Lactic acid metabolism regulation engineering bacterium as well as construction method and application thereof

Abstract

The invention discloses lactic acid metabolism regulation engineering bacteria as well as a construction method and application thereof. The lactic acid metabolism regulation engineering bacteria comprise chassis bacteria and recombinant plasmids, the chassis bacterial cell is EcN delta nlpI, and the EcN delta nlpI is an EcN strain with nlpI gene deleted and is used for enhancing release of outer membrane vesicles; the recombinant plasmid is used for enabling engineering bacteria to express tumor targeting molecules and lactate oxidase, and comprises a Myc-EGFP (Enhanced Green Fluorescent Protein) recombinant protein, a Myc-INP-HlpA-ClyA-EGFP-3 * Flag recombinant protein, a coding gene of the Myc-INP-HlpA-ClyA-LOx-3 * Flag recombinant protein, and a promoter. The lactic acid metabolism regulation engineering bacterium can target a tumor site, continuously express lactate oxidase at the tumor site, degrade lactic acid enriched in tumors and improve the radiotherapy effect.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to an engineered bacterium that regulates lactic acid metabolism, its construction method, and its application. Background Technology

[0002] Radiotherapy, a crucial tool in cancer treatment, primarily kills tumor cells by inducing DNA damage and disrupting cellular structure. In the comprehensive treatment of diseases such as rectal adenocarcinoma, radiotherapy plays a key role in both neoadjuvant and adjuvant therapy phases. However, acquired radioresistance driven by the tumor microenvironment remains a significant clinical challenge. Studies have found that radiation significantly alters the metabolic characteristics of tumor cells, upregulating the expression of glycolysis-related enzymes while exacerbating hypoxia in tumor tissues. This metabolic reprogramming causes tumor cells to rely more heavily on glycolysis for energy, leading to a large accumulation of lactic acid in the tumor microenvironment. This excess lactic acid is not only a metabolic product but also an important signaling molecule, promoting radioresistance through multiple mechanisms: first, it activates abnormal DNA repair pathways; second, it inhibits tumor cell apoptosis; third, it further drives lactic acid metabolic reprogramming; and finally, it promotes the formation of an immunosuppressive microenvironment.

[0003] Faced with this complex situation, traditional methods for overcoming radioresistance often fall short of achieving precise regulation of the tumor microenvironment. Therefore, developing novel therapeutic strategies is particularly important. In recent years, engineered probiotics, represented by *Escherichia coli* Nissle 1917 (EcN), have demonstrated unique therapeutic advantages. These engineered bacteria possess natural tumor tropism, enabling them to specifically colonize tumor tissues, primarily due to their responsiveness to the hypoxic environment of tumors and their chemotactic properties. EcN strains not only have a reliable safety record, but their highly efficient protein expression system also makes them ideal therapeutic carriers. The core innovation of this technology lies in utilizing naturally secreted bacterial outer membrane vesicles (OMVs) as a nanoscale delivery system. These natural nanoparticles, with diameters of 20-200 nanometers, are secreted by Gram-negative bacteria and possess multiple advantages: excellent biological barrier penetration, highly efficient tumor targeting properties, and natural drug delivery functions. Researchers have also discovered that the EcNΔnlpI strain, obtained by knocking out the nlpI gene, can significantly increase OMV production while maintaining cell membrane integrity. Currently, by utilizing specialized domains such as ice nucleoproteins and cytolysin A, the efficient display of therapeutic proteins on bacterial surfaces has been successfully achieved. Based on these findings, there is an urgent need for an engineered bacterial therapy system to address the limitations imposed on current tumor radiotherapy protocols by acidification and radioresistance caused by lactic acid accumulation in the microenvironment. Summary of the Invention

[0004] Objective: To overcome the shortcomings of existing technologies, this invention provides a lactic acid metabolism regulating engineered bacteria, its construction method, and its application. This lactic acid metabolism regulating engineered bacteria has tumor targeting properties, can stably colonize tumor sites, and continuously release lactate oxidase, thereby regulating the tumor microenvironment and providing a novel solution for combined tumor therapy.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides an engineered bacterium for regulating lactic acid metabolism, comprising a chassis bacterium and a recombinant plasmid; The chassis bacterial cells are EcNΔnlpI, which is an EcN strain with the nlpI gene deleted, used to enhance the release of outer membrane vesicles; The recombinant plasmid includes a plasmid vector and a target gene; The plasmid vector is pBAD / His A, and pBAD / His A uses an arabinose promoter with a nucleotide sequence as shown in SEQ ID NO:1; The target genes include the encoding genes for Myc-EGFP recombinant protein, Myc-INP-HlpA-ClyA-EGFP-3×Flag recombinant protein, and Myc-INP-HlpA-ClyA-LOx-3×Flag recombinant protein, which are used to enable engineered bacteria to express tumor-targeting molecules, lactate oxidase, and enhanced green fluorescent protein.

[0007] The introduction of recombinant plasmids enables engineered bacteria that regulate lactic acid metabolism to express target modules, reporter modules, and lactic acid regulation modules. The targeting module, namely the gene encoding the Myc-EGFP recombinant protein, consists of an ice nucleoprotein (INP)-histone-like protein A (HlpA) fusion protein and a Myc tag. It targets heparan sulfate proteoglycans (HSPGs) overexpressed on the surface of tumor cells via histone-like protein A (HlpA), thereby enhancing tumor-specific enrichment. The reporter module, namely the gene encoding the Myc-INP-HlpA-ClyA-EGFP-3×Flag recombinant protein, includes a cytolysin A (ClyA)-green fluorescent protein (EGFP) fusion protein and a 3×Flag tag. In this invention, it is named ENHP engineered bacteria and is used to monitor the tumor targeting and therapeutic protein localization of the engineered bacteria in real time. The lactate regulation module, namely the gene encoding the Myc-INP-HlpA-ClyA-LOx-3×Flag recombinant protein, replaces EGFP in the reporter module with lactate oxidase (LOx). In this invention, it is named ENHL engineered bacteria and is used to express lactate oxidase.

[0008] EcN itself has a good ability to colonize intestinal tumors. Using this strain as a chassis bacterium, along with the exogenous introduction of tumor-targeting molecules, can enable engineered bacteria to enter the tumor site more often. On the one hand, this can achieve the enrichment of engineered bacterial drugs at the tumor site and improve the efficacy. On the other hand, it can also reduce the side effects or impact on the patient's normal physiological functions that may result from engineered bacterial drugs entering other normal tissues and organs.

[0009] The engineered bacteria obtained based on the recombinant plasmid provided by this invention can better colonize tumor sites, improve the amount, stability and duration of LOx release at tumor sites, and further enhance the synergistic effect of radiotherapy.

[0010] pBAD / His A is a commonly used vector for tightly regulated, high-level expression of recombinant proteins in E. coli, including: The arabinose promoter is precisely regulated by arabinose; its expression is completely suppressed in the absence of arabinose and induced in the presence of arabinose, helping to prevent the toxicity of exogenous proteins to the host bacteria. The His-Tag encodes an N-terminal 6x histidine tag, facilitating subsequent protein purification using nickel columns. Multiple cloning sites (MCS), such as 5' NheI and 3' EcoRI, are located after the His-Tag sequence for insertion of the target gene. The Ampicillin resistance gene is used to screen for positive clones containing the plasmid. pBR322ori is used to ensure plasmid replication in E. coli.

[0011] When using an arabinose promoter, even if some of the lactate metabolism regulating engineered bacteria fail to enter the target site (tumor site) after entering the body, the engineered bacteria will not express recombinant proteins in normal tissues because normal tissues do not have the conditions to initiate the expression of exogenous genes. This avoids the impact of engineered bacteria on normal tissues and organs and further improves the safety of the engineered bacteria provided by this invention.

[0012] The nucleotide sequence of the arabinose promoter is shown in SEQ ID NO:1.

[0013] SEQ ID NO:1

[0014] AAGAAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAA CAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT

[0015] In some embodiments, the 5'→3' direction of the gene encoding the Myc-EGFP recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2 and the enhanced green fluorescent protein encoding gene as shown in SEQ ID NO:6.

[0016] SEQ ID NO:2

[0017] GAACAAAAACTCATCTCAGAAGAGGATCTG

[0018] SEQ ID NO:6

[0019] ATGGTGAGCAAAGGCGAAGAGGAAAACATGGCGAGCACCCCGTTTAAATTTCAGCTGAAAGGCACCATTAACGGCAAAAGCTTTACCGTGGAAGGCGAAGGCGAAGGCAACAGCCATGAAGGCAGCCATAAAGGCAAATATGTGTGCACGAGCGGCAAACTGCCGATGAGCTGGGCGG CGCTGGGCACCACCTTTTGGCTATGGCATGAAATATTATACCAAATATCCGAGCGGCCTGAAAAACTGGTTTCGCGAAGTGATGCCGGGCGGCTTTACCTATGATCGCCATATTCAGTATAAAGGCGATGGCAGCATTCATGCGAAACATCAGCATTTTATGAAAAACGGCACCTATCAT AACATTGTGGAATTTACCGGCCAAGATTTTAAAGAAACAGCCCGGTGCTGACCGGCGATATGAACGTGAGCCTGCCGAACGAAGTGCCGCAGATTCCGCGCGATGATGGCGTGGAATGCCCGGTGACCCTGCTGTATCCGCTGCTGAGCGATAAAAGCAAATATGTTGAAGCGCATC AGTATACATTTGCAAACCGCTGCATAATCAGCCGGCGCCGGATGTGCCGTATCATTGGATTCGCAAACAGTATACGCAGAGCAAAGATGATGCGGAAGAACGCGATCATATTTGTCAGAGCGAAACCCTGGAAGCGCATCTGAAAGGCATGGATGAACTGTATAAAGGCGCCGGCGCA

[0020] In some embodiments, the 5'→3' direction of the encoding gene of the Myc-INP-HlpA-ClyA-EGFP-3×Flag recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2, the ice nucleoprotein-histone-like protein A fusion gene encoding gene as shown in SEQ ID NO:3, the cytolysin A encoding gene as shown in SEQ ID NO:4, the enhanced green fluorescent protein encoding gene as shown in SEQ ID NO:6, and the 3×Flag tag protein encoding gene as shown in SEQ ID NO:7.

