3 'UTR element, recombinant vector and preparation method and application thereof
By using the Actg1 3' UTR element and a recombinant adeno-associated virus vector, the problems of gene expression stability and specificity in neurons were solved, achieving efficient and sustained gene expression and improving the treatment effect of nervous system diseases.
Patent Information
- Application Number
- CN202610025883.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-02-06
AI Technical Summary
The expression efficiency and stability of existing 3' UTR elements in neurons have not been fully optimized, making it difficult to achieve long-term, stable and cell-type-specific gene expression, which limits the efficacy of gene therapy for neurological diseases.
Using the 3' UTR element of the actin γ1 (Actin Gamma 1, Actg1) gene, a recombinant adeno-associated virus vector was designed and constructed through systematic screening and functional validation. This vector carries a fluorescent protein reporter gene and the pCALM1 promoter, enabling efficient and persistent expression of exogenous genes in neurons.
It achieves equally efficient, persistent, and more cell-type-specific gene expression in neurons, improves mRNA stability and translation efficiency, provides more flexible gene expression regulation options, and reduces potential biological risks.
Smart Images

Figure CN121472228A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to 3' UTR elements, recombinant vectors, their preparation methods and applications. Background Technology
[0002] The brain is primarily composed of neurons that perform information processing and glial cells that provide support for these functions. In neurodegenerative diseases such as Alzheimer's, Parkinson's, and multiple sclerosis, the core pathology is often closely related to progressive neuronal damage and death. Therefore, achieving long-term, stable expression of therapeutic proteins such as neurotrophic factors in neurons through gene delivery has become a promising therapeutic strategy. Against this backdrop, the 3' UTR is increasingly important due to its ability to directly regulate mRNA stability, translation efficiency, and final protein yield, playing a crucial role in neuronal development, functional maintenance, plasticity, and regeneration. However, existing 3' UTRs are not fully optimized, and the cell specificity of gene expression needs improvement. Summary of the Invention
[0003] Based on this, this application provides a 3' UTR element, a recombinant vector, its preparation method, and its applications. Using the 3' UTR element of this application, specific and efficient expression of exogenous genes in neuronal host cells can be achieved.
[0004] The first aspect of this application provides a 3' UTR element, the nucleotide sequence of which contains: a fragment sequence from the stop codon of the actin family 1 gene to the poly A tail signal site on the positive strand, the nucleotide sequence of the poly A tail signal site being: AATAAA; and / or, the fragment sequence being 719 bp in length, the nucleotide sequence of the 3' UTR element being as shown in SEQ ID NO: 1.
[0005] The inventors of this application selected the actin γ1 (Actin Gamma 1, Actg1) gene and conducted in-depth analysis and innovative design of the 3' UTR of the mRNA. Through systematic screening and functional verification, a novel 3' UTR element (named Actg1 element) was successfully obtained. Experimental verification showed that, compared with the bovine growth hormone poly A signal (bGHpA) widely used in neuroscience research and gene therapy, the Actg1 element, when applied to the rAAV vector, can achieve equally efficient, persistent, and more cell-type-specific expression in neurons after the exogenous gene is delivered to the brain.
[0006] A second aspect of this application provides a recombinant carrier carrying the 3' UTR element described above.
[0007] In some embodiments, the recombinant vector is a recombinant adeno-associated virus expression vector packaged with the 3' UTR element; Furthermore, the recombinant vector also carries a fluorescent protein reporter gene and a pCALM1 promoter.
[0008] A third aspect of this application provides a method for constructing the aforementioned recombinant vector, comprising the following steps: A backbone vector was constructed and linearized. The backbone vector was an adeno-associated virus backbone vector containing a fluorescent protein reporter gene. The gene fragment of the 3' UTR element was obtained by amplification using PCR amplification technology. The linearized backbone vector is ligated to the gene fragment of the 3' UTR element to obtain the recombinant vector.
[0009] In some embodiments, in the step of amplifying the gene fragment of the 3' UTR element using PCR amplification technology, the amplification primer pair used contains a sequence complementary to the Actg1 template, and the 5' end contains an arm region homologous to the sequences at both ends of the linearized backbone vector. Furthermore, the nucleotide sequences of the amplification primer pair are as shown in SEQ ID NO: 2-SEQ ID NO: 3.
[0010] A fourth aspect of this application provides a recombinant virus packaged with the recombinant vector described above.
[0011] In some embodiments, the recombinant virus is a recombinant adeno-associated virus.
[0012] The fifth aspect of this application provides a method for constructing the aforementioned recombinant virus, comprising the following steps: The recombinant vector, packaging vector, and helper vector were co-transfected into 293T cells, and the virus was isolated to obtain the recombinant virus.
[0013] The sixth aspect of this application provides the use of the 3' UTR element described above, or the recombinant vector described above, or the recombinant virus described above in the preparation of related reagents and / or drugs for neural circuit tracing, and / or gene therapy drugs for the nervous system.
[0014] The seventh aspect of this application provides a neurological therapeutic drug, comprising: the recombinant virus described above.
[0015] In some embodiments, a second virus is also included, the second virus comprising a 3' UTR element derived from the Rtn1 gene; wherein the viral genome titer ratio of the recombinant virus to the second virus is (1:10) to (10:1). Attached Figure Description
[0016] Figure 1 A schematic diagram illustrating the construction of the recombinant plasmid pAAV-pCALM1-EYFP-Actg1; Figure 2 The results of cell transfection with plasmids pAAV-pCALM1-EYFP-Actg1 and pAAV-pCALM1-EYFP-bGHpA, and the comparison of fluorescence values; Figure 3 Fluorescence distribution in the M1 brain region of mice infected with PHP.eB-pCALM1-EYFP-Actg1 and PHP.eB-pCALM1-EYFP-bGHpA viruses; Figure 4 The results are the gene sequencing results of the recombinant plasmid in Example 1. Detailed Implementation
[0017] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a more complete understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.
