Use of a reagent for detecting a snp molecular marker associated with meat quality traits in goats

Abstract

This invention relates to the field of molecular marker technology, specifically to the application of detection reagents for SNP molecular markers related to goat meat quality traits. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The SNP site is located at position 139 from the 5' end of the sequence shown in SEQ ID NO.1, and its polymorphism is A or G. Goats with the genotype AG or GG at this site have a longer back muscle with greater tenderness than goats with the AA genotype at this site. This invention also develops a reagent for detecting this SNP molecular marker. This reagent can be used to identify goat meat quality traits, thereby screening for goat meat with tender texture and delicate taste, which has significant value in goat breeding, assisted breeding, and improving the value of goat meat.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to the application of detection reagents for SNP molecular markers related to goat meat quality traits. Background Technology

[0002] The quality of meat is primarily determined by the biochemical composition and microstructure of muscle tissue, with muscle fiber type, intramuscular fat content, connective tissue distribution, and protein degradation being key factors influencing meat quality. Currently, meat color, tenderness, water-holding capacity, and pH value are widely used for meat quality evaluation. Tenderness, as a core indicator, directly affects the mechanical strength and chewing characteristics of muscle, serving as an important basis for consumers to evaluate the edible quality of meat. The longissimus dorsi muscle, as the main muscle group for goat movement, has representative muscle fiber composition and metabolic characteristics, effectively reflecting overall meat performance. Shear force measurement, as an internationally accepted method for tenderness assessment, can objectively quantify the shear strength of muscle, providing reliable phenotypic data for meat quality breeding. Therefore, elucidating the tenderness regulation mechanism of the longissimus dorsi muscle is of great significance for improving goat meat quality.

[0003] Traditional phenotypic selection methods rely on post-slaughter testing, often requiring multiple generations of screening, resulting in long breeding cycles, high costs, poor reproducibility, and large errors. In recent years, developing functional markers for target traits using genome-wide association analysis has become a hot topic in molecular biology research. Marker-assisted selection (MAG) technology, with its advantages of being unrestricted by time and geographical factors and offering accurate, rapid, and efficient selection processes, is gradually becoming a reliable and effective selection method. Therefore, it is essential to identify SNP molecular markers related to goat meat quality and develop a reagent to detect these markers, enabling rapid identification and genetic improvement of goat meat quality traits. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides the application of a detection reagent for SNP molecular markers associated with goat meat quality traits. This reagent can be used for goat breeding, assisted breeding, or meat quality trait identification.

[0005] To achieve the above objectives, the specific technical solution of the present invention is as follows:

[0006] The first aspect of this invention provides the application of a detection reagent for SNP molecular markers related to goat meat quality traits, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP site is located at position 139 from the 5' end of the sequence shown in SEQ ID NO.1, and its polymorphism is A or G; the application is for goat breeding, goat assisted breeding, or identification of goat meat quality traits.

[0007] Furthermore, goat meat with the genotype AG or GG at the SNP locus has a higher tenderness than goat meat with the genotype AA.

[0008] Furthermore, the detection reagent is a primer set for detecting SNP molecular markers related to goat meat quality; the primer set consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.

[0009] Furthermore, the breed of goat mentioned is the Yunling goat.

[0010] A second aspect of the present invention provides a method for identifying the quality traits of goat meat, comprising the following steps:

[0011] DNA was extracted from the goat to be tested;

[0012] Using the primer set described above, a PCR reaction was performed with the DNA of the goat to be tested as a template to obtain PCR products;

[0013] The PCR product was sequenced to obtain the PCR product sequence shown in SEQ ID NO.1;

[0014] Identify the genotype of the SNP site shown in SEQ ID NO.1, and determine the meat quality traits of goats based on the genotype of the SNP site: the meat tenderness of goats with the genotype of AG or GG at the SNP site is greater than that of goats with the genotype of AA.

[0015] Furthermore, each 25 μL PCR reaction system contains: 12.5 μL of 2x Taq Plus Master Mix II, 2 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, and 8.5 μL of ddH2O.

