the primers for detecting the RNA sequence used in claim 1 for treating myocardial remodeling diseases, characterized in that, The primers include sequences as shown in SEQ NO.10, SEQ NO.11, SEQ NO.26, and SEQ NO.

27.

6. The RNA sequence inhibitor for treating myocardial remodeling diseases as described in claim 1, characterized in that, The inhibitor is a small interfering RNA of the RNA sequence used to treat myocardial remodeling diseases, and the nucleotide sequence of the small interfering RNA is shown in SEQ NO.24 or SEQ NO.

25.

7. Use of the RNA sequence inhibitor of claim 6 for treating myocardial remodeling diseases in the preparation of medicaments for the prevention and / or treatment of heart failure diseases.

8. The use of the inhibitor of the RNA sequence for treating myocardial remodeling diseases as described in claim 7 in the preparation of a medicament for the prevention and / or treatment of heart failure, characterized in that, The vector for the inhibitor includes an adeno-associated virus vector.

9. The use of the RNA sequence inhibitor for treating myocardial remodeling diseases as described in claim 8 in the preparation of a medicament for the prevention and / or treatment of heart failure, characterized in that, The adeno-associated virus vector is an adeno-associated virus vector with a myocardial-specific promoter.

10. The use of the inhibitor of the RNA sequence for treating myocardial remodeling diseases as described in claim 9 in the preparation of a medicament for the prevention and / or treatment of heart failure, characterized in that, The adeno-associated virus vector is the AAV9 vector.

Images