[0018] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in this application and in its specification is for descriptive purposes only and is not intended to be limiting of the application.
[0019] Unless otherwise stated or in case of conflict, the terms or phrases used in this application shall have the following meanings: The terms "and / or," "or / and," and "and / or" as used in this application encompass any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected using at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes solutions connected by "logical AND," and also undoubtedly includes solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").
[0020] In this application, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or embodiments that achieve better results, and should be understood not to limit the scope of protection of this application.
[0021] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.
[0022] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.
[0023] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.
[0024] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.
[0025] Unless otherwise specified, the percentage content mentioned in this application refers to mass percentage for solid-liquid mixtures and solid-phase-solid mixtures, and volume percentage for liquid-phase-liquid mixtures.
[0026] Unless otherwise specified, all percentage concentrations mentioned in this application refer to the final concentration. The final concentration refers to the proportion of the added component in the system after the addition of that component.
[0027] All references to this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the purpose and / or technical solution of this application, all cited references are incorporated herein by reference in their entirety and for all purposes. When references are cited in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.
[0028] Adeno-associated virus (AAV) is a non-enveloped, icosahedral microvirus with a linear single-stranded DNA genome. Wild-type AAV typically requires co-infection with helper viruses (such as adenovirus or herpesvirus) for effective replication and proliferative infection. Due to its high infection specificity, long-term stable gene expression, and low immunogenicity, AAV has been widely modified as a gene delivery tool. Recombinant adeno-associated virus (rAAV) is a novel gene vector modified from wild-type AAV. In addition to the above advantages, it also features a wide host cell range, high biocompatibility, and the ability to achieve long-term expression of exogenous genes in vivo.
[0029] Currently, rAAV has been widely used in transgenic research and the development of gene therapy drugs. In the treatment of neurological diseases, the choice of vector and delivery method are crucial. Due to the presence of the blood-brain barrier, peripherally administered gene expression products are difficult to effectively accumulate in the central nervous system, thus limiting therapeutic efficacy. To overcome this obstacle, existing technologies mostly employ stereotactic injection to directly cross the blood-brain barrier, or intramuscular injection relying on retrograde transport via nerve axons to deliver exogenous genes to nerve cells.
[0030] Many neurological diseases are accompanied by neuronal apoptosis and progressive neurological decline; therefore, supplementing with neurotrophic factors with neuroprotective functions is an important therapeutic strategy. However, direct delivery of neurotrophic factor proteins has problems such as short in vivo half-life and difficulty in targeting lesion sites. Although using rAAV vectors to deliver their encoding genes can achieve sustained in vivo expression, the expression efficiency of exogenous genes is still limited by the stability and translational activity of their messenger RNA (mRNA) in cells.
[0031] Ribonucleic acid (RNA) is a long-chain molecule formed by the polymerization of ribonucleotides through phosphodiester bonds. It plays a central role in the transmission of genetic information and is widely involved in life processes such as gene expression and protein synthesis. Among them, messenger RNA (mRNA) is responsible for transmitting the genetic information of DNA to ribosomes, serving as a direct template for protein synthesis. However, natural mRNA molecules have low abundance in cells, short half-life, and are easily degraded. Their expression levels fluctuate with changes in cell state and environment, which limits the stable and efficient production of functional proteins encoded by them (such as neurotrophic factors).
[0032] In eukaryotic gene transcription, RNA polymerase uses specific polyadenylation signals (such as AAUAAA or AUUAAA) on the precursor messenger RNA (pre-mRNA) molecule as recognition markers to initiate and mediate the terminal splicing and polyadenylation of pre-mRNA. This process is accomplished by covalently linking a polyadenylation sequence (i.e., the poly-A tail) to the 3' end of the mRNA and is an indispensable key step in mRNA maturation. The formed poly-A tail not only provides physical protection for the mRNA, enabling it to effectively resist degradation by exonucleases, but also has a crucial impact on its transport from the nucleus to the cytoplasm, the maintenance of stability in the cytoplasm, and the final translation efficiency. These functions are closely related to specific sequence elements located in the 3' untranslated region (3' UTR) of the mRNA. The 3' UTR is a non-coding sequence immediately downstream of the coding region, which contains not only the core polyadenylation signal but also a GU / U-rich auxiliary sequence approximately 10-30 bases downstream, among other key regulatory elements. In eukaryotes, the 3' UTR serves as the central hub of the posttranscriptional regulatory network. It can be recognized and bound by various RNA-binding proteins and non-coding RNAs, thereby enabling precise control over gene expression by regulating the degradation rate of mRNA and the efficiency of translation initiation.
[0033] Therefore, enhancing the expression level and persistence of heterologous genes in host cells, especially in highly differentiated cells (such as neurons), largely depends on the rational design and optimization of gene expression vectors. This involves the systematic consideration and selection of various functional elements within the vector, including but not limited to promoters, enhancers, introns, internal ribosome entry sites (IRES), and polyadenylation signals and their derived 3' UTR sequences. However, current research focuses primarily on the first few elements, while systematic research and optimization on how polyA signals from different sources and their defined specific 3' UTR sequences affect the expression specificity, level, and long-term stability of exogenous genes in complex tissues (such as the brain) are insufficient. This constitutes a technological gap that urgently needs to be explored in this field.