[0021] SEQ ID NO:3

[0022] ATGGCCGATCACTGCGGTCTTATCTGGCCAGCGTCCGGTACTGTGGAATCTCGTTACTGGCAGTCTACCCGTCGCCATGAGAACGGTCTGGTAGGTTTACTGTGGGGTGCTGGCACCAGCGCATTCCTCAGCGTGCATGCAGATGCTCGTTGGATTGTCTGTGAAGTTGCCGTTGCAGACATCATCAGTCTGGAAGAGCCGGGTATGGTGAAGTTTCCGCGTGCCGAAGTGGTTCATGTCGGCGACCGTATTAGCGCGTCTCACTTCATTTCGGCACGTCAGGCCGACCCTGCGTCTACCTCAACTTCTACGTCCACGAGTACGCTGACTCCAATGCCTACGGCCATTCCGACGCCAATGCCTGCGGTTGCAAGCGTAACGCTGCCAGTGGCAGAACAGGCACGTCATGAAGTGTTTGATGTAGCGTCGGTAAGCGCTGCTGCCGCACCAGTCAACACTCTGCCAGTTACTACGCCGCAGAATCTGCAGACCGCAACTTATGGTTCTACGTTGTCCGGCGACAATCATTCTCGTCTGATTGCAGGTTATGGTTCCAACGAGACCGCTGGCAACCACAGTGATCTGATTGGGTCCTTTGGTACCATGGCGAACAAACAGGATCTGATTGCGAAAGTGGCGGAAGCGACCGAACTGACCAAAAAAGATAGCGCGGCGGCGGTGGATGCGGTGTTTAGCGCGATTGAAAGTTTTCTGAGCGAAGGCGAAAAAGTGCAGCTGATTGGCTTTGGCAACTTTGAAGTGCGCGAACGCGCGGCGCGCAAAGGCCGCAACCCGCAGACCGGCGCGGAAATTAAAATTGCGGCGAGCAAAGTGCCGGCGTTTAAAGCGGGCAAAGCGCTGAAAGATGCGGTGAAATA

[0023] SEQ ID NO:4

[0024] ATGGGCATGACTGAAATCGTCGCGGATAAAACCGTTGAGGTGGTGAAAAACGCAATCGAAACCGCTGATGGCGCTCTGGATCTGTATAACAAATACCTGGACCAGGTTATTCCGTGGCAGACTTTTGATGAAACCATTAAAGAACTGTCCCGCTTCAAACAGGAATACTCTCAGGCGGCGTCCGTACTGGTAGGCGACATCAAAACTCTGCTGATGGACTCCCAGGACAAATACTTCGAAGCCACTCAGACCGTTTACGAGTGGTGCGGTGTTGCTACCCAGCTGCTGGCTGCATACATTCTGCTGTTCGACGAATATAATGAGAAAAAAGCGTCTGCTCAAAAAGACATCCTGATCAAAGTTCTGGATGATGGTATCACTAAGCTGAACGAAGCGCAGAAAAGCCTGCTGGTTAGCAGCCAGAGCTTCAACAACGCGTCTGGTAAGCTGCTGGCTCTGGATTCCCAGCTGACCAACGATTTCTCCGAAAAATCTTCCTACTTCCAGTCCCAGGTAGACAAAATCCGCAAAGAAGCTTACGCTGGCGCAGCTGCTGGTGTTGTAGCAGGTCCGTTCGGTCTGATCATTAGCTATTCTATTGCTGCAGGTGTGGTCGAGGGCAAACTGATTCCGGAGCTGAAAAACAAACTGAAATCTGTACAAAACTTCTTTACCACCCTGTCTAACACTGTTAAACAGGCGAACAAAGACATCGATGCGGCAAAACTGAAACTGACCACCGAGATCGCGGCCATCGGTGAAATCAAAACTGAAACCGAAACCACCCGTTTTTACGTTGATTACGACGACCTGATGCTGAGCCTGCTGAAAGAGGCAGCGAAAAAAATGATCAACACTTGTAACGAATACCAGAAACGTCACGGTAAAAAAACCCTGTTTGAAGTGCCGGAAGTA

[0025] SEQ ID NO:7

[0026] GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAG

[0027] In some embodiments, the 5'→3' direction of the encoding gene of the Myc-INP-HlpA-ClyA-LOx-3×Flag recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2, the ice nucleoprotein-histone-like protein A fusion gene encoding gene as shown in SEQ ID NO:3, the cytolysin A encoding gene as shown in SEQ ID NO:4, the lactate oxidase encoding gene as shown in SEQ ID NO:5, and the 3×Flag tag protein encoding gene as shown in SEQ ID NO:7.

[0028] SEQ ID NO:5

[0029]

[0030] In a second aspect, the present invention provides a method for constructing engineered bacteria that regulate lactic acid metabolism as described in the first aspect, comprising: Using pBAD / His A as the plasmid vector, pBAD / His A was double-digested with restriction endonucleases NheI and EcoRI to linearize the plasmid vector and expose sticky ends that match the ends of the target gene. The target gene was prepared using T4 DNA ligase and its buffer solution. The cut plasmid vector and the prepared target gene are mixed and ligated under the action of T4 DNA ligase and its buffer to form a circular recombinant plasmid. The recombinant plasmid was introduced into EcNΔ via electroporation. nlpI Competent DH5α cells were screened for strains containing the target recombinant plasmid using ampicillin to obtain engineered bacteria that regulate lactic acid metabolism.

[0031] Preferably, the electrical transfer parameters are 2.5 kV voltage and 5 ms time.

[0032] Furthermore, the method for screening strains containing the target recombinant plasmid using ampicillin includes: using Western blot to detect whether the strain expresses the tag proteins Myc and 3×Flag; when the strain expresses the tag proteins Myc and 3×Flag, an engineered bacterium that stably expresses the target gene is obtained.

[0033] Thirdly, the present invention provides the use of lactic acid metabolism regulating engineered bacteria as described in the first aspect in the preparation of drugs that degrade lactic acid accumulated in the tumor microenvironment.

[0034] Fourthly, the present invention provides the application of lactic acid metabolism regulating engineered bacteria as described in the first aspect in the preparation of drugs that enhance tumor radiosensitivity.

[0035] Furthermore, the lactic acid metabolism-regulating engineered bacteria enhance tumor radiosensitivity by producing bacterial extravesicles.

[0036] In some embodiments, the drug is administered orally.

[0037] In some embodiments, the tumor is a colorectal tumor.

[0038] In tumor treatment regimens, the lactate metabolism-regulating engineered bacteria provided by this invention are used in combination with radiotherapy. Furthermore, after oral administration, the lactate metabolism-regulating engineered bacteria selectively colonize colorectal tumor sites, significantly inhibiting tumor growth, enhancing radiotherapy efficacy, and regulating intestinal flora balance through LOx-mediated lactate metabolism regulation.

[0039] Beneficial effects:

[0040] (1) This invention combines metabolic regulation therapy with a bacterial delivery platform that can be targeted to the tumor site to construct lactic acid metabolism regulation engineered bacteria; by utilizing the tumor tropism of lactic acid metabolism regulation engineered bacteria and the penetrating ability of outer membrane vesicles, the efficient tumor enrichment of therapeutic components is achieved. (2) The lactic acid metabolism regulating engineered bacteria provided by the present invention can target the tumor site and achieve specific colonization of the lesion site by utilizing the tumor hypoxia targeting of the lactic acid metabolism regulating engineered bacteria, thus prolonging the local action time; and, in the tumor microenvironment, it continuously secretes lactate oxidase (LOx) to degrade extracellular lactic acid, while generating nanoscale extracellular vesicles (OMVs) in situ. These OMVs carry LOx and tumor-targeting molecules and can be efficiently internalized into tumor cells, achieving synergistic clearance of intracellular and extracellular lactic acid, effectively reducing lactic acid accumulation, and achieving precise regulation of tumor metabolism; (3) The lactic acid metabolism regulating engineered bacteria constructed in this invention is a "bacteria-external vesicle" dual-cascade engineered bacteria system. The dual-cascade effect significantly improves the acidity of the tumor microenvironment. The lactic acid metabolism regulating engineered bacteria significantly enhances the radiosensitivity of the tumor and reverses radiotherapy resistance through synergistic effect with radiotherapy. Moreover, the bacterial carrier can be expanded, and the external vesicle has the advantages of natural nanocarrier (high permeability and low immunogenicity). It has a significant therapeutic effect on colorectal tumors and has important clinical application value.

