Construction method and application of engineering bacteria for reprogramming bioenergy through polyphosphate metabolism

Abstract

The invention discloses a construction method and application of engineering bacteria for reprogramming biological energy through polyphosphate metabolism. According to the invention, genes related to polyphosphate metabolism are screened, recombinant expression plasmids are constructed and introduced into shewanella through electrotransformation to obtain corresponding engineering bacteria, biological metabolism rates of the engineering bacteria are compared from intracellular polyP content, ATP level and maximum output current, and the engineering bacteria SPK2DK co-expressed by ppk2 gene and nadk gene are obtained through further screening. And comprehensively evaluating the energy metabolism enhancement efficiency. The constructed engineering bacteria significantly improve the intracellular energy metabolism state by reconstructing a polyphosphate metabolic pathway, not only have excellent cofactor regeneration capacity and lactic acid metabolism rate, but also can specifically target a tumor microenvironment, induce macrophages to be polarized to an anti-tumor phenotype by efficiently depleting lactic acid, and improve the anti-tumor activity of the macrophages. And a new design thought and a technical basis are provided for developing an in-vivo treatment preparation with high-efficiency energy integration and immune regulation and control functions.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and synthetic biology, and in particular to a method for constructing and applying engineered bacteria that can reprogram bioenergy through polyphosphate metabolism. Background Technology

[0002] Bacterial immunotherapy, as an emerging cancer treatment strategy, overcomes to some extent the limitations of traditional therapies caused by the heterogeneity of the tumor microenvironment (TME) by leveraging the natural targeting and immunomodulatory capabilities of microorganisms to hypoxic tumor regions. The combination of synthetic biology and materials science has successfully constructed a series of programmable bacterial vectors, such as modifying Salmonella to escape phagocytosis and activate tumor immunity, or reconstructing Escherichia coli Nissle 1917 as a vaccine platform to stimulate T-cell anti-tumor responses. However, existing bacterial therapies still suffer from a fundamental limitation: insufficient energy supply to bacteria within the tumor, weak ATP metabolic flux, and severe redox imbalance significantly affect their metabolic efficiency and therapeutic durability, thus limiting drug synthesis and microenvironment remodeling capabilities and hindering their clinical translation.

[0003] Shewanella oneidensis MR-1 is considered an ideal candidate for tumor-targeting engineered bacteria due to its superior lactate metabolism and extracellular electron transport (EET) mechanism. It not only effectively couples lactate oxidation and electron transport, overcoming the tumor hypoxia barrier, but also avoids the biocompatibility and synthetic complexity issues associated with exogenous nanomaterials. Previous attempts to enhance its metabolic capacity by combining manganese dioxide nanoflowers with drug-loaded nanoparticles have faced challenges such as complex preparation, electron leakage, and in vivo safety. Therefore, developing strategies based on endogenous metabolic regulation to enhance its bioefficiency has significant research value and application prospects. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a method for constructing and applying engineered bacteria that reprogram bioenergy through polyphosphate metabolism. This invention focuses on polyP metabolism and significantly enhances the bioenergy level of *S. oneidensis* MR-1 through synthetic biology modification, thereby achieving efficient lactate consumption and remodeling of the anti-tumor immune microenvironment.

[0005] The technical solution of the present invention is as follows:

[0006] A method for constructing engineered bacteria capable of reprogramming bioenergy through polyphosphate metabolism, the method comprising the following steps:

[0007] (1) Using pYYDT plasmid as a vector, the pYYDT plasmid was digested with restriction endonuclease to obtain linearized pYYDT plasmid. Then, the ppk2 gene and the nadk gene were cloned into the pYYDT plasmid by PCR technology. After plasmid sequencing verification, the recombinant co-expression plasmid pYYDT-ppk2-nadk with correct sequencing was obtained.

[0008] (2) The pYYDT-ppk2-nadk plasmid was introduced into the competent cells of wild-type Shewanella MR-1 by electroporation. After verification by colony PCR and plasmid sequencing, the engineered bacteria SPK2DK, which co-expresses the ppk2 gene and the nadk gene, was obtained. This is the engineered bacteria that reprograms bioenergy through polyphosphate metabolism.

[0009] Further, in step (1), the gene sequence of the ppk2 gene is shown in SEQ ID NO.2.

[0010] Further, in step (1), the gene sequence of the nadk gene is shown in SEQ ID NO.3.