[0034] The brain is primarily composed of neurons that perform information processing and glial cells that provide support for these functions. In neurodegenerative diseases such as Alzheimer's, Parkinson's, and multiple sclerosis, the core pathology is often closely related to progressive neuronal damage and death. Therefore, achieving long-term, stable expression of therapeutic proteins such as neurotrophic factors in neurons through gene delivery has become a promising therapeutic strategy. Against this backdrop, the 3'UTR is increasingly important due to its ability to directly regulate mRNA stability, translation efficiency, and final protein yield, and its crucial role in neuronal development, functional maintenance, plasticity, and regeneration.
[0035] In recent years, optimizing the 3' untranslated region (3' UTR) of messenger RNA (mRNA) using genetic engineering techniques to improve the expression efficiency of exogenous genes has become an important research direction in the fields of gene therapy and biotechnology. Existing studies have confirmed that rationally designed and screened 3' UTR sequences can significantly enhance the stability and translation efficiency of mRNA. For example, published patent CN119752896A reports a 3' UTR element derived from the reticulum family 1 gene (Rtn1). This element, when driving reporter gene expression in neurons, exhibits superior efficiency compared to the traditional bovine growth hormone poly A signaling (bGHpA), providing a powerful tool for gene therapy and circuit tracing in the nervous system.
[0036] However, despite the positive results achieved by the Rtn1 element, the regulatory mechanism of 3' UTR is highly gene-origin-specific and context-dependent, meaning that a single dominant element cannot meet all the complex research and clinical application needs. The urgent need for alternatives stems primarily from the following reasons: First, there is a need for "tool diversity" in gene expression regulation. Just as scientific research requires promoters of varying intensities and fluorescent proteins of different spectra, the "toolbox" of 3' UTR elements also needs members from different sources and with different characteristics. Different experimental or therapeutic goals have different requirements for the level, duration, and dynamics of gene expression. In some gene therapy scenarios that require mild, sustained rather than high-intensity expression, a 3'UTR with moderate expression levels but excellent stability may be more suitable. Therefore, developing alternative elements with different expression characteristics than Rtn1 can provide more flexible and precise regulatory options.
[0037] Second, there is a need to mitigate potential biological risks and explore novel regulatory mechanisms. The widespread application of any single biological element may be accompanied by potential unknown risks. The Rtn1 gene itself has been mentioned in neurological diseases and certain cancers. Although its application in vectors involves truncated sequences, exploring 3' UTR elements from other sources with clearer biological backgrounds helps reduce technical risks and provides an irreplaceable comparative model for understanding how different sequence structures (such as length, base composition, and RNA-binding protein recognition motifs) affect mRNA fate. Actin, as a core component of the cytoskeleton, has highly conserved 3' UTRs in its gene family members (such as Actg1), which typically carry efficient post-transcriptional regulatory information essential for maintaining basic cellular functions. This makes it a highly promising candidate, potentially with a fundamentally different regulatory logic from Rtn1.
[0038] Third, compatibility requirements must be met with different exogenous genes and delivery systems. The efficacy of a 3' UTR element may be influenced by its upstream coding sequence (i.e., the therapeutic gene to be expressed). Rtn1 elements may perform well when paired with certain specific genes, but there is no guarantee that their combination with all neurotrophic factors, enzymes, or regulatory factors will achieve optimal results. Therefore, systematically screening and identifying 3' UTRs from various sources is crucial for advancing cutting-edge fields such as multigene synergistic therapy and the construction of complex gene circuits.
[0039] Based on the above understanding, this application is not intended to simply replace or surpass existing Rtn1 elements, but rather to enrich the diversity of 3' UTR elements and fill the technological gap in this field where alternatives are scarce. This application selected the actin γ1 (Actin Gamma 1, Actg1) gene and successfully identified and isolated its specific 3' UTR sequence. This sequence differs significantly from the known Rtn1 element (578 bp) in length (719 bp), primary structure, and distribution of potential cis-acting elements.
[0040] The novel 3' UTR element of this application will now be described in detail: The first aspect of this application provides a 3' UTR element, the nucleotide sequence of which contains a fragment sequence from the stop codon of the actin family 1 gene to the poly A tailing signal site on the sense strand.
[0041] Actin γ1 is a cytoplasmic actin found in non-muscle cells. As a cornerstone of the cytoskeleton, it participates in almost all fundamental cellular processes, including maintaining cell morphology, movement, division, and signal transduction. Mutations in the Actg1 gene are a major cause of severe neurodevelopmental disorders such as Baraiser-Winter syndrome, highlighting its irreplaceable role in normal development, particularly brain development. Research on Actin γ1 serves as a crucial bridge between basic cell biology and human diseases. The inventors of this application selected the Actin Gamma 1 (Actg1) gene and conducted in-depth analysis and innovative design of the 3' UTR of its mRNA. Through systematic screening and functional verification, a novel 3' UTR element (named the Actg1 element) was successfully obtained. Experimental verification showed that, compared to the bovine growth hormone poly A signal (bGHpA) widely used in neuroscience research and gene therapy, the Actg1 element, when applied to the rAAV vector, achieves equally efficient, persistent, and more cell-type-specific expression in neurons after the exogenous gene is delivered to the brain.
[0042] In some embodiments, actin γ1 is derived from the human actin gene. It has broader biocompatibility.
[0043] In some embodiments, the nucleotide sequence of the poly A-tailing signal site is AATAAA. AATAAA is a cis-acting element located in the 3' untranslated region of a eukaryotic protein-coding gene, primarily used to guide the precise cleavage of the polyadenylation complex into the mRNA precursor.