[0041] Overall, the lactate metabolism-regulating engineered bacteria provided by this invention significantly enhances radiosensitivity through precise regulation of lactate metabolism. Its bacterial exovesicles also serve as a multifunctional nanoplatform, further loading radiosensitizers or immunomodulators to achieve synergistic treatment through multiple mechanisms: lactate clearance, radiotherapy enhancement, and immune activation. Furthermore, this lactate metabolism-regulating engineered bacteria possesses long-lasting effects, targeted targeting, and safety, as well as the potential for low-cost, large-scale production, providing a novel solution for combination therapy of tumors. Attached Figure Description

[0042] Figure 1 This is a schematic diagram illustrating the construction process of engineered bacteria for regulating lactic acid metabolism in an embodiment of the present invention.

[0043] Figure 2 This is a diagram illustrating the construction and characterization of tumor-targeting bacteria in an embodiment of the present invention. Figure 2 In the diagram, 'a' represents a modified EcN used to construct and achieve tumor targeting. Figure 2 b is a Western blot verification diagram of Flag / Myc tag protein expression in bacteria modified under Ara induction; Figure 2 Figure c shows the experimental results of optimizing the Ara induction concentration to achieve maximum protein expression in vitro (n = 6); Figure 2The image in 'd' is a representative fluorescent image showing the binding of bacteria to host cells, where green represents bacteria, red represents actin filaments and cell nuclei, and the scale bar is 20 micrometers. Figure 2 The image in the middle is a super-resolution image showing the localization of EGFP on the bacterial membrane (green), as well as bacterial colonization on the surface of HCT116 cells, actin filaments (red), and cell nuclei (blue). Scale bar: 10 micrometers. Figure 2 f in the figure represents the representative fluorescence images of gastrointestinal tissue at specific time points in vivo for ENHP (n = 3). Figure 2 In the figure, g represents the in vivo quantitative biodistribution map of ENHP (n = 3). All data in the figure represent the mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0044] Figure 3 This is a diagram showing the experimental results of oxidative lactase activity exhibited by the engineered bacterium ENHL in this embodiment of the invention. Figure 3 Figure 'a' is a schematic diagram of a genetically modified bacterium expressing oxidative lactate and its functional mechanism. Figure 3 Figure b shows the results of Western blot analysis of the expression of 3×Flag- / Myc tag protein in genetically modified bacteria and its derived outer membrane inclusion bodies; Figure 3 Figure c shows the enzyme kinetics analysis results comparing pyruvate production between native oxidative lactase and ENHL. Figure 3 The middle image (d) shows the Western blot results of purified outer membrane inclusion bodies containing Flag-tagged proteins. Figure 3 Image e shows the quantitative grayscale analysis results of Flag-tagged proteins in purified outer membrane inclusion bodies; Figure 3 Figure f shows the results of in vivo optimization of glucose-induced concentration (n = 5); Figure 3 The middle g is a statistical graph of the tumor colonization efficiency (n = 5) of ENHL in the CT-26 orthotopic tumor model under different bacterial doses; Figure 3 The graph in Figure h represents the statistical distribution of tumor oxidative lactate concentration (n = 5) measured by Flag-ELISA after ENHL administration. All data are expressed as mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0045] Figure 4 This figure shows the experimental results of in vitro cytotoxicity and mechanism analysis of OMV loaded with LOx in an embodiment of the present invention. Figure 4In the middle, a represents the transmission electron microscopy (TEM) characterization of the morphology of OMV-P (OMV derived from ENHP) and OMV-L (OMV derived from ENHL), scale bar: 200 nm. Figure 4 In the middle, b represents a representative spectrum of apoptosis in CT26 cells obtained by flow cytometry analysis, corresponding to different treatments (G1: PBS control; G2: OMV-P; G3: OMV-L; G4: 6Gy; G5: OMV-P + 6Gy; G6: OMV-L + 6Gy; n = 5). Figure 4 Figure c shows the quantitative analysis results of CT26 cell apoptosis by flow cytometry, corresponding to different treatments (G1: PBS control; G2: OMV-P; G3: OMV-L; G4: 6Gy; G5: OMV-P + 6Gy; G6: OMV-L + 6Gy; n = 5). Figure 4 Figure d shows the results of cell viability assessment (n = 5) of CT26 cells after treatment; Figure 4 Figure e shows the results of quantitative analysis of clone counts for CT26 cells under different treatment methods; Figure 4 In the middle f are immunofluorescence images of γ-H2AX staining after different treatments. Scale bar: 100 micrometers; Figure 4 The graph in middle g represents the statistical analysis of lactate content (n = 5) in the supernatant of CT26 cells after different treatments. Figure 4 Figure h shows the results of Western blot analysis of CT26 cell lysates, including the expression of Pan-Kla, GAPDH, and MRE11, as well as the level of Pan-Kla-modified MRE11 under different treatments. All data are presented as mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0046] Figure 5 This is a diagram showing the experimental results of the anti-tumor effect of engineered bacteria that regulate lactic acid metabolism combined with radiotherapy in an embodiment of the present invention. Figure 5 Figure 'a' is a schematic diagram of the experimental design for in situ treatment of rectal cancer. Figure 5 In the middle b, the Kaplan-Meier survival curves for different treatment groups (n = 5) are shown. Figure 5 In the middle c, there are representative bioluminescent images of longitudinal tumor monitoring at baseline (day 0) and endpoint (day 14) (n = 5). Figure 5 In the middle d, the results of quantitative photon flux analysis at baseline (day 0) and endpoint (day 14) for longitudinal tumor monitoring are shown (n = 5). Figure 5 The graph in section e shows the final tumor weight (n = 5) for different treatment groups. Figure 5In the middle f are tissue sections stained with H&E and Ki67 immunohistochemistry, scale bar = 50 micrometers; Figure 5 Figure g shows the quantitative analysis results of Ki67 immunohistochemistry in tumor sections. All data are expressed as mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0047] Figure 6 This is a diagram showing the experimental results of in vivo immune remodeling and tumor microenvironment regulation in an embodiment of the present invention. Figure 6 In the middle, 'a' is a schematic diagram of tumor microenvironment remodeling after treatment; Figure 6 In the middle, bd represents the representative immunohistochemical staining of Pan-Kla, HIF1α and IFN-γ in the tumor section, respectively. Scale bar = 50 micrometers. Figure 6 In the middle, e and f are representative flow cytometry images of CD8+ T cells (CD45+CD3+CD8+) and M1 macrophages (CD11b+F4 / 80+CD86+) in tumor tissue, respectively; Figure 6 The image in image g is a representative flow cytometry image of dendritic cells (CD11c+CD80+CD86+) in the mesenteric lymph nodes. Figure 6 The graph in hj shows the results of quantitative analysis of immune cells: h represents CD8+ T cell infiltration, i represents M1 macrophage polarization, and j represents DC maturation in mesenteric lymph nodes (n = 6). Figure 6 Figure k in the figure represents the results of quantitative analysis of IFN-γ immunohistochemical staining in mice of different treatment groups (n = 4). All data are expressed as mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0048] Figure 7 This figure shows the experimental results in which the regulatory role of the gut microbiota is caused by ENHL in an embodiment of the present invention. Figure 7 In the figure, 'a' represents the Ace index assessed at the OTU level, and comparisons were made between treatment groups using the Kruskal-Wallis H test (G1: PBS control group; G2: ENHL group; G3: 4Gy group; G4: ENHL+4Gy group). Figure 7 Figures b and c show the α-diversity results assessed by the Shannon index (b) and the Chao index (c), respectively. Figure 7 The figure in the middle (d) shows the results of principal component analysis (PCoA) of the gut microbiota composition; Figure 7 In the middle, 'e' represents a Venn diagram showing the overlap of identified bacterial strains in fecal samples from different treatment groups. Figure 7 The bar chart in section f shows the taxonomic distribution of microbial communities at the genus level; Figure 7In the analysis of short-chain fatty acid (SCFA) metabolism in different treatment groups, g represents isobutyric acid and h represents butyric acid. All data are expressed as mean ± standard deviation (n = 5). Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

[0049] Figure 8 This figure shows the experimental results of the anti-tumor effect of lactic acid metabolism regulating engineered bacteria in APCmin / + mice in this embodiment of the invention. Figure 8 In Figure 'a', the experimental design for treating APCmin / + mice is shown in the diagram. Figure 8 In Figure b, the overall morphology of intestinal tumors in different treatment groups is shown. Figure 8 Figure c shows the results of quantitative analysis of intestinal tumor burden in different treatment groups (n = 5). Figure 8 In the middle section, d represents the representative immunohistochemical staining of Ki67, Pan-Kla, TUNEL, and H&E in the tumor section. Scale bar = 100 micrometers. Figure 8 Figures e and f show the results of quantitative analysis of Ki67 positive cells and Pan-Kla staining intensity (n = 4), respectively. Figure 8 The image in the middle (g) shows the immunofluorescence staining of TNFα in intestinal tumors in APCmin / + mice under different treatments. Scale bar = 100 micrometers. Figure 8 The graph in the middle (h) shows the statistical changes in mouse body weight during the study period (n = 5). All data are expressed as mean ± standard deviation. Statistical significance was determined by one-way ANOVA (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). Detailed Implementation

[0050] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use.