[0016] Furthermore, the PCR reaction procedure is as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57.6℃ annealing for 40 s, 72℃ extension for 60 s, 34 to 36 cycles; 72℃ extension for 5 min.

[0017] Furthermore, the breed of goat mentioned is the Yunling goat.

[0018] Furthermore, the goat meat is the longest muscle tissue from the goat's back.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This invention discloses the application of a detection reagent for a SNP molecular marker related to goat meat quality traits. The shear force of the longissimus dorsi muscle is one of the core indicators for measuring meat tenderness; a lower shear force value indicates higher tenderness. This invention discloses for the first time an SNP molecular marker related to goat meat quality. The nucleotide sequence of this SNP molecular marker is shown in SEQ ID NO.1. The SNP site is located at position 139 from the 5' end of the sequence shown in SEQ ID NO.1, and its polymorphism is A or G. Goats with the genotype AG or GG at this site have greater tenderness in their longissimus dorsi muscle than goats with the genotype AA at this site. The developed detection reagent for this SNP molecular marker can be used to identify goat meat quality traits. In the process of goat breeding, this SNP molecular marker detection reagent can be used to assist in selecting AG or GG individuals with tender meat, which has important practical application value for improving the meat value of goats, goat breeding, and goat assisted breeding.

[0021] This invention also discloses a method for identifying the meat quality traits of goats. This method is simple to operate and provides accurate and reliable identification results, which is beneficial to improving the efficiency of goat breeding and shortening the breeding cycle. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This shows the distribution of the GG, AG, and AA genotypes at the SNP locus in the shear force trait of the longissimus dorsi muscle in Yunling goats; * indicates P <0.05, *** indicates P <0.001.

[0024] Figure 2 The results are shown in the agarose gel electrophoresis results; lane M is the DNA marker; lane 0 is the blank control group, and the blank control sample is 2 μL of sterile water; lanes 1 to 9 are the experimental group, and the bands in lanes 1 to 9 are the target sequence bands, with a brighter band at 201 bp for the target sequence.

[0025] Figure 3 The peak diagram shows the forward sequencing results of the PCR amplification products from Yunling goats. Figure 3 The A in the diagram shows that the SNP site at position 139bp in SEQ ID NO.1 has only one A base peak; Figure 3B in the diagram shows that the SNP site at 139bp of SEQ ID NO.1 has only one G base peak. Detailed Implementation

[0026] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0027] The Yunling goats in this invention are from a farm in Shuangbai County, Yunnan Province, under standardized breeding conditions.

[0028] Meat quality traits are influenced by key factors such as muscle fiber type, intramuscular fat content, connective tissue distribution, and the degree of protein degradation. Tenderness is a core evaluation indicator, directly related to the consumer's eating experience. The longissimus dorsi muscle, as a representative muscle, can have its tenderness quantitatively assessed through shear force measurement. Traditional phenotypic breeding methods are time-consuming and costly. Molecular marker-assisted selection (MMR) technology, with its advantages of being unrestricted by time and geographical factors and offering accurate, rapid, and efficient selection processes, is gradually becoming a reliable and effective selection method. Therefore, it is essential to identify SNP molecular markers related to goat meat quality and develop a reagent to detect these SNPs, enabling rapid identification and genetic improvement of goat meat quality traits.

[0029] This invention discloses the application of a detection reagent for SNP molecular markers related to goat meat quality traits. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The SNP site is located at position 139 from the 5' end of the sequence shown in SEQ ID NO.1, and its polymorphism is A or G. Goats with the genotype AG or GG at this site have greater tenderness in the longest back muscle than goats with the genotype AA at this site. This invention also develops a reagent for detecting this SNP molecular marker. This reagent can be used to identify goat meat quality traits. During goat breeding, the reagent for detecting this SNP molecular marker can assist in the selection of AG or GG individuals with tender meat, thereby accelerating the goat breeding process.