[0044] In some embodiments, the fragment sequence is 719 bp in length. The Actg1 element of this application has a longer sequence length, which may cover more complete regulatory information and is applicable to a variety of exogenous genes.
[0045] In some embodiments, the nucleotide sequence of the 3' UTR element is as shown in SEQ ID NO: 1. The 3' UTR element with the nucleotide sequence shown in SEQ ID NO: 1 exhibits a more stable expression trend in specific neuronal subpopulations, providing a new tool for precision gene therapy.
[0046] Specifically, the sequence shown in SEQ ID NO: 1 is: .
[0047] The nucleotide sequence of the Actg1 3' UTR element provided in this application is shown in SEQ ID NO:1. Those skilled in the art can foresee its potential for various design modifications and expanded applications. Furthermore, the Actg1 element provided in this application differs fundamentally from existing technologies (such as the Rtn1 element disclosed in CN119752896A) in sequence origin, structural characteristics, and potential application advantages. This provides a novel and complementary tool option for gene expression regulation. A specific comparison is as follows: 1. Genetic origin and biological background: The Actg1 3' UTR element in this application is derived from the Actin Gamma 1 gene, a core component of the cytoskeleton, which is involved in maintaining basic cell morphology, movement, and division. Its expression is usually closely related to cellular basal metabolism and homeostasis.
[0048] The existing Rtn1 element is derived from the Reticulon 1 gene and is mainly involved in the morphological shaping of the endoplasmic reticulum. It is upregulated in nervous system stress response, certain cancers, and neurodegenerative diseases.
[0049] This comparison shows that Actg1 originates from a "household gene," has a more universal biological background, and carries lower potential risks. This makes Actg1 a better or safer option for treatment regimens that require long-term, stable, and basal expression.
[0050] 2. Sequence structure and length: The Actg1 3' UTR element in this application has a sequence length of 719 bp. The longer sequence may contain more RNA-binding protein (RBP) recognition sites and complex secondary structures, providing more possibilities for fine regulation.
[0051] The existing Rtn1 element has a sequence length of 578 bp and a relatively compact structure.
[0052] This comparison shows that a longer Actg1 sequence may form a more complex regulatory logic, which is suitable for studying different types of post-transcriptional regulatory mechanisms.
[0053] 3. Expression characteristics (based on experiments): The Actg1 3' UTR element of this application enables efficient and persistent reporter gene expression in neurons, with expression levels comparable to or better than bGHpA, and may exhibit different expression kinetics (e.g., onset time, long-term stability). The existing Rtn1 element exhibits high reporter gene expression intensity in neurons.
[0054] This comparison shows that this application does not aim to simply replace Rtn1, but rather to provide an alternative with different, rather than superior, expression characteristics. In some applications where peak expression is not the primary concern, but rather expression persistence or cell compatibility, Actg1 may be more advantageous.
[0055] In summary, the Actg1 3' UTR element of this application aims to cover its complete posttranscriptional regulatory information by retaining a longer natural sequence derived from the human gene, thereby providing better mRNA stability and translation efficiency after the exogenous gene is introduced into the neuron, ultimately achieving a higher level of protein expression.
[0056] A second aspect of this application provides a recombinant carrier carrying the 3' UTR element described above.
[0057] In some embodiments, the recombinant vector is a recombinant adeno-associated virus expression vector packaged with the 3' UTR element. Adeno-associated virus (AAV) is a non-enveloped, icosahedral microvirus with a linear single-stranded DNA genome. Wild-type AAV typically requires co-infection with helper viruses (such as adenovirus or herpesvirus) for effective replication and proliferative infection. Due to its high infection specificity, long-term stable gene expression ability, and low immunogenicity, AAV has been widely modified as a gene delivery tool. Recombinant adeno-associated virus (rAAV) is a novel gene vector modified from wild-type AAV. In addition to the advantages mentioned above, it also has the characteristics of a wide host cell range and high biosafety, enabling long-term expression of exogenous genes in vivo. Packaging the 3' UTR element of this application into a recombinant adeno-associated virus expression vector can achieve long-term stable expression of the 3' UTR element.
[0058] Furthermore, the recombinant vector also carries a fluorescent protein reporter gene and a pCALM1 promoter. Specifically, the fluorescent protein reporter gene is an enhanced yellow fluorescent protein (EYFP) gene, to visually assess the regulatory function of the Actg1 element.
[0059] The third aspect of this application provides a method for constructing the aforementioned recombinant vector, comprising the following steps S110-S130: S110. Construct a backbone vector and linearize the backbone vector, wherein the backbone vector is an adeno-associated virus backbone vector and contains a fluorescent protein reporter gene; S120. Amplify the gene fragment of the 3' UTR element using PCR amplification technology; S130. The linearized backbone vector is ligated to the gene fragment of the 3' UTR element to obtain the recombinant vector.
[0060] In some preferred embodiments, plasmid pAAV-pCALM1-EYFP-bGHpA was selected as the backbone. This selection has the following significant advantages: First, using bGHpA, which is widely used in the industry, as a direct control allows for the clearest verification of the core function of the Actg1 element in this application. Second, this backbone ensures complete consistency of all regulatory elements except the 3' UTR (such as the neuron-specific promoter pCALM1 and the reporter gene EYFP), achieving rigorous single-variable comparison and attributing experimental results entirely to differences in the 3' UTR element. Finally, this backbone system is mature and stable, facilitating rapid viral packaging and subsequent in vitro and in vivo functional verification, and providing a reliable platform for comparative analysis with existing 3' UTR elements from different sources (such as Rtn1) under the same conditions.