[0051] Unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention. It should also be understood that, for ease of description, the dimensions of the various parts shown in the drawings are not drawn to actual scale. Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of the specification. In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may include different values. It should be noted that similar reference numerals and letters in the following figures denote similar items; therefore, once an item is defined in one figure, it need not be further discussed in subsequent figures.

[0052] The present invention will be further described below with reference to the embodiments.

[0053] In this invention, unless otherwise specified, "EcNΔ" nlpI That is, "delete". nlpI The abbreviations for "EcN strain of gene" have the same meaning; "LOx" is the abbreviation for "lactic acid oxidase" and has the same meaning; "HlpA" is the abbreviation for "histone-like protein A"; "ClyA" is the abbreviation for "cytolysin A"; and "OMVs" is the abbreviation for "bacterial outer membrane vesicles" and has the same meaning. The terms with the same meaning can be used interchangeably.

[0054] In this embodiment of the invention, a recombinant plasmid was constructed that utilizes an arabinose promoter to initiate gene expression under specific conditions, thereby initiating the expression of recombinant protein-like protein A and lactate oxidase. This recombinant plasmid was then introduced into a tumor-targeting chassis bacterium, resulting in an engineered bacterium capable of targeting tumors and expressing lactate oxidase under arabinose conditions at the tumor site. Figure 1 As shown, this engineered bacteria that regulates lactic acid metabolism can target tumor sites and continuously express lactate oxidase at the tumor site to degrade lactic acid accumulated in the tumor.

[0055] Example 1

[0056] This embodiment provides a radiosensitizing engineered bacteria ENGD and ENHP that deliver lactate via engineered bacterial vesicles.

[0057] 1. Experimental Materials

[0058] EcNΔ nlpIChassis bacteria (purchased from Baosai Biotechnology), recombinant plasmids (synthesized by Genewiz Biotechnology Co., Ltd.), LB medium containing ampicillin, PBS, fetal bovine serum, electroporation cups, HCT116 cells, CT26 cells, insulin injector, DAPI, phalloidin-tetramethylrhodamine B isothiocyanate (purchased from Solarbio), IVIS Lumina III in vivo imaging system.

[0059] 2. Experimental Methods

[0060] 2.1 Construction and Validation of Engineered Bacteria ENGD and ENHP

[0061] The recombinant plasmid (including the arabinose promoter gene and the exogenous protein-coding gene linked thereafter) was designed according to Table 1 and synthesized by Genewiz Biotechnology Co., Ltd. The recombinant plasmid was then ligated into the pBAD His A vector and introduced into EcNΔ using electroporation. nlpI The target engineered bacteria were screened using ampicillin from the basal bacteria.

[0062] Table 1. Gene sequences of engineered bacteria ENGD and ENHP

[0063] Methods for synthesizing recombinant plasmids include: Using pBAD / His A as the plasmid vector, pBAD / His A was double-digested with restriction endonucleases NheI and EcoRI in a reaction system (containing 1 μg pBAD / His A plasmid vector, 2 μL 10×PBS buffer, 1 μL restriction endonuclease I (NheI) and 1 μL restriction endonuclease II (EcoRI) in a nuclease-free water bath at 37°C for 2-4 hours to linearize the plasmid vector and expose sticky ends that match the ends of the target gene. After the plasmid vector digestion reaction is complete, add 1 μL of alkaline phosphatase and continue incubation at 37°C for 30 minutes to significantly reduce vector self-ligation. The target gene was prepared using T4 DNA ligase and its buffer solution. The cut plasmid vector and the prepared target gene were mixed and ligated overnight at 16°C using T4 DNA ligase and its buffer to form a circular recombinant plasmid. The recombinant plasmid was introduced into EcNΔ via electroporation. nlpIFor competent DH5α cells, add 10 μL of ligation product to 100 μL of thawed competent cells, mix gently, and incubate on ice for 30 minutes; heat shock at 42°C for 90 seconds, immediately transfer to ice to cool for 2 minutes, add 900 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 200 rpm for 45-60 minutes to revive the cells and express ampicillin resistance; Centrifuge the revived bacterial culture at 4000 rpm for 2 minutes, discard part of the supernatant, and resuspend the bacterial cells in about 100 μL. Then, spread the entire culture onto LB agar plates containing 100 μg / mL ampicillin. Invert the plates and incubate at 37°C for 12-16 hours. Randomly pick several single colonies, take a small amount with a sterile toothpick or pipette tip, and use it as a template for PCR. Set up an empty vector and a positive control, and use electrophoresis to preliminarily determine which colonies contain the insert fragment. Inoculate the PCR-positive colonies into LB liquid medium containing ampicillin and incubate overnight at 37°C with shaking. Use a plasmid extraction kit and restriction endonucleases NheI and EcoRI to extract the plasmid. Observe the plasmid by agarose gel electrophoresis. Two clear bands were observed (one is the linearized vector, and the other is the target gene), which preliminarily proves that the recombinant plasmid was successfully constructed. Positive clones were identified by colony PCR. A single colony was picked up with a sterile toothpick and placed into 200 μL of LB medium. The mixture was then incubated at 37°C for 3 hours. Clones were selected for DNA sequencing. Based on the sequencing results, the correct clones were selected. Preparation of EcNΔnlpI electrocompetent states: from EcNΔ nlpI A single colony was picked from the plate culture and inoculated into 5 mL of LB liquid medium. The culture was incubated overnight at 37°C with shaking at 220 rpm to obtain a seed culture. The seed culture was then inoculated into 200 mL of SOB medium (placed in a 1 L shake flask to ensure adequate oxygen) at a ratio of 1:100 and incubated at 37°C with vigorous shaking at 220 rpm, closely monitoring the bacterial concentration. The culture was then analyzed using EcNΔ... nlpI Bacterial liquid OD 600 When the concentration reaches 0.4-0.6, immediately place it in an ice-water mixture to cool for 30 minutes, then collect the cells by centrifugation at 4°C and 4000 × g for 10 minutes. Next, wash: discard the supernatant, gently resuspend the cells in an equal volume of ice-cold ultrapure water, and centrifuge again. Repeat this washing step once. For final resuspending and aliquoting, first resuspend the cells in a small amount of ice-cold 10% glycerol, then add to 20-30 mL to remove ions. After centrifugation, discard the supernatant, and finally resuspend the cells very gently in 1-2 mL of 10% glycerol to form a high-concentration cell suspension. Aliquot 100 μL / tube and flash-freeze at -80°C for storage. Electroporation preparation of engineered bacteria: First, set the electroporator to 2.5 kV and prepare pre-chilled electroporation cuvettes and plasmid DNA. Thaw a tube of competent cells on ice, add 1 μL of DNA, mix gently, and transfer to the electroporation cuvette (avoiding air bubbles). Electroporate at 2.5 kV and 5 ms. Immediately after electroporation, add 1 mL of pre-warmed LB medium to revive the cells, and transfer the bacterial culture to a centrifuge tube. Incubate at 37°C and 150 rpm for 45-90 minutes. Finally, spread 100 μL of the revived bacterial culture onto LB agar plates containing ampicillin antibiotics and incubate at 37°C for 12-16 hours to observe transformants. Western blot analysis showed that the Myc and Flag signals were successfully localized to the engineered bacteria, indicating that the engineered bacteria stably express the target gene.

[0064] The engineered bacteria ENGD and ENHP were cultured in 30 mL LB medium at 37°C with shaking (220 rpm), and 1500 μg of 50 mg / mL ampicillin was added. Bacterial lysate was obtained, and Western blotting was used to detect the expression of the exogenous gene in the engineered bacteria. To evaluate the in vitro induction concentration of the engineered bacteria, after culturing for 8 hours under different concentrations of arabinose inducer (0, 0.25, 0.5, 1.0, 2.0 g / L), the expression intensity of EGFP green fluorescent protein was detected at an excitation wavelength of 488 nm using a microplate reader, and the fluorescence intensity signal value was quantitatively analyzed.

[0065] 2.2 Targeting Validation of Engineered Bacteria ENGD and ENHP

[0066] This invention employs confocal laser scanning microscopy (CLSM) to visualize and analyze the binding characteristics of engineered bacteria ENHP and ENGP with HCT-116 colon cancer cells. Heparin competition experiments confirmed that the binding process depends on a specific molecular recognition mechanism mediated by heparan sulfate proteoglycan (HSPG). To further elucidate its structural basis, super-resolution microscopy was used to observe and reveal the characteristics of the ultrastructure on the surface of the engineered bacteria and its interaction patterns with target cells at the nanoscale.

[0067] 2.3 In vivo distribution of engineered bacteria ENGD and ENHP

[0068] Healthy BALB / c mice were selected and administered 100 μL of solution containing 1×10⁻⁶ mg / L orally via gavage. 9 CFU engineered bacteria suspension in 20 g / L arabinose solution. Complete gastrointestinal samples were obtained at five key time points: 0, 2, 5, 12, and 24 hours after administration, and fluorescence imaging analysis was performed using the IVISLumina III in vivo imaging system.