[0011] Further, in step (1), the restriction endonuclease is NdeI enzyme and XhoI enzyme.

[0012] An application of the engineered bacteria constructed by the aforementioned construction method, wherein the engineered bacteria are used in antitumor drugs.

[0013] Furthermore, the engineered bacteria are used as an inhibitor of tumor cell proliferation.

[0014] The beneficial technical effects of this invention are as follows:

[0015] This invention, through screening for polyphosphate (polyP) metabolism-related enzyme genes, discovered that co-expression of the ppk2 and nadk genes could increase the ATP production of engineered bacteria by 259.32% and the NADH / NAD ratio. + The ratio increased by 299.9%, and the maximum output current increased by 58.4%, significantly enhancing bioenergy metabolism.

[0016] The engineered bacteria constructed in this invention have a highly efficient targeted metabolic ability for lactic acid, which can achieve specific depletion of lactic acid in the tumor microenvironment, reverse the immunosuppressive state, and promote anti-tumor immune response.

[0017] This invention provides a novel strategy for developing microbial drugs that combine high bioenergy and immunomodulatory functions, thus advancing the practical application of bacterial immunotherapy. Attached Figure Description

[0018] Figure 1This is a functional diagram of the polyphosphate (polyP) metabolism-related enzyme genes ppk1, ppk2, nadk, pap, ppx, and pppn1.

[0019] Figure 2 The plasmid maps are for the recombinant expression plasmids pYYDT-ppk1, pYYDT-ppk2, and pYYDT-nadk constructed in Example 1 of this invention.

[0020] In the figure: A is the pYYDT-ppk1 plasmid map; B is the pYYDT-ppk2 plasmid map; C is the pYYDT-nadk plasmid map.

[0021] Figure 3 The plasmid maps show the specific map information of the recombinant expression plasmids pYYDT-pap, pYYDT-ppx, and pYYDT-ppn1 constructed in Example 1 of this invention.

[0022] In the figure: A is the pYYDT-pap plasmid map; B is the pYYDT-ppx plasmid map; C is the pYYDT-ppn1 plasmid map.

[0023] Figure 4 The image shows the fluorescence detection results of intracellular polyphosphate content of the engineered bacteria SCFP1, SPAK2, SMTDK, SAJAP, SECPX, SSCN1 and WT strains constructed in Example 1 of this invention.

[0024] Figure 5 The graph shows the results of detecting intracellular ATP content of the engineered bacteria SCFP1, SPAK2, SMTDK, SAJAP, SECPX, SSCN1 and WT strains constructed in Example 1 of this invention.

[0025] Figure 6 The maximum output current detection results of the engineered bacteria SCFP1, SPAK2, SMTDK, SAJAP, SECPX, SSCN1 and WT strains constructed in Example 1 of this invention are shown in the figure.

[0026] Figure 7 Map of the co-expression recombinant plasmid pYYDT-ppk2-nadk.

[0027] Figure 8 The image shows the fluorescence detection results of the intracellular polyphosphate content of the engineered bacteria SPK2DK and WT strains constructed in Example 1 of this invention.

[0028] Figure 9 The intracellular ATP content and NADH / NAD ratio of the engineered bacteria SPK2DK and WT strains constructed in Example 1 of this invention are shown. + Graph showing the ratio and maximum output current detection results.

[0029] In the figure: A) is the fluorescence detection result of intracellular ATP content in engineered bacteria SPK2DK and WT strains; B) is the NADH / NAD ratio of engineered bacteria SPK2DK and WT strains. + Ratio graph; C is the graph showing the detection results of the maximum output current of engineered bacteria SPK2DK and WT strains.

[0030] Figure 10 The graph shows the toxicity test results of engineered bacteria SPAK2, SMTDK, SPK2DK and WT strains in Example 2 of the present invention on 293T cells, 4T1 cells and CT26 cells.

[0031] In the figure: A is the result of the toxicity test on 293T cells; B is the result of the toxicity test on 4T1 cells; C is the result of the toxicity test on CT26 cells.

[0032] Figure 11 The image shows the results of detecting lactate levels in the microenvironment of CT26 cells using engineered bacteria SPAK2, SMTDK, SPK2DK, and WT strains in Example 2 of this invention.

[0033] Figure 12 This is a fluorescence contrast imaging image of live / dead CT26 cells by engineered bacteria SPK2DK and WT strains in Example 2 of the present invention.