[0061] In some embodiments, in step S120, the amplification primer pair used contains a sequence complementary to the Actg1 template, and the 5' end contains an arm region homologous to the sequences at both ends of the linearized backbone vector.
[0062] Furthermore, the amplification primer pair is as follows: FW: tcggcatggacgagc tgtacaagtaaacggactcagcagatgcgta (as shown in SEQ ID NO:2); RV: gtccgcacgtgccac accggtccaaacaggagccattcattggttacggcagcacttttatt (as shown in SEQ ID NO:3); Among them, the bolded and underlined parts in the sequences shown in SEQ ID NO:2 and SEQ ID NO:3 are homologous arms.
[0063] In step S120, the amplification primers were specially designed so that their 5' ends contained arms precisely homologous to both ends of the linearized backbone vector. This design yielded several beneficial effects: First, it enabled seamless and precise insertion of the Actg1 element, completely avoiding the unexpected base deletions or unnecessary sequences that might be introduced by traditional enzyme digestion and ligation methods, thus ensuring the structural and functional integrity of the tested 3' UTR sequence. Second, the precise repair of the EYFP coding region ends by the upstream primer homologous arms effectively eliminated the risk of frameshift mutations, ensuring the reliable operation of the reporter gene system. Finally, this strategy significantly improved the success rate and efficiency of clone construction, laying a technical foundation for the rapid validation and subsequent widespread application of this application.
[0064] A fourth aspect of this application provides a recombinant virus packaged with the recombinant vector described above.
[0065] In some embodiments, the recombinant virus is a recombinant adeno-associated virus.
[0066] The 3' UTR element described in this application is packaged as a recombinant adeno-associated virus, which has the characteristics of high infection specificity, long-term stable gene expression ability, low immunogenicity, and high biosafety, and can achieve long-term expression of exogenous genes in vivo.
[0067] The fifth aspect of this application provides a method for constructing the aforementioned recombinant virus, comprising the following steps: The recombinant vector, packaging vector, and helper vector were co-transfected into 293T cells, and the virus was isolated to obtain the recombinant virus.
[0068] In some embodiments, the packaging carrier includes, but is not limited to, the capsid plasmid PHP.eB. The helper plasmid includes, but is not limited to, the pHelper plasmid (from Agilent Technologies, Cat. No. 240071).
[0069] The sixth aspect of this application provides the use of the 3' UTR element described above, or the recombinant vector described above, or the recombinant virus described above in the preparation of related reagents and / or drugs for neural circuit tracing, and / or gene therapy drugs for the nervous system.
[0070] The seventh aspect of this application provides a neurological therapeutic drug, comprising the recombinant virus provided in the fourth aspect above.
[0071] The Actg1 element in the aforementioned recombinant virus can achieve equally efficient, persistent, and more cell-type-specific expression in neurons after the exogenous gene is delivered to the brain. It can be prepared into a neurological therapeutic drug for the treatment of neuronal damage, etc.
[0072] In some embodiments, the neurotherapeutic drug further includes a second virus containing a 3' UTR element derived from the Rtn1 gene. The viral genome titer ratio of the recombinant virus to the second virus is (1:10) to (10:1). The combined action of the recombinant virus and the second virus can enhance the therapeutic effect of the neurotherapeutic drug.
[0073] In some embodiments, the second virus is a recombinant adeno-associated virus containing a 3' UTR element derived from the Rtn1 gene. Further, the 3' UTR element derived from the Rtn1 gene includes, but is not limited to, the 3' UTR element disclosed in patent application number 202411861652.4. The second virus includes, but is not limited to, the recombinant virus disclosed in patent application number 202411861652.4. This configuration allows the second virus to synergize with the aforementioned recombinant virus, further enhancing the therapeutic effect of neurological treatment drugs.
[0074] In some embodiments, the neurological therapeutic agents of this application further include pharmaceutically acceptable excipients, including but not limited to one or more of the following: buffers (such as PBS), isotonic modifiers (such as sodium chloride), stabilizers (such as human serum albumin), carriers, or surfactants (such as polysorbate 80). The addition of these excipients helps maintain viral stability, ensures the physiological compatibility of the formulation, and provides a formulation suitable for storage, transportation, and administration.
[0075] To address current challenges such as insufficient stability and translation efficiency of exogenous gene mRNA, inadequate optimization of the key regulatory element of gene expression vectors—the 3' UTR—and the need to improve cell specificity of gene expression, this application provides a novel 3' UTR sequence element and its applications, enabling specific and efficient expression of exogenous genes in various host cells, including neurons. Furthermore, the Actg1 element provided in this application offers a high-performance key tool for precise tracing of neural circuits, development of next-generation gene therapy drugs for nervous system diseases, and efficient transgenic research, possessing broad application prospects and enormous industrialization potential.
[0076] The following is a specific embodiment.
[0077] Unless otherwise specified, the reagents and instruments used in the examples are conventionally selected in the art. Experimental methods not specifying particular conditions in the examples are typically performed under standard conditions, such as those described in literature, books, or recommended by the reagent kit manufacturer. All reagents used in the examples are commercially available.