[0069] 3. Experimental Results

[0070] 3.1 Construction and validation results of engineered bacteria ENGD and ENHP

[0071] like Figure 2 As shown in Figures a and b, plasmid expression was successfully performed in both modified strains. Under arabinose induction, ENHP expressed both Myc and 3×Flag tagged proteins, while ENGP expressed only the Myc tagged protein. Furthermore, as... Figure 2 As shown in Figure c, screening the induction conditions using the EGFP fluorescent reporter system revealed that the fluorescence intensity reached its peak when the induction concentration of arabinose (Ara) reached 1 g / L. Therefore, in subsequent in vitro induction experiments, a arabinose concentration of 1 g / L was selected to achieve the optimal protein expression effect.

[0072] 3.2 Targeting Validation Results of Engineered Bacteria ENGD and ENHP

[0073] The binding efficiency of ENHP to HCT-116 colon cancer cells was analyzed using confocal laser scanning microscopy (CLSM), such as... Figure 2 As shown in Figure d, the binding strength of ENHP was significantly higher than that of the control strain ENGP. Heparin pretreatment experiments confirmed the binding mechanism mediated by heparan sulfate-dependent heparan proteoglycans (HSPGs), and the binding rate decreased after competitive inhibition by heparin. Figure 2 As shown in Figure e, EGFP was observed for the first time in a circular distribution on the bacterial outer membrane using super-resolution microscopy. This spatial arrangement indicates that the recombinant protein is located on the bacterial outer membrane, providing a structural basis for targeted delivery mediated by bacterial extravesicular vesicles (OMVs).

[0074] 3.3 In vivo distribution characteristics of engineered bacteria ENHP

[0075] like Figure 2 As shown in f and g, the fluorescence signal was mainly concentrated in the stomach 2 hours after administration, shifted to the small intestine 5 hours later, and showed persistent fluorescence in the colon region from 12 to 24 hours later, confirming that the engineered bacterium ENHP has a significant colonic colonization ability. This method, through time-series whole gastrointestinal imaging, achieves precise evaluation of the intestinal distribution dynamics of engineered bacteria, providing a reliable technical means for the targeted assessment of orally delivered engineered bacteria.

[0076] Example 2

[0077] This embodiment provides an engineered bacterium ENHL carrying lactate oxidase.

[0078] 1. Experimental Materials

[0079] EcNΔ nlpIChassis bacteria (purchased from Bosai Biotech), exogenous plasmids (purchased from Anshengda), ultrafiltration tubes, ultracentrifuge tubes, ultracentrifuge, 0.22μm filter membrane, electroporation cup, pyruvate content assay kit, LB medium containing ampicillin, PBS, and fetal bovine serum.

[0080] 2. Experimental Methods

[0081] 2.1 Construction and validation of engineered strain ENHL carrying lactate oxidase

[0082] The recombinant plasmid (including the arabinose promoter gene and the exogenous protein-coding gene linked thereafter) was designed according to Table 2 and synthesized by Genewiz Biotechnology Co., Ltd. The recombinant plasmid was then ligated into the pBAD His A vector and introduced into the EcNΔ vector using electroporation. nlpI The target engineered bacteria were screened using ampicillin from the basal bacteria.

[0083] Table 2 Gene sequences of engineered bacteria ENHL

[0084] The engineered strain ENHL was cultured in 30 mL LB medium at 37°C with shaking (220 rpm), and 1500 μg of 50 mg / mL ampicillin was added. Bacterial extracellular vesicles (OMVs) were extracted using a combination of ultracentrifugation and density gradient centrifugation. The specific steps were as follows: First, the engineered bacterial culture was centrifuged at 10000×g for 30 minutes at 4°C to remove bacterial cells. The supernatant was filtered through a 0.22 μm filter for sterilization. Then, the filtrate was ultracentrifuged at 150000×g for 2 hours at 4°C, the precipitate was collected, and resuspended in PBS buffer. After identification by transmission electron microscopy (TEM), high-purity OMV samples were obtained. This method can effectively separate vesicle structures with diameters of 50-200 nm while maintaining their intact membrane structure and biological activity.

[0085] 2.2 Determination of enzyme kinetics of lactate oxidase.

[0086] LOx activity was determined by measuring the amount of pyruvate generated during lactate oxidation. The procedure involved adding 0.5 mg of LOx sample to 1 mL of PBS solution containing different amounts of lactate substrate (0 μg, 2 μg, 4 μg, 6 μg, 8 μg, 10 μg), and then initiating the reaction. The amount of pyruvate generated was then measured using a commercially available pyruvate assay kit (Sorbite Biosciences, BC2200), and the kinetic measurements were obtained by monitoring the absorbance at 520 nm using a microplate reader.

[0087] To accurately determine the lactate oxidase (LOx) loading in bacterial extravesicular vesicles (OMVs), this invention establishes a protein labeling-based quantitative analysis method. Specifically, Western blot is used for quantitative detection: purified OMV samples are separated by SDS-PAGE electrophoresis, transferred to an NC membrane, and then immunoassay is performed sequentially using anti-3×Flag monoclonal primary antibody (1:1000 dilution) and HRP-labeled secondary antibody (1:5000 dilution). Finally, the images are developed using an ECL chemiluminescence system. The band gray values ​​are analyzed using ImageJ software, and a standard curve is established using recombinant Flag-LOx standards (concentration gradient: 0-9 μg) to calculate the absolute content of LOx in OMVs.

[0088] 2.3 Evaluation of enzyme production in tumors by engineered strain ENHL

[0089] To determine the optimal arabinose concentration for induction in vivo while minimizing gastrointestinal side effects, mice were administered 200 μL of ENHL (containing 1 × 10⁻⁶ g / L) orally via gavage. 9 CFU-engineered bacteria were administered via gavage for 12 hours, followed by induction with drinking water (500 mL per cage) containing different concentrations (0, 2.5, 5, 10, 15 g) of arabinose. Fecal samples were then collected and diluted with PBS (1 mL per gram of feces) for fluorescence intensity analysis. The tumor-targeting colonization efficiency and LOx expression level of orally administered engineered EcN were systematically evaluated. A gradient dosing regimen was used, and tumor tissue was obtained 24 hours after administration. Bacterial colonization (CFU / g tissue) was quantified using a plate spread method (ampicillin LB medium). Simultaneously, the expression level of the LOx-Flag fusion protein in tumor homogenate was detected using a Flag-labeled ELISA kit (FineTest, EU2607).

[0090] 3. Experimental Results

[0091] 3.1 Construction and Validation Results of Engineered Bacterium ENHL

[0092] Bacterial lysis proteins and bacterial extracellular vesicles (OMVs) were obtained, and Western blotting was used to detect the expression of recombinant plasmids in the engineered bacterium ENHL. Figure 3 As shown in Figure b, Western blot analysis revealed the expression of Myc and 3×Flag-tagged proteins in engineered ENHL cells and their secreted outer membrane vesicles (OMVs-L) after arabinose induction.

[0093] 3.2 Enzyme kinetics results of lactate oxidase

[0094] like Figure 3As shown in Figure c, enzymatic characterization analysis revealed that, compared with the natural LOx standard, the substrate affinity of lactate oxidase expressed by engineered bacteria ENHL was slightly decreased, and its Michaelis constant (Km) increased from 2.61 mmol to 2.69 mmol, but it still retained some of the natural enzyme activity.

[0095] To quantitatively determine the LOx loading on OMV, Western blot analysis was performed using protein tags (Flag tags) as a surrogate indicator of LOx content, such as... Figure 3 As shown in d and e, the average flag loading per 10 micrograms of OMV-L is 10.17 nanograms. And as... Figure 3 As shown in Figure f, the maximum induction effect was achieved at a concentration of 10 g / L arabinose. Furthermore, the engineered strain ENHL exhibited dose-proportional tumor colonization, such as... Figure 3 As shown in g, at 1.0 × 10 9 The maximum bacterial load was reached at a single cell dose. Consistently, as... Figure 3 As shown in Figure h, after oral administration of different doses of engineered bacteria ENHL, the actual protein yield of engineered bacteria ENHL in tumors showed a trend that was basically consistent with the increasing trend of engineered bacteria ENHL loading in tumors.

[0096] Example 3

[0097] This embodiment provides an in vitro radiosensitivity assessment of outer membrane vesicles (OMVs-L) secreted by the engineered bacterium ENHL.

[0098] 1. Experimental Materials

[0099] CT26 (ATCC source), DMEM culture medium, fetal bovine serum, trypsin, CCK-8 assay kit, Annexin V-FITC / PI apoptosis assay kit, crystal violet staining solution; antibodies included anti-γH2AX, anti-MRE11, anti-lactation modified antibodies and corresponding fluorescent secondary antibodies. Key instruments and equipment: ultracentrifuge (Beckman Optima XE-90), microplate reader (BioTek Synergy H1), flow cytometer (BD FACSCanto II), confocal microscope (Zeiss LSM 880), chemiluminescence imaging system (Bio-Rad ChemiDoc MP), and X-ray irradiator (X-RAD 320). All experimental materials underwent quality control verification, and instruments were professionally calibrated to ensure the accuracy and reproducibility of experimental data.

[0100] 2. Experimental Methods

[0101] 2.1 Extraction and characterization of exovesicles of engineered bacteria ENHL

[0102] Bacterial cultures were centrifuged (4°C, 4000 rpm, 20 min), and the supernatant was then filtered sequentially through a 0.22 μm vacuum filter (Wuxi Nissei Biotechnology, 343011) and concentrated using a 50 kDalton ultrafiltration membrane (Milwaukee, uFC905008). Further purification was performed using a 0.22 μm disposable syringe filter. The resulting filtrate was ultracentrifuged (150,000 × g, 4°C, 3 h), and the precipitate was resuspended in 1 mL of PBS (obtained from the initial 1000 mL culture volume) and stored at -20°C. The protein concentration of OMV was quantified using a BCA protein assay kit (Nanjing Novizan Biotechnology, E112-01). Morphological characteristics were characterized by cryo-electron microscopy (Aifang Biotechnology).