[0034] Figure 13 This is a graph showing the detection results of lactate levels in the tumor microenvironment of CT26 cells induced by the engineered bacteria SPK2DK and WT strains in Example 3 of the present invention.

[0035] Figure 14 The figure shows the detection results of the levels of inflammatory cytokines released by macrophages induced by engineered bacteria SPK2DK, WT strain, and LPS in CT26 cells in Example 3 of the present invention.

[0036] In the figure: A is the detection results of TNF-α and IL-6 levels; B is the detection results of IL-1β.

[0037] Figure 15 This invention relates to the changes in the expression levels of M1 / M2 type inflammatory cytokine-related genes in macrophages induced by engineered bacteria SPK2DK, WT strain, and LPS in Example 3 of the present invention.

[0038] In the figure: A, the detection results of marker gene expression in M1 macrophages; B, the detection results of marker gene expression in M2 macrophages. Detailed Implementation

[0039] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0040] The wild-type Shewanella oneidensis MR-1 used in this invention was purchased from the China Industrial Microbial Culture Collection Center, with accession number ATCC 700550.

[0041] The polyphosphate (polyP) metabolic enzyme-related genes involved in this invention include pPK1 from *Citrobacter freundii*, with the gene sequence shown in SEQ ID NO.1; pPK2 from *Pseudomonas aeruginosa*, with the gene sequence shown in SEQ ID NO.2; nadk from *Mycobacterium tuberculosis*, with the gene sequence shown in SEQ ID NO.3; pap from *Acinetobacter johnsonii*, with the gene sequence shown in SEQ ID NO.4; ppx from *Escherichia coli*, with the gene sequence shown in SEQ ID NO.5; and pPN1 from *Saccharomyces cerevisiae*, with the gene sequence shown in SEQ ID NO.6. All gene sequences were codon optimized and chemically synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0042] ppk1, SEQ ID NO.1:

[0043]

[0044] ppk2,SEQ ID NO.2:

[0045]

[0046] nadk,SEQ ID NO.3:

[0047] ATGACGGCTCACCGCTCTGTGCTCTTAGTGGTCCATACTGGCCGTGATGAAGCCACCGAAACCGCACGTCGCGTGGAGAAAGTGTTAGGCGATAACAAGATTGCATTACGCGTGTTAAGCGCAGAAGCAGTGGATCGTGGCAGTTTACATTTAGCACCTGATGATATGCGCGCAATGGGCGTGGAAATCGAAGTGGTTGATGCCGATCAACACGCCGCCGATGGTTGTGAGCTTGTGCTGGTCTTAGGCGGCGATGGTACCTTCTTACGCGCCGCTGAATTAGCACGCAATGCCTCAATTCCGGTATTAGGCGTGAATCTGGGCCGAATTGGCTTTCTTGCTGAAGCTGAAGCGGAAGCCATCGATGCCGTGTTGGAACATGTGGTGGCTCAAGATTACCGCGTGGAAGATCGATTAACTCTTGATGTTGTGGTGCGTCAAGGCGGCCGTATTGTGAATCGTGGTTGGGCATTAAATGAAGTTAGTCTTGAGAAAGGTCCACGTTTAGGTGTCTTAGGTGTGGTGGTCGAAATTGATGGCCGACCAGTTAGCGCATTTGGCTGTGATGGTGTGTTAGTGAGTACTCCAACCGGTAGTACCGCATACGCCTTTAGTGCCGGCGGACCAGTGTTATGGCCAGATTTAGAAGCTATTCTGGTGGTGCCTAATAACGCGCATGCCTTGTTTGGCCGACCTATGGTGACCTCTCCAGAAGCCACTATCGCCATCGAAATTGAAGCGGATGGCCATGATGCATTAGTCTTCTGCGATGGTCGCCGTGAAATGTTAATTCCGGCTGGTAGCCGATTAGAAGTGACTCGTTGTGTGACTTCAGTGAAGTGGGCACGCTTAGATAGCGCTCCATTTACCGATC GCTTAGTGCGCAAATTTCGTCTGCCTGTGACGGGCTGGCGTGGCAAATGA

[0048] pap,SEQ ID NO.4:

[0049]

[0050] ppx,SEQ ID NO.5:

[0051]

[0052] ppn1,SEQ ID NO.6:

[0053]

[0054] The pYYDT empty vector plasmid involved in this invention was kindly provided by Professor Song Hao of Northeastern University. Its gene sequence is the same as that of the plasmid PYYDT (base length of 5885bp) disclosed in Chinese Invention Patent CN2022100291069.