[0078] In the following examples, unless otherwise specified, 293T cells were prepared using ATCC CRL-3216; complete culture medium (containing 10% v / v fetal bovine serum, from Gibco, batch number 26010074 and 1% v / v penicillin antibody, from Gibco, batch number 15070063): Example 1 I. Construction of recombinant plasmid pAAV-pCALM1-EYFP-Actg1: In this embodiment, the enhanced yellow fluorescent protein (EYFP) gene was selected as the reporter gene to visually evaluate the regulatory function of the Actg1 element (i.e., the 3' UTR element with the nucleotide sequence shown in SEQ ID NO: 1). The recombinant plasmid pAAV-pCALM1-EYFP-Actg1 was successfully constructed. The vector construction process is as follows: 1. Virtual Construction and Backbone Preparation: The plasmid structure was virtually constructed using Snapgene software (construction strategy as follows). Figure 1 As shown, Figure 1 (Schematic diagram for constructing recombinant plasmid pAAV-pCALM1-EYFP-Actg1). Using plasmid pAAV-pCALM1-EYFP-bGHpA as the backbone, the original bovine growth hormone polyA signal (bGHpA) was replaced with Actg1 through molecular manipulation. The backbone plasmid was double-digested with restriction endonucleases BsrGI and AgeI at 37°C for 2 hours to obtain the linearized vector fragment for subsequent ligation. The enzyme digestion reaction system is detailed in Table 1.
[0079] Table 1. Enzyme digestion system of pAAV-pCALM1-EYFP-bGHpA vector
[0080] 2. Amplification of the target fragment: Using genomic DNA from human embryonic kidney HEK293T cells (ATCC CRL-3216) as a template, the Actg1 target fragment (the nucleotide sequence of the Actg1 target fragment is shown in SEQ ID NO: 1) was specifically amplified by polymerase chain reaction (PCR). The primers used for amplification were: FW: tcggcatggacgagc tgtacaagtaaacggactcagcagatgcgta (as shown in SEQ ID NO:2); RV: gtccgcacgtgccac accggtccaaacaggagccattcattggttacggcagcactttttatt (as shown in SEQ ID NO:3); the PCR amplification reaction system is shown in Table 2, and the PCR amplification procedure is shown in Table 3. Since the BsrGI restriction site is located within the EYFP coding region, to ensure the integrity and correctness of the final EYFP amino acid sequence and avoid frameshift mutations, a portion of the EYFP coding sequence (i.e., the bolded and underlined portion in the sequences shown in SEQ ID NO:2 and SEQ ID NO:3) needs to be introduced upstream of the Actg1 sequence as a homologous arm when designing amplification primers.
[0081] 3. Homologous Recombination Ligation: To minimize unexpected base deletions or insertions due to enzyme digestion, this embodiment employs high-fidelity homologous recombination technology for ligation of the vector and fragment. Accordingly, the designed PCR primers (i.e., primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3) contain sequences complementary to the Actg1 template, and their 5' ends also contain arm regions completely homologous to the sequences at both ends of the linearized vector (i.e., the bolded and underlined portions in the sequences shown in SEQ ID NO:2 and SEQ ID NO:3). The PCR amplification reaction system and procedure are shown in Tables 2 and 3, respectively. The purified linearized backbone and the amplified Actg1 fragment are mixed according to the system shown in Table 4 and reacted at 50°C for 30 minutes to efficiently complete directional ligation, obtaining the target recombinant plasmid pAAV-pCALM1-EYFP-Actg1. The recombinant plasmid is then subjected to gene sequencing (i.e., Sanger Sequence) for verification (e.g., ...). Figure 4 As shown in the figure, the target recombinant plasmid pAAV-pCALM1-EYFP-Actg1 is linked with Actg1.
[0082] Table 2 Actg1 fragment amplification system
[0083] Table 3 Fragment Amplification Procedure
[0084] Table 4 Connection System
[0085] II. After completing plasmid construction, functional verification is performed through cell transfection. The specific steps are as follows: 1. Cell preparation: 293T cells were seeded at a confluence density of 60% in 24-well plates containing complete culture medium (containing 10% v / v fetal bovine serum and 1% v / v antibiotics) and cultured at 37°C and 5% CO2 until the appropriate density was reached.
[0086] 2. Cell Transfection: When the cell density reaches 80%-90%, use jetOPTIMUS transfection reagent (from Polyplus, batch number 101000006) and follow the instructions to transfect the recombinant plasmid pAAV-pCALM1-EYFP-Actg1 into 293T cells. Replace with fresh complete culture medium (containing 10% v / v fetal bovine serum and 1% v / v penicillin antibiotics) 72 hours later, observe and collect fluorescence images under blue excitation light (fluorescence images are shown in...). Figure 2 Simultaneously, cells are collected for protein extraction. Figure 2Cell transfection results and fluorescence value comparison results of plasmids pAAV-pCALM1-EYFP-Actg1 and pAAV-pCALM1-EYFP-bGHpA (Scale bar: 50μm).
[0087] from Figure 2 It can be seen that, Figure 2 The left-hand panel shows that the pAAV-pCALM1-EYFP-bGHpA group, using the conventional bovine growth hormone polyA signal (bGHpA) as the 3' UTR control, exhibits a clear fluorescent signal in cells for its EYFP reporter gene. The pAAV-pCALM1-EYFP-Actg1 group, showing the experimental group after replacing bGHpA with the Actg1 3' UTR element of this application, shows that the distribution and intensity of the EYFP fluorescent signal in cells are visually comparable to the control group or show a positive expression trend. Figure 2 The right-hand side of the graph shows that the bar chart quantifies and compares the average fluorescence intensity of the two groups of cells. (For example...) Figure 2 As shown in the right-hand figure, the average fluorescence intensity of the pAAV-pCALM1-EYFP-Actg1 experimental group was higher than that of the pAAV-pCALM1-EYFP-bGHpA control group. This data indicates that, in this experiment, the Actg1 3' UTR element provided in this application can drive the reporter gene EYFP to achieve efficient expression, with an expression level that is not lower than, and even better than, the widely used bGHpA element.