[0103] 2.2 Experimental evaluation of OMVs-L sensitizing radiotherapy

[0104] The antitumor effect of engineered ENHL external vesicles (OMVs) was systematically evaluated using a multidimensional experimental approach. The cytotoxicity of different experimental groups (including PBS (G1), OMVs-P (G2), OMVs-L (G3), 6Gy (G4), OMVs-P+6Gy (G5), and OMVs-L+6Gy (G6)) on tumor cells was assessed. For cell proliferation assays, the inhibitory effect of OMVs on tumor cell growth was quantitatively analyzed using the CCK-8 assay: CT26 cells (5×10⁻⁶) were... 3 Cells were seeded in 96-well plates and treated with 20 μg / mL OMVs for 24 hours, followed by incubation with CCK-8 reagent for 1 hour. Absorbance at 450 nm was measured using a microplate reader, and cell viability was calculated. To investigate long-term proliferation inhibition, a colony formation assay was performed: cells were seeded at low density, treated with OMVs or combined with radiotherapy (6 Gy), and cultured for 10-14 days. Colony formation rate was counted using crystal violet staining. For apoptosis detection, Annexin V-FITC / PI double staining was used: treated cells were trypsinized, resuspended in Binding Buffer, and stained with Annexin V-FITC and PI in the dark for 15 minutes. Flow cytometry was used to quantitatively analyze the proportion of apoptotic cells (early apoptosis: Annexin V⁺ / PI⁻; late apoptosis: Annexin V⁺ / PI⁺). This series of experiments comprehensively elucidated the antitumor mechanism of OMVs from three aspects: short-term proliferation inhibition, long-term colony formation ability, and apoptosis induction.

[0105] 2.3 Evaluation of the mechanism of OMVs-L radiosensitization

[0106] This invention systematically evaluated the regulatory effect of OMVs-L on lactation of the DNA damage repair protein MRE11 in CT26 cells using immunofluorescence and Western blotting techniques. In immunofluorescence assays, CT26 cells were seeded in confocal culture dishes, treated with OMVs-L, fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, and incubated overnight at 4°C with primary antibodies against anti-γH2AX (1:200) and anti-MRE11 (1:100). Then, they were incubated with Alexa Fluor 647-labeled secondary antibody at room temperature in the dark for 1 hour. After nuclear staining with DAPI, the fluorescence colocalization signal was observed and quantified under a confocal microscope. Western blotting assays used RIPA lysis buffer to extract total protein, which was separated by SDS-PAGE and transferred to an NC membrane. Immunoassays were performed using anti-γH2AX (1:1000), anti-MRE11 (1:800), and anti-lactation modification antibody (1:1000). Experimental results showed that the formation of γH2AX focal points was reduced by about 40% in the OMVs-L treatment group (p<0.01), and the lactation modification level of MRE11 protein was significantly reduced, indicating that OMVs-L can enhance radiosensitivity by regulating the lactation modification of DNA damage repair proteins.

[0107] 3. Experimental Results

[0108] 3.1 Characterization results of the engineered bacteria ENHL exovesicles

[0109] Based on the confirmation that the engineered bacterium ENHL can efficiently secrete therapeutic OMVs (OMVs-L) loaded with LOx, a comprehensive study was conducted on the radiosensitizing effect of LOx-loaded OMVs. First, OMVs were isolated by ultracentrifugation and characterized using transmission electron microscopy (TEM), such as... Figure 4 As shown in Figure a, all OMVs exhibit a typical bilayer membrane structure. The particle size distribution of OMVs derived from engineered bacteria ENHP (OMVs-P) and OMVs derived from engineered bacteria ENHL (OMVs-L) is approximately 200 nm.

[0110] 3.2 Evaluation of the synergistic effect of OMVs-L and radiotherapy

[0111] The viability of CT-26 cells treated with different concentrations of OMVs-P and OMVs-L was evaluated using flow cytometry and CCK-8 assay. The toxicity of different formulations (including PBS (G1), OMVs-P (G2), OMVs-L (G3), 6Gy (G4), OMVs-P+6Gy (G5), and OMVs-L+6Gy (G6)) to tumor cells was also assessed. Figure 4As shown in Figures b and c, flow cytometry using Annexin V-APC / 7-AAD staining revealed that the combined use of 100 μg / mL OMVs-L and 6 Gy radiation significantly increased the apoptosis rate of CT26 cells. Similarly, as... Figure 4 As shown in Figure d, OMVs-L exhibits a significant radiosensitizing effect under 6 Gy X-ray treatment. Figure 4 As shown in Figure e, the colony formation experiment further confirmed the enhanced radiation response; the colony formation survival rate of OMVs-L+6Gy (G6) was significantly lower than that of OMVs-P+6Gy (G5) or radiation alone (G4). These combined results indicate that OMVs-L enhances radiation-induced cell death, supporting its role as an effective radiosensitizer.

[0112] 3.3 Evaluation of the mechanism of OMVs-L radiosensitization

[0113] To investigate the radiosensitization mechanism of OMVs-L, the degree of lactation of the DNA damage protein MRE11 and the state of γH2AX were detected. γH2AX is a typical marker of DNA double-strand breaks. In addition, immunofluorescence staining was used to detect the formation of γH2AX focal spots, such as... Figure 4 As shown in Figure f, DNA damage accumulation in cells treated with OMVs-L+6Gy (G6) was significantly higher than in the untreated control group and the single radiation therapy group. Lactate levels in the supernatant of CT26 cells after various treatments were measured to assess the functional capacity of OMVs-L, such as... Figure 4 As shown in Figure g, OMVs-L effectively degrades radiotherapy-induced lactate in CT26 cells, indicating that it can remodel the tumor microenvironment by targeting lactate catabolism. Further investigation into the effect of OMVs-L on lactation of cancer cell proteins was conducted by detecting the expression level of Pan-Kla using Western blotting. Figure 4 As shown in Figure h, OMVs-L treatment significantly reduced the upregulated Pan-Kla expression in CT26 cells induced by radiotherapy. Figure 4 Western blotting results showed that OMVs-L treatment significantly reduced MRE11 lactation in CT26 cells. These findings collectively indicate that LOx-loaded OMVs (exosomes) exert radiosensitizing effects through multiple mechanisms: (1) targeted consumption of lactate in the tumor microenvironment, (2) inhibition of protein lactylation modification, and (3) disruption of DNA damage repair pathways. This synergistic effect significantly enhances the antitumor efficacy of radiotherapy.

[0114] Example 4

[0115] This embodiment evaluates the therapeutic effect of engineered bacteria ENHL combined with radiotherapy on low rectal tumors in mice.

[0116] 1. Experimental Materials

[0117] Microsyringe, CT26 cells expressing luciferase, CD3-FITC (100202), CD4-APC (B201509), CD8-PE (100734), CD11c-FITC (N418), CD86-APC (105008), CD80-PE (104708), CD11b-PerCP (E-AB-F1081F), and F4 / 80-FITC (E-AB-F0995C), IVIS spectral imaging system (IVIS spectrum, Perkin Elmer), flow cytometer (BD FACSVerse), stereo microscope, microsyringe.

[0118] 2. Experimental Methods

[0119] 2.1 Establishment of a mouse CT26 low-lying colorectal tumor model and treatment regimen

[0120] like Figure 5 As shown in Figure a, by using a microsyringe (1×10⁻⁶) 5 10 μL of CT26-luc cells (1 × 10⁻⁶ cells) were injected intramuscularly into the rectal mucosa of anesthetized BALB / c mice. 5 An orthotopic rectal cancer model was established on day -7. Successful tumor implantation was verified by IVIS fluorescence imaging on day 0. Subsequently, mice were randomly assigned to six treatment groups and received the following treatments: PBS gavage (G1), ENHP gavage (G2), ENHL gavage (G3), 4 Gy (G4), ENHP gavage + 4 Gy (G5), and ENHL gavage + 4 Gy (G6). A standardized treatment regimen was used, namely oral administration of engineered bacterial suspension (1×10⁻⁶). 9 The mice were treated with CFU / 200 μL, and bacteria were allowed to colonize and express proteins at 12-hour intervals. Following this, local tumor irradiation was administered at a dose of 4 Gy. Tumor growth in mice was monitored periodically using an IVIS spectral imaging system. Imaging was performed on days 0, 5, 8, 10, and 14 post-treatment, and fluorescence intensity data at the tumor site were recorded. Mice were euthanized 15 days after tumor implantation, and tumor weight and volume were measured.