[0030] Example 1: Obtaining SNP molecular markers associated with goat meat quality

[0031] 1. Extraction of Yunling goat genomic DNA

[0032] This invention uses blood samples from 20 healthy Yunling goats aged 18-24 months. The goats were isolated and fasted from water for 12 hours prior to blood collection. The following morning, fasting blood samples were drawn from the jugular vein of each goat using a sterile disposable needle and a 5mL EDTA-K2 anticoagulant vacuum blood collection tube. After collection, the samples were thoroughly mixed eight times by inverting the tube to ensure the anticoagulant was fully incorporated into the blood. The blood samples were aliquoted into 1.8mL cryovials and flash-frozen in liquid nitrogen within 30 minutes, then stored at -80°C.

[0033] Yunling goat DNA extraction: Genomic DNA was extracted from frozen blood samples using the DP304 blood / cell / tissue genomic DNA extraction kit purchased from Tiangen Biotech Co., Ltd., following the instructions in the kit's manual.

[0034] 2. Genome resequencing and variant detection

[0035] The DNA extracted in step 1 was resequencing using BGI Genomics' DNBSEQ-T7 sequencer. The raw sequencing data was quality checked using FastQC v0.12.1 software. Based on the quality status, low-quality sequences and sequencing adapters were removed from the raw data using Fastpv0.24.0. The cleaned data was aligned to the goat reference genome T2T-goat1.0 (GenBank ID: GCA_040806595.1) using BWA-MEM2 v2.2.1, and PCR repeats in the alignment results were removed using Picard. After indexing the above results using Samtools v1.9, variant detection was performed using GATK v4.6.1.0 in Joint-Call Cohort mode, following GATK variant detection best practices. Due to the limitations of short-read sequencing data, this invention performs quality control on variant data, retaining variants that meet the following conditions: variant quality depth QD ≥ 2.0, FS ≤ 60, SOR ≤ 3, MQ > 40, ReadPosRankSum ≥ -8.0, MQRankSum > -12.5, MAF ≥ 0.05, and F_MISSING ≤ 0.1. This yields a high-quality variant set.

[0036] A SNP site was found at position 34372606 bp on chromosome 17 of the goat reference genome T2T-goat1.0. The base of this SNP site in the goat reference genome is A, while the SNP site in the test sample has two base types, A and G. That is, there is an A / G polymorphism at position 139 bp of the sequence shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, R represents A or G.

[0037] SEQ ID NO.1:

[0038] AAAAATAAACAAAGATCCCCAGCAAAGATCCCCTTGGTTGGGATACATCGTTTTTGAGGGCATTAGCCTACTATGTCCCCCTGAGGCTGGCAAAGCAATAAAACTTTTCTTTTAAACTTCACCCAAAACTTTGTCTCCRAGATTCAATTTGGCACCATTGAGCTTTCAGCATCAATATGAGTCCACTGAAAAAGCAACACA.

[0039] This invention statistically analyzed the genotypes of each sample at the SNP sites in the sequence shown in SEQ ID NO.1, and the statistical results are shown in Table 1.

[0040] Table 1. Sample Genotyping Information

[0041]

[0042] 3. Determination of shear force in the longissimus dorsi muscle of Yunling goat samples

[0043] The shear force of the longissimus dorsi muscle is one of the core indicators for measuring meat tenderness; the lower the shear force value, the higher the tenderness of the meat. Shear force was measured in the longissimus dorsi muscle of the above-mentioned Yunling goat samples using a shear force analyzer.

[0044] Shear force determination method: Using a round-hole sampler, take a 2.5 cm diameter and 1 cm thick meat sample from the center of the longissimus dorsi and biceps femoris muscles along the muscle fiber direction. Place the sample on a shear force analyzer for measurement. Each sample is measured three times, and the average value is taken. The unit of shear force is N, Newton. The shear force measurement results are shown in Table 2.

[0045] Table 2 Shear force measurement results

[0046]

[0047] 4. Obtaining SNP molecular markers related to goat meat quality

[0048] After quality control of SNP loci, Plink was used