[0088] III. Based on the above cellular-level validation results, recombinant adeno-associated virus (AAV) was packaged using a three-plasmid co-transfection method. Before virus packaging, a medium amount of the required plasmids was extracted, including the recombinant vector pAAV-pCALM1-EYFP-Actg1, the capsid plasmid PHP.eB (Addgene, Plasmid #103005), and the helper plasmid (Addgene, Plasmid #112867). pAAV-pCALM1-EYFP-bGHpA was used as a control, and the recombinant AAV was packaged using a three-plasmid co-transfection method with the capsid plasmid PHP.eB and the helper plasmid. The specific steps are as follows: 1. Cell preparation: 293T cells were seeded in culture dishes containing complete culture medium (containing 10% v / v fetal bovine serum and 1% v / v antibiotics) and cultured at 37°C in a 5% CO2 incubator to the appropriate density.
[0089] 2. Preparation of transfection complex: Take 15 μg of helper plasmid, 15 μg of packaging plasmid, and 15 μg of recombinant plasmid pAAV-pCALM1-EYFP-Actg1, and gently mix them with 5.25 mL of ultrapure water and 0.8 mL of 2M calcium chloride solution. Then add an equal volume of 2×HBS solution, vortex to mix, and let stand at room temperature for 30 minutes. Simultaneously, replace the recombinant plasmid pAAV-pCALM1-EYFP-Actg1 with pAAV-pCALM1-EYFP-bGHpA plasmid as a control.
[0090] 3. Cell transfection: Add 20 μL of chloroquine solution to each tube of transfection complex, and then add it dropwise to a 293T cell culture dish.
[0091] 4. Virus collection: 72 hours after transfection, the cell suspension was collected, centrifuged at 3000 rpm / min for 30 minutes, the supernatant was discarded, an appropriate amount of cell lysis buffer was added, and after repeated freeze-thaw cycles, a cell lysis suspension containing virus particles was obtained.
[0092] 5. Virus purification: Centrifuge the virus suspension at 12,000 rpm / min for 30 minutes, collect the supernatant, add 200 μL HBS and mix well, then add 200 μL chloroform and centrifuge at 12,000 rpm / min for 5 minutes. Collect the supernatant, add 100 μL 2.5M sodium chloride and 100 μL 40% PEG8000 solution, vortex to mix, and incubate overnight at 4°C. The next day, centrifuge at 12,000 rpm / min for 35 minutes at 4°C, discard the supernatant, resuspend the precipitate in 30 μL HBS, add 0.5 μL nuclease, and digest at room temperature for 30 minutes. Finally, 30 μL of chloroform was added, and the mixture was centrifuged at 12,000 rpm for 5 minutes. The supernatant was collected, aliquoted, and stored at -80°C to obtain recombinant adeno-associated virus (AAV) packaged with the recombinant plasmid pAAV-pCALM1-EYFP-Actg1 (viral titer: 5.88E+13vg / mL) and recombinant AAV packaged with the plasmid pAAV-pCALM1-EYFP-bGHpA (viral titer: 6.28E+13vg / mL). The viral titer was determined using qPCR (i.e., the AAVPrime™ AAV-qPCR titer assay kit, Cat. Nos. AA301 / AA302).
[0093] 6. The purified recombinant adeno-associated virus (AAV) was precisely injected into the unilateral primary motor cortex (M1 area) of 8-week-old male C57BL / 6 mice (obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.) using stereotactic injection technique. The AAV was located 2.0 mm anterior to Bregma, 2.1 mm lateral to Bregma, and at a depth of -1.70 mm. The recombinant AAV used in this experiment employed the pCALM1 promoter, which specifically promotes expression in neurons. Three weeks after injection, the mice were perfused, and their brains were harvested. Frozen sections of brain tissue were prepared, stained with DAPI nuclei, mounted, and the fluorescence expression in the brain slices was observed (results are shown in [link to results]). Figure 3 ). Figure 3 Fluorescence distribution map of the M1 brain region of mice infected with PHP.eB-pCALM1-EYFP-Actg1 and PHP.eB-pCALM1-EYFP-bGHpA viruses (scale bar: 200 μm).
[0094] like Figure 3 As shown, in vivo experimental results indicate that, compared to the control virus pAAV-pCALM1-EYFP-bGHpA, pAAV-pCALM1-EYFP-Actg1 mediates EYFP protein expression with equivalent efficiency in the mouse cerebral cortex. This confirms that the 3' UTR Actg1 element provided in this application can effectively maintain mRNA stability and enhance its translation efficiency in vivo, exhibiting superior gene expression regulation function in cortical neurons, and can be used to prepare neurotherapeutic drugs.
[0095] Actg1, which encodes γ-actin, is a core "household gene" for maintaining cytoskeleton homeostasis. The mRNA of such genes typically needs high stability to ensure the continuous synthesis of basic proteins to meet the long-term structural requirements of the cell. Therefore, its natural 3' UTR likely evolved regulatory features that enhance mRNA stability. In contrast, the Rtn1 gene used in existing technologies (such as CN119752896A) encodes a protein involved in endoplasmic reticulum stress response, and its expression may be more inducible and dynamically variable. Therefore, 3' UTR elements derived from Actg1 may have an inherent advantage over Rtn1 elements in conferring more constitutive and durable expression stability to exogenous genes. This differentiated characteristic makes Actg1 elements particularly suitable for the treatment of chronic neurological diseases requiring long-term, stable expression of therapeutic proteins.
[0096] Example 2: Construction of a neuropharmaceutical composition and its expected synergistic effect This embodiment provides a neuropharmaceutical composition comprising two viruses and elucidates its expected synergistic principle.