[0055] Example 1: Construction and characterization of engineered bacteria that reprogram bioenergy through polyphosphate metabolism

[0056] (1) Construction of engineered Shewanella bacteria

[0057] 1.1 Genes for synthesizing polyphosphate (polyP) metabolic enzymes: such as Figure 1 As shown, based on the functional analysis of polyphosphate (polyP) metabolic enzymes, the coding sequences of the following genes were obtained from the NCBI database: ppk1 (derived from Citrobacter freundii, gene sequence as shown in SEQ ID NO.1), ppk2 (derived from Pseudomonas aeruginosa, gene sequence as shown in SEQ ID NO.2), nadk (derived from Mycobacterium tuberculosis, gene sequence as shown in SEQ ID NO.3), pap (derived from Acinetobacter johnsonii, gene sequence as shown in SEQ ID NO.4), ppx (derived from Escherichia coli, gene sequence as shown in SEQ ID NO.5), and pppn1 (derived from Saccharomyces cerevisiae, gene sequence as shown in SEQ ID NO.6). All gene sequences were codon optimized and chemically synthesized by Beijing Qingke Biotechnology Co., Ltd. Then, PCR amplification was performed on each gene using primers listed in Table 1 (reaction system shown in Table 2, amplification procedure shown in Table 3). The PCR amplification products were verified by 1% agarose gel electrophoresis and then purified using a DNA purification kit.

[0058] Table 1 Primer sequences for polyP metabolism-related genes

[0059]

[0060] Table 2 PCR reaction system

[0061] composition concentration Volume (μL) Template (DNA) 200-600 ng / μL 1 upstream primer 10μM 2 Downstream primer 10μM 2 2×Phanta Flash Master Mix (Novizan) 2× 25 <![CDATA[ddH2O]]> - 20

[0062] Table 3 PCR amplification conditions

[0063]

[0064] 1.2 Construction of recombinant expression plasmids:

[0065] pYYDT-ppk1 plasmid: The PCR-purified pPK1 gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed on E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-ppk1 plasmid was obtained (plasmid map shown in [link]). Figure 2 A).

[0066] pYYDT-ppk2 plasmid: The PCR-purified pPK2 gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed on E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-ppk2 plasmid was obtained (plasmid map shown in [link]). Figure 2 B).

[0067] pYYDT-nadk plasmid: The PCR-purified nadk gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed into E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-nadk plasmid was obtained (plasmid map shown in...). Figure 2 C).

[0068] pYYDT-pap plasmid: The PCR-purified pap gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed on E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-pap plasmid was obtained (plasmid map shown in [link]). Figure 3 A).

[0069] pYYDT-ppx plasmid: The PCR-purified ppx gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed on E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-ppx plasmid was obtained (plasmid map shown in [link]). Figure 3 B).

[0070] pYYDT-ppn1 plasmid: The PCR-purified pPN1 gene was ligated with the pYYDT empty vector plasmid digested with NdeI and XhoI restriction endonucleases using seamless DNA cloning technology. The ligation was then performed on E. coli DH5α competent cells, plated on LB agar plates containing kanamycin (50 μg / mL), and cultured overnight at 37°C. Single colonies were picked and cultured overnight, and the plasmid was extracted and sequenced for verification. The correctly sequenced pYYDT-ppn1 plasmid was obtained (plasmid map shown in [link]). Figure 3 C).

[0071] 1.3 Construction of engineered bacteria: The recombinant plasmids correctly sequenced in step 1.2 were introduced into wild-type Shewanella oneidensis MR-1 competent cells via electroporation. Then, 1 mL of LB medium was added, and the cells were incubated at 30°C for 2 h. The resulting culture was then plated on LB plates containing kanamycin (50 μg / mL) and cultured at 30°C for 12-18 h. Six engineered bacteria were successfully obtained through colony PCR and plasmid extraction verification. The engineered bacteria introduced with pYYDT-ppk1 were named SCFP1, pYYDT-ppk2 were named SPAK2, pYYDT-nadk were named SMTDK, pYYDT-pap were named SAJAP, pYYDT-ppx were named SECPX, and pYYDT-ppn1 were named SSCN1.