[0121] 2.2 H&E tissue sections and immunohistochemical staining detection

[0122] The potential impact of engineered bacteria on intestinal xenografts was assessed using histopathological methods including hematoxylin and eosin (H&E) staining and immunohistochemistry (IHC). The specific procedures were as follows: First, mouse intestinal tumor tissue samples were fixed in 4% paraformaldehyde for 24 hours, then embedded in paraffin and prepared into 4 μm thick tissue sections. H&E staining was then performed: after dewaxing and hydration, the sections were sequentially immersed in hematoxylin staining for 5 minutes and eosin staining for 3 minutes, dehydrated, cleared, and mounted with neutral resin. Morphological changes were observed under an optical microscope. Immunohistochemical staining was performed using the SP method: after antigen retrieval, endogenous myeloperoxidase was blocked with endogenous peroxidase, and non-specific binding sites were blocked with 10% BSA. Then, primary antibodies (Ki67, Pan-Kla, HIF1α, IFN-γ), biotin-labeled secondary antibodies, and HRP-labeled streptavidin were added sequentially. DAB staining was performed, and after hematoxylin counterstaining, the expression and localization of target proteins were observed. This method can simultaneously obtain histopathological changes and target protein expression localization information, providing important experimental evidence for evaluating the intestinal safety and targeted expression characteristics of engineered bacteria.

[0123] 2.3 Flow cytometry detection of CD8 + Maturation status of T cells, M1 tumor-associated macrophages, and dendritic cells in mesenteric lymph nodes

[0124] After the experiment, mice were euthanized, and the regulatory effect of the engineered bacteria on the host immune system was evaluated using flow cytometry to detect multidimensional immune cell subsets. The specific steps were as follows: First, single-cell suspensions were prepared. Tumor tissue was prepared using type IV collagenase digestion, while mesenteric lymph nodes were obtained through mechanical grinding. After erythrocyte lysis, Fc receptors were blocked with anti-CD16 / 32 antibody, followed by flow cytometry-based fluorescent antibody labeling to detect CD8+. + T cells were identified using a combination of anti-CD3-FITC, CD4-APC, and CD8-PE antibodies; M1 macrophages were identified using anti-CD11b-PerCP, F4 / 80-FITC, and CD86-APC antibodies; and dendritic cell maturity was analyzed using anti-CD11c-FITC, CD86-APC, and CD80-PE antibodies. After excluding dead cells, all samples were analyzed using flow cytometry (e.g., BD FACS Canto II), with thresholds set to exclude cell debris. The proportions of each subset were analyzed using FlowJo software. This method can simultaneously and quantitatively detect the polarization status of effector T cells and macrophages, as well as the maturity of antigen-presenting cells, providing comprehensive and accurate experimental evidence for assessing the immunomodulatory function of engineered bacteria.

[0125] 2.4 Sequencing of 16S rDNA gut microbial diversity

[0126] Fecal microbiota of mice in each experimental group was analyzed by 16S rRNA gene sequencing to comprehensively evaluate the regulatory effect of engineered bacteria ENHL on the gut microbiota. Mice were randomly assigned to four treatment groups: PBS gavage (G1), ENHL gavage (G2), 4Gy group (G3), and ENHL gavage + 4Gy group (G4). After the experiment, intestinal contents were collected from the mice, and 16S rDNA microbial diversity and targeted metabolomics sequencing were performed. Total genomic DNA was extracted from the mouse intestinal contents using a fecal DNA kit (Omega, D4015), and purity was determined using Nano Drop spectrometry before 16S rDNA sequencing (Illumina MiSeq PE300 platform) was performed to evaluate the diversity of the medical microbiota and analyze its composition. Sequencing data processing and bioinformatics analysis were performed on the BigBio Cloud Platform. The content of sequencing data processing and bioinformatics analysis included α diversity (Sobs, Chao, ACE, Shannon-Wiener index, Simpson diversity index) and β diversity (principal coordinate analysis (PCoA), non-metric multidimensional scaling (NMDS) analysis). Venn diagrams were used to show the differences in species composition between the two groups, and community histograms and t-tests were used to analyze the differences in microbial species and abundance at the genus level.

[0127] 3. Experimental Results

[0128] 3.1 Therapeutic effect of engineered bacteria combined with radiotherapy on orthotopic xenograft tumors

[0129] like Figure 5 As shown in Figure b, the combination therapy (G6) significantly prolonged the survival time of mice compared with monotherapy. Tumor progression was monitored at days 0, 5, 8, 10, and 14 using IVIS fluorescence bioimaging. Figure 5 As shown in C and D, the fluorescence intensity of mice (G6) treated with ENHL + 4 Gy was significantly reduced. This therapeutic effect was further confirmed by the endpoint measurement of tumor weight, as shown in... Figure 5 As shown in Figure e, the tumor mass was lowest in the ENHL + 4Gy group, indicating that the engineered bacteria ENHL provided by this invention, combined with radiotherapy, effectively inhibited the progression of low rectal cancer.

[0130] 3.2 Evaluation of treatment efficacy by tissue section

[0131] like Figure 5 Histopathological analysis of tumor tissue after treatment also showed extensive necrosis / apoptosis in the ENHL + 4Gy group (G6). Consistently, as... Figure 5Analysis of f and gKi67 staining images showed that the combined treatment of ENHL and 4Gy radiation significantly reduced tumor cell proliferation.

[0132] Figure 6 Figure a illustrates the remodeling of the tumor microenvironment after treatment, demonstrating how engineered bacteria combined with radiotherapy can modulate the tumor immune microenvironment. First, tumor tissues were collected from mice receiving different treatments and subjected to Pan-Kla immunohistochemical staining. (See figure a for details.) Figure 6 As shown in Figure b, the LOx-loaded engineered bacteria ENHL significantly reduced radiation-induced upregulation of Pan-Kla expression. Further evaluation of HIF1α expression levels in different treatment groups was conducted, such as... Figure 6 As shown in Figure c, ENHL +4 Gy effectively alleviated the hypoxia in the tumor microenvironment caused by radiation.

[0133] 3.3 Flow cytometry detection of the immunomodulatory effects of engineered bacteria

[0134] To evaluate the immunomodulatory effects of combining genetically modified bacteria with radiotherapy, flow cytometry was used to analyze tumor-infiltrating T cells and M1 tumor-associated macrophages (TAMs), and immunohistochemistry was used to detect their IFN-γ expression. Different treatment regimens were also investigated, and the results are as follows: Figure 6 Figures d to f show the difference in CD8 levels in tumors between mice treated with ENHL and mice treated with 4 Gy compared to mice treated with PBS. + The percentage of T cells increased significantly, from 11.1% to 29.2%, while the percentage of M1 type TAMs increased from 15.7% to 66.1%. Immunohistochemical analysis was performed to assess IFN-γ expression in tumor tissues, such as... Figure 6 As shown in Figure d, the ENHL + 4Gy (G6) treatment group had the highest IFN-γ expression level. Furthermore, the antigen-specific immune response in the mesenteric lymph nodes was assessed, such as... Figure 6 As shown in Figure g, in the 4 Gy group, DC cells (CD11c) + CD80 + CD86 + The proportion of [unclear - possibly a specific type of cancer] was increased compared to the control group, and this effect was more pronounced in mice in the ENHL + 4 Gy (G6) group. Notably, engineered ENHL combined with 4 Gy (G6) radiotherapy significantly enhanced the anti-tumor immune response, which was observed from CD8 [unclear - possibly a specific type of cancer]. + Increased T cell infiltration ( Figure 6 Increased M1 type tumor-associated macrophages (middle h), M1 type tumor-associated macrophages ( Figure 6 (i) An increase in the number of mature dendritic cells in the mesenteric lymph nodes (i) Figure 6(j) and elevated IFN-γ levels in the tumor microenvironment (j) Figure 6 These effects are manifested in (k). These effects may be achieved through the degradation of tumor-derived lactate mediated by engineered bacteria ENHL.

[0135] 3.4 Sequencing of 16S rDNA gut microbial diversity

[0136] like Figure 7 As shown in Figure a, ENHL treatment with engineered bacteria significantly enhanced the α-diversity of the gut microbiota, manifested as a marked increase in microbial richness; in stark contrast, the RT group (4 Gy radiation therapy) resulted in a significant decrease in bacterial diversity. Analysis of various α-diversity indicators revealed, such as... Figure 7 As shown in Figures b and c, the Chao and Shannon indices in the ENHL treatment group were significantly higher than those in other groups, further confirming the promoting effect of this treatment on microbial diversity. Figure 7 β-diversity analysis of d and e showed that ENHL intervention significantly altered the overall composition of the gut microbiota. Figure 7 As shown in Figure d, compared with the control group, the β diversity of mice in the RT treatment group was significantly altered, and principal coordinate analysis (PCoA) clearly showed the clustering differences between different treatment groups. Venn diagram analysis further revealed the common and unique microbial species distribution characteristics among the groups. Figure 7 (e). For example Figure 7 As shown in Figure f, the microbial community characteristics of the ENHL + 4Gy combination therapy group differed significantly from those of radiotherapy alone. At the taxonomic level, the ENHL + 4Gy combination therapy induced characteristic changes in community structure: a significant increase in the abundance of beneficial bacteria (such as Lactobacillus). These findings suggest that ENHL treatment may exert its radioprotective effect by modulating the abundance of probiotics. The ENHL + 4Gy combination therapy significantly increased the levels of short-chain fatty acids (SCFAs). Specifically, as shown in Figure f... Figure 7 As shown in g and h, the levels of isobutyric acid and butyric acid in the feces of this group of mice were significantly higher than those in other groups. Although radiotherapy alone significantly inhibited the synthesis of short-chain fatty acids, the combination of engineered bacteria ENHL and radiotherapy not only effectively blocked this downward trend, but also further restored the ability of intestinal microorganisms to generate SCFAs.