[0097] 1. The composition of the neuropharmaceutical composition of this embodiment includes: The recombinant AAV virus (rAAV-pCALM1-EYFP-Actg1) with the Actg1 3' UTR element obtained in Example 1 had a titer of 5.88E+13vg / mL; The second virus (a recombinant AAV virus containing the Rtn1 3' UTR element disclosed in patent CN119752896A, namely rAAV-pCALM1-EYFP-Rtn1) has a titer of 1.12×10¹³ vg / mL. Pharmaceutical excipients: Phosphate-buffered saline (PBS) containing 5% trehalose (stabilizer) and 0.001% polysorbate 80 (surfactant).
[0098] 2. Compatibility Ratio: rAAV-pCALM1-EYFP-Actg1 and rAAV-pCALM1-EYFP-Rtn1 were mixed at a viral genome titer ratio of 1:10 and diluted with excipients to the dosing concentration.
[0099] 3. The principle behind the expected synergistic effect is based on the following reasonable deduction: (1) As described in the background section, Actg1 and Rtn1 have different origins and different regulatory logics. rAAV-pCALM1-EYFP-Actg1 may drive more stable and sustained expression, while rAAV-pCALM1-EYFP-Rtn1 may drive a higher initial expression peak. When the two are combined in a certain ratio, a better overall protein expression curve with less fluctuation can be expected to be generated within the treatment time window, thereby achieving a more sustained and stable therapeutic effect.
[0100] (2) The two different sources of 3' UTR may have subtle differences in their affinity for neuronal subtypes or glial cells due to their different intracellular factor lineages. Combined use is expected to cover a wider range of lesion-related cell types and improve the overall response rate of treatment.
[0101] (3) Using a single potent regulatory element to drive therapeutic gene expression over a long period of time carries the theoretical risk of excessively disturbing intracellular homeostasis or inducing unknown adaptive responses. Using a combination of two elements with different mechanisms of action can be expected to reduce such long-term risks and improve the safety of treatment through differentiation of mechanisms of action.
[0102] 4. Conclusion: The pharmaceutical composition provided in this embodiment, through the scientific combination of the virus of the present invention with other viruses, is expected to produce therapeutic effects superior to those achieved by using a single virus, manifested in more stable efficacy, broader cell coverage, and better safety. This composition provides a new solution for the development of next-generation gene therapy products for neurological diseases.
[0103] In summary, the Actg1 3' UTR element of this application selects the actin γ1 (Actin Gamma 1, Actg1) gene. By retaining a long natural sequence derived from the human gene, it covers its complete posttranscriptional regulatory information, thereby providing better mRNA stability and translation efficiency after the exogenous gene is introduced into neurons, ultimately achieving a higher level of protein expression, which can be used to prepare neurotherapeutic drugs.
[0104] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A 3' UTR element, characterized in that, The nucleotide sequence of the 3' UTR element contains: a fragment sequence from the stop codon of the actin family 1 gene to the poly A tail signal site on the positive strand, wherein the nucleotide sequence of the poly A tail signal site is: AATAAA; and / or, the fragment sequence is 719 bp in length, and the nucleotide sequence of the 3' UTR element is shown in SEQ ID NO:
1.
2. A recombinant vector, characterized in that, The recombinant carrier carries the 3' UTR element as described in claim 1.
3. The recombinant vector according to claim 2, characterized in that, The recombinant vector is a recombinant adeno-associated virus expression vector packaged with the 3' UTR element; the recombinant vector also carries a fluorescent protein reporter gene and a pCALM1 promoter.
4. The method for constructing the recombinant vector according to any one of claims 2-3, characterized in that, Includes the following steps: A backbone vector was constructed and linearized. The backbone vector was an adeno-associated virus backbone vector containing a fluorescent protein reporter gene. The gene fragment of the 3' UTR element was obtained by amplification using PCR amplification technology. The linearized backbone vector is ligated to the gene fragment of the 3' UTR element to obtain the recombinant vector.
5. The construction method according to claim 4, characterized in that, In the step of amplifying the gene fragment of the 3' UTR element using PCR amplification technology, the amplification primer pair used contains a sequence complementary to the Actg1 template, and the 5' end contains an arm region homologous to the sequences at both ends of the linearized backbone vector; the nucleotide sequences of the amplification primer pair are shown in SEQ ID NO: 2-SEQ ID NO:
3.
6. A recombinant virus, characterized in that, The recombinant virus packaging has the recombinant vector as described in any one of claims 2-3.
7. The recombinant virus according to claim 6, characterized in that, The recombinant virus is a recombinant adeno-associated virus.
8. The method for preparing the recombinant virus according to any one of claims 6-7, characterized in that, Includes the following steps: The recombinant vector, packaging vector, and helper vector were co-transfected into 293T cells, and the virus was isolated to obtain the recombinant virus.
9. The use of the 3' UTR element of claim 1, or the recombinant vector of any one of claims 2-3, or the recombinant virus of any one of claims 6-7 in the preparation of related reagents and / or drugs for neural circuit tracing, and / or gene therapy drugs for the nervous system.
10. A neurological therapeutic drug, characterized in that, include: The recombinant virus according to any one of claims 6-7.
11. The nervous system therapeutic drug according to claim 10, characterized in that, It also includes a second virus, which contains a 3' UTR element derived from the Rtn1 gene; wherein the viral genome titer ratio of the recombinant virus to the second virus is (1:10) to (10:1).
Citation Information
Patent Citations
3 'UTR element and application thereof
CN119752896A
Nucleic acid constructs comprising utrs and applications thereof
TW202400784A
mRNA for protein expression and template therefor
US20250134971A1