[0072] 1.4 Construction of the wild-type Shewanella oneidensis MR-1 strain WT carrying the empty pYYDT plasmid: The pYYDT plasmid was introduced into competent wild-type Shewanella oneidensis MR-1 cells by electroporation. Then, 1 mL of LB medium was added, and the cells were incubated at 30°C for 2 h. The cells were then plated on LB plates containing kanamycin (50 μg / mL) and cultured at 30°C for 12-18 h. The wild-type Shewanella oneidensis MR-1 strain carrying the empty pYYDT plasmid was successfully obtained by colony PCR and plasmid extraction. The strain was named WT.

[0073] (2) Preliminary characterization of engineered bacteria

[0074] 2.1 Preparation of bacterial strain samples: The engineered bacteria constructed in step 1.3 and the WT strain constructed in step 1.4 were inoculated into LB medium containing kanamycin (50 μg / mL) and cultured with shaking at 30℃ and 200 rpm until OD. 600=0.6, then add IPTG to a final concentration of 0.5 mM, and induce expression overnight at 30°C. Collect bacterial cells (measured OD). 600 =1.0), wash once with pre-cooled HEPES buffer (20mM, pH 7.4) and resuspend to obtain samples of each engineered bacteria.

[0075] 2.2 Detection of intracellular polyphosphate (polyP) content: DAPI (4',6-diamidinyl-2-phenylindole dihydrochloride, Sigma-Aldrich) fluorescence method was used for detection. The engineered bacterial samples obtained in step 2.1 were lysed using HEPES buffer (10... 8 (cells / mL), 10 μL of the lysed sample was mixed with DAPI working solution and reacted in the dark for 10 min. The fluorescence intensity of the sample was measured at an excitation wavelength of 415 nm and an emission wavelength of 550 nm. The results are as follows: Figure 4 As shown. From Figure 4 The results show that the intracellular polyP content of the six engineered bacteria constructed in this invention changed compared with the control strain WT, indicating that the recombinant protein was successfully expressed and functioned.

[0076] 2.3 ATP content detection: Take 10 μL of each engineered bacterial sample obtained in step 2.1. 8 Cells / mL were added to cell lysis buffer and vortexed on ice for 10 min. The supernatant was then collected by centrifugation at 12000 rpm for 5 min at 4 °C. The supernatant was analyzed using an enhanced ATP assay kit according to the manufacturer's instructions. The chemiluminescence value was then measured using a 96-well black plate and a microplate reader. Results are as follows: Figure 5 As shown. From Figure 5 The results showed that the ATP levels of the engineered bacteria differed, with the engineered bacteria SCFP1, SPAK2, and SMTDK producing ATP levels that were 376.6%, 238.2%, and 215.3% higher than the control strain WT, respectively.

[0077] 2.4 Electron Transfer Rate Detection: The electron transfer rate was detected using a microbial electrolysis cell (MEC) system. This system was a single-chamber reactor with a three-electrode configuration and a working volume of 28 mL. The working electrode was carbon cloth, the reference electrode was a 3M KClAg / AgCl electrode, and the counter electrode was a graphite rod. The electrolyte was M9 buffer (containing 20 mM sodium lactate and 5% LB medium). The maximum output current was recorded using a CHI1040C electrochemical workstation with a current-time (It) measurement method (200 mV vs. reference electrode). The results are as follows: Figure 6 As shown. From Figure 6The results showed that, compared with the control strain WT, the maximum output current of engineered strains SPAK2 and SMTDK increased by 32.6% and 29.0%, respectively, while that of SCFP1 decreased by 77.6%, indicating that the expression of ppk2 and nadk can significantly enhance the bioenergy metabolism potential of the strains.

[0078] (3) Optimization of the construction and energy characterization of engineered bacteria

[0079] 3.1 Construction of the engineered strain SPK2DK co-expressing ppk2 and nadk: Based on the above results, SPAK2 (containing ppk2) and SMTDK (containing nadk) strains with the best energy metabolism performance were selected. The ppk2 and nadk genes were amplified using primers PPK2-F / M-PPK2-R and M-NADK-F / NADK-R, respectively, as shown in Table 4. The ppk2 and nadk genes were then ligated using overlap extension PCR and cloned into the pYYDT vector (with NdeI and XhoI restriction sites) to construct the recombinant co-expression plasmid pYYDT-ppk2-nadk (plasmid map shown). Figure 7 After sequencing verification, the sample was electroporated into competent Shewanella cells, and colony PCR and plasmid extraction sequencing were performed to obtain the co-expressing engineered strain SPK2DK.