[0137] Example 5

[0138] This embodiment, based on Embodiment 2, provides the therapeutic effect of engineered bacteria ENHL combined with radiotherapy on spontaneous intestinal adenoma model mice.

[0139] 1. Experimental Materials

[0140] Spontaneous intestinal adenoma model mice (male, purchased from Jicui Yaokang), gavage injection, ruler, 4% paraformaldehyde, sodium citrate buffer (pH 6.0), 10% BSA, endogenous peroxidase, primary antibody against the target protein and HRP-labeled secondary antibody, DAB staining, hematoxylin, neutral resin.

[0141] 2. Experimental Methods

[0142] 2.1 Animal Model Construction and Grouping

[0143] The study used materials purchased from Jicui Pharmacy. APC Mice with a gene-deficient spontaneous intestinal adenoma model underwent treatment intervention starting at eight weeks of age. Experimental animals were randomly assigned to different treatment groups, receiving the following regimens: PBS gavage as a blank control, gavage with engineered ENHL suspension, local radiotherapy alone (4 Gy), and synergistic treatment with ENHL gavage combined with 4 Gy radiotherapy. Standardized procedures were followed during treatment, beginning with oral gavage administration of 1×10⁻⁶ ppm of PBS. 9 A CFU / 200 μL suspension of engineered bacteria was administered, followed by 12-hour intervals to ensure adequate bacterial colonization and expression of the target protein in the intestine, and then local tumor radiotherapy at a dose of 4 Gy was given. This combined treatment regimen was administered weekly for three consecutive weeks, with weekly monitoring of mouse body weight. At the end of the treatment cycle, the number of adenomas in the mid and distal colon segments of the mice was counted by dissection to evaluate the intervention efficacy of each treatment regimen.

[0144] 2.2 The inhibitory effect of combined therapy on intestinal tumors

[0145] After the fifteenth week of treatment, intestinal tumors from mice in each group were collected. Histopathological examination using H&E staining and immunohistochemistry was conducted to evaluate the potential impact of engineered bacteria combined with radiotherapy on spontaneous intestinal tumors. The specific steps were as follows: First, intestinal tumor tissue samples from mice were fixed in 4% paraformaldehyde for 24 hours, then embedded in paraffin and prepared into 4μm thick tissue sections. H&E staining was then performed: after dewaxing and hydration, the sections were sequentially immersed in hematoxylin staining for 5 minutes and eosin staining for 3 minutes. After dehydration and clearing, they were mounted with neutral resin and the morphological changes were observed under an optical microscope. Immunohistochemical staining used the SP method: after antigen retrieval, endogenous peroxidase was blocked with a progenitor peroxidase inhibitor, and non-specific binding sites were blocked with 5% BSA. Then, primary antibodies (Ki67, Pan-Kla, Tunnel), HRP-labeled secondary antibodies, and DAB staining were performed. After hematoxylin counterstaining, the expression and localization of target proteins were observed under a microscope. After the experiment, immunofluorescence was used to detect the expression distribution of TNF-α in the tumor microenvironment to evaluate the treatment effect.

[0146] 3. Experimental Results

[0147] 3.1 Tumor Suppression Effect

[0148] like Figure 8 The experimental results in sections b and c showed that the engineered bacteria ENHL combined with 4 Gy radiotherapy (G4) exhibited a significant anti-tumor effect, with a statistically significant reduction in the number of distal colonic adenomas compared to the other control groups (G1-G3). This data indicates that the combined treatment regimen of engineered bacteria and radiotherapy has a significant anti-tumor effect. APC Min / + It exhibits synergistic tumor-suppressive effects in spontaneous intestinal adenoma models. Regarding safety assessments, such as... Figure 8 As shown in Figure h, the G4 group mice maintained a stable weight gain trend throughout the treatment period, and no obvious toxic side effects were observed, confirming that the combined treatment regimen has good biosafety.

[0149] 3.2 The inhibitory effect of combined therapy on intestinal tumors

[0150] like Figure 8 Immunohistochemical analysis of d and e showed that the proportion of Ki67-positive cells in adenomas was significantly reduced in the combined treatment group (ENHL+4 Gy), indicating that this treatment regimen effectively inhibited the proliferative activity of tumor cells. Meanwhile, as Figure 8 TUNEL assay results showed that the apoptosis positivity rate in group G4 was significantly higher than that in other groups. This result is consistent with the decreasing trend of Ki67 expression, jointly confirming that the combination therapy not only inhibits tumor cell proliferation but also significantly promotes tumor cell apoptosis, thereby exerting a synergistic anti-tumor effect. Meanwhile, as... Figure 8 As shown in d and f, the combined treatment group (ENHL + 4 Gy) exhibited significant metabolic-immune regulatory characteristics: on the one hand, the radiation-induced protein lactation modification (Pan-Kla) level in this group was significantly lower than that in other control groups, indicating that the combined treatment could effectively alleviate radiotherapy-induced metabolic stress; on the other hand, as Figure 8 As shown in Figure g, immunofluorescence analysis revealed that the expression level of TNF-α in the tumor microenvironment of group G4 was significantly upregulated compared to other groups, suggesting that treatment can activate the anti-tumor immune response. These results, from the molecular mechanism to the overall effect level, systematically elucidate the synergistic anti-tumor effect of engineered bacteria ENHL combined with radiotherapy.

[0151] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of engineered bacteria that regulates lactic acid metabolism, characterized in that, Including chassis bacteria and recombinant plasmids; The bacterial cells in the chassis are EcNΔ nlpI ,EcNΔ nlpI To delete nlpI The EcN strain of the gene is used to enhance the release of outer membrane vesicles; The recombinant plasmid includes a plasmid vector and a target gene; The plasmid vector is pBAD / His A, and pBAD / His A uses an arabinose promoter with a nucleotide sequence as shown in SEQ ID NO:1; The target genes include the encoding genes for Myc-EGFP recombinant protein, Myc-INP-HlpA-ClyA-EGFP-3×Flag recombinant protein, and Myc-INP-HlpA-ClyA-LOx-3×Flag recombinant protein, which are used to enable engineered bacteria to express tumor-targeting molecules, lactate oxidase, and enhanced green fluorescent protein.

2. The engineered bacteria for regulating lactic acid metabolism according to claim 1, characterized in that, The 5'→3' direction of the encoding gene of the Myc-EGFP recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2 and the enhanced green fluorescent protein encoding gene as shown in SEQ ID NO:6; The 5'→3' direction of the encoding gene of the Myc-INP-HlpA-ClyA-EGFP-3×Flag recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2, the ice nucleoprotein-histone-like protein A fusion gene encoding gene as shown in SEQ ID NO:3, the cytolysin A encoding gene as shown in SEQ ID NO:4, the enhanced green fluorescent protein encoding gene as shown in SEQ ID NO:6, and the 3×Flag tag protein encoding gene as shown in SEQ ID NO:7; The 5'→3' direction of the encoding gene of the Myc-INP-HlpA-ClyA-LOx-3×Flag recombinant protein includes: the Myc tag protein encoding gene as shown in SEQ ID NO:2, the ice nucleoprotein-histone-like protein A fusion gene encoding gene as shown in SEQ ID NO:3, the cytolysin A encoding gene as shown in SEQ ID NO:4, the lactate oxidase encoding gene as shown in SEQ ID NO:5, and the 3×Flag tag protein encoding gene as shown in SEQ ID NO:

7.

3. The method for constructing engineered bacteria that regulate lactic acid metabolism as described in any one of claims 1-2, characterized in that, include: Using pBAD / His A as the plasmid vector, pBAD / His A was double-digested with restriction endonucleases NheI and EcoRI to linearize the plasmid vector and expose sticky ends that match the ends of the target gene. The target gene was prepared using T4 DNA ligase and its buffer solution. The cut plasmid vector and the prepared target gene are mixed and ligated under the action of T4 DNA ligase and its buffer to form a circular recombinant plasmid. The recombinant plasmid was introduced into EcNΔ via electroporation. nlpI Competent DH5α cells were screened for strains containing the target recombinant plasmid using ampicillin to obtain engineered bacteria that regulate lactic acid metabolism.

4. The method for constructing engineered bacteria that regulate lactic acid metabolism according to claim 3, characterized in that, The electrical transfer parameters are 2.5 kV and 5 ms.

5. The method for constructing engineered bacteria that regulate lactic acid metabolism according to claim 3, characterized in that, The method for screening strains containing the target recombinant plasmid using ampicillin includes: using Western blot to detect whether the strain expresses the tag proteins Myc and 3×Flag. When the strain expresses the tag proteins Myc and 3×Flag, an engineered bacterium that stably expresses the target gene is obtained.

6. The use of the lactic acid metabolism regulating engineered bacteria according to claim 1 in the preparation of a drug that degrades lactic acid accumulated in the tumor microenvironment.

7. The use of the lactic acid metabolism regulating engineered bacteria according to claim 1 in the preparation of drugs that enhance tumor radiosensitivity.

8. The application according to claim 7, characterized in that, The lactic acid metabolism-regulating engineered bacteria enhance tumor radiosensitivity by producing bacterial extravesicles.

9. The application according to claim 6 or 7, characterized in that, The drug is administered orally.

10. The application according to any one of claims 6-9, characterized in that, The tumor is a colorectal tumor.

Images