[0080] Table 4. Primers for constructing co-expression engineered bacteria SPK2DK.

[0081]

[0082] 3.2 PolyP and ATP Content Detection: The polyP content of SPK2DK strain was detected using the same method as in step 2.2, and the ATP content was detected using the same method as in step 2.3. The results are shown below. Figure 8 and Figure 9 As shown in A. From Figure 8 Results combined Figure 4 The results showed that the polyP content of the SPK2DK strain was significantly lower than that of the control strain WT and the single-gene engineered strains SPAK2 and SMTDK, suggesting that its polyP metabolic turnover was accelerated. Figure 9 As shown in Figure A, the intracellular ATP production of SPK2DK cells increased by 259.32% compared to the wild-type control.

[0083] 3.3NADH / NAD + Ratio detection: The WST-8 method was used for detection: 10⁻⁶ cells were collected after induction. 8 (per cell / sample), after adding cell lysis buffer, follow the NADH / NAD ratio. + Follow the instructions in the test kit to measure the absorbance at a wavelength of 450 nm. The results are as follows: Figure 9 As shown in B. From Figure 9The results in Figure B show that the NADH / NAD ratio of SPK2DK... + The ratio was 299.9% higher than that of the control strain WT.

[0084] 3.4 Electron transfer rate detection: The electron transfer rate of strain SPK2DK was detected using the same method as in step 2.4, and the results are as follows. Figure 9 As shown in C. From Figure 9 The results in Figure C show that the maximum output current of SPK2DK increased significantly by 58.4% compared with the control strain WT, indicating that its energy metabolism level was greatly enhanced.

[0085] Example 2: Evaluation of the in vitro antitumor activity of engineered bacteria SPK2DK

[0086] (1) Cytotoxicity detection

[0087] Different concentrations of engineered bacteria SPK2DK, SPAK2, SMTDK, and the control strain WT were co-cultured with 293T cells, 4T1 cells, or CT26 cells for 24 h. Cytotoxicity was then detected using the CCK-8 assay. The results are as follows: Figure 10 As shown. From Figure 10 The results showed that the control strains WT, SPAK2, SMTDK, and SPK2DK had no significant toxicity to 293T normal embryonic kidney cells and 4T1 breast cancer cells, but showed significant killing effect on CT26 colorectal cancer cells, indicating that they have good tumor cell selectivity.

[0088] (2) Lactic acid clearance capacity test

[0089] To investigate the killing mechanism of engineered strain SPK2DK, different concentrations of engineered strains SPK2DK, SPAK2, SMTDK, and the control strain WT were co-cultured with CT26 cells for 24 hours. Lactate levels in the co-culture system were then measured. The results are as follows: Figure 11 As shown. From Figure 11 The results showed that the lactate concentration in the SPK2DK treatment group was significantly reduced, indicating that the engineered bacteria can directly induce tumor cell death by efficiently clearing lactate.

[0090] (3) Verification by live / dead cell staining

[0091] To further verify cell viability, a concentration of 1×10⁻⁶ was used. 7 After co-culturing CT26 cells with engineered strain SPK2DK (CFU / mL) and control strain WT for 24 h, cell viability was further verified by Calcein-AM / PI double staining. The results are as follows: Figure 12 As shown. From Figure 12The results showed that the SPK2DK treatment group had a large number of PI positive (dead cell) signals, while Calcein-AM positive (live cell) signals were significantly reduced, indicating that it can effectively disrupt the integrity of tumor cell membranes, consistent with the cytotoxic results.

[0092] Example 3: The ability of engineered bacteria SPK2DK to remodel the tumor immune microenvironment

[0093] (1) Regulation of lactate levels in co-culture system

[0094] A transwell system was established using CT26 cells and RAW 264.7 macrophages (CT26 cells in the upper chamber and RAW 264.7 cells in the lower chamber) and co-incubated for 12 h. Then, a concentration of 1×10⁻⁶ cells was added. 7 CFU / mL of engineered strain SPK2DK and control strain WT, along with 100 ng / mL of LPS, were added to the upper chamber containing CT26 cells and co-cultured for 24 h. CT26 cells and RAW264.7 macrophages without any reagents were used as controls. The supernatant from the Transwell co-culture was collected, and lactate content was measured. The results are as follows: Figure 13 As shown, the lactate level in the engineered bacteria treatment group decreased sharply, indicating that it still maintains excellent lactate scavenging ability in complex cell co-culture systems.

[0095] (2) Levels of inflammatory cytokine secretion

[0096] A transwell system was established using CT26 cells and RAW 264.7 macrophages (CT26 cells in the upper chamber and RAW 264.7 cells in the lower chamber) and co-incubated for 12 h. Then, a concentration of 1×10⁻⁶ cells was added. 7 CFU / mL of engineered strain SPK2DK and control strain WT, along with 100 ng / mL of LPS, were added to the upper chamber containing CT26 cells and co-cultured for 24 h. CT26 cells and RAW264.7 macrophages (without any reagents) were used as controls. The supernatant from the Transwell co-culture was collected, and cytokine secretion was detected by ELISA. The results are as follows: Figure 14 As shown. From Figure 14 The results showed that SPK2DK significantly promoted the release of inflammatory factors TNF-α, IL-6 and IL-1β, with an increase of 21.8%-48.0%, and its stimulatory effect was comparable to that of LPS, indicating that SPK2DK can effectively activate the immune response.

[0097] (3) Expression of macrophage polarization-related genes

[0098] A transwell system was established using CT26 cells and RAW 264.7 macrophages (CT26 cells in the upper chamber and RAW 264.7 cells in the lower chamber) and co-incubated for 12 h. Then, a concentration of 1×10⁻⁶ cells was added. 7 CFU / mL of engineered strain SPK2DK and control strain WT, along with 100 ng / mL of LPS, were added to the upper chamber containing CT26 cells and co-cultured for 24 h. CT26 cells without any reagents and RAW 264.7 macrophages were used as controls. RAW 264.7 macrophages co-cultured in Transwell were collected, and the expression of M1 / M2 macrophage marker genes (using GAPDH as an internal control) was detected by qPCR using the primers in Table 5. The results are shown below. Figure 15 As shown, SPK2DK significantly upregulated the mRNA expression of M1 markers (NOS2, TNF-α, CD16, CD80) (increased by 52.3%–185.9%), while inhibiting the expression of M2 markers (Arg1, IL10, CD206, CSF1R) (decreased by 59.4%–88.8%). These results indicate that SPK2DK can drive macrophage polarization towards the anti-tumor M1 phenotype by depleting lactate, providing a mechanistic basis for enhancing anti-tumor immune responses.

[0099] Table 5 qPCR primer sequences

[0100]

[0101]

[0102] The above description is merely a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and variations that are directly derived or conceived by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included within the protection scope of the present invention.

Claims

1. A method for constructing engineered bacteria capable of reprogramming bioenergy through polyphosphate metabolism, characterized in that, The construction method includes the following steps: (1) Using pYYDT plasmid as a vector, the pYYDT plasmid was digested with restriction endonuclease to obtain linearized pYYDT plasmid. Then, the ppk2 gene and the nadk gene were cloned into the pYYDT plasmid by PCR technology. After plasmid sequencing verification, the recombinant co-expression plasmid pYYDT-ppk2-nadk with correct sequencing was obtained. (2) The pYYDT-ppk2-nadk plasmid was introduced into the competent cells of wild-type Shewanella MR-1 by electroporation. After verification by colony PCR and plasmid sequencing, the engineered bacteria SPK2DK, which co-expresses the ppk2 gene and the nadk gene, was obtained. This is the engineered bacteria that reprograms bioenergy through polyphosphate metabolism.

2. The construction method according to claim 1, characterized in that, In step (1), the gene sequence of the ppk2 gene is shown in SEQ ID NO.

2.

3. The construction method according to claim 1, characterized in that, In step (1), the gene sequence of the nadk gene is shown in SEQ ID NO.

3.

4. The construction method according to claim 1, characterized in that, In step (1), the restriction endonucleases are NdeI enzyme and XhoI enzyme.

5. The application of an engineered bacterium constructed by the construction method according to any one of claims 1-4, characterized in that, The engineered bacteria are used in anti-tumor drugs.

6. The application according to claim 5, characterized in that, The engineered bacteria are used as an inhibitor of tumor cell proliferation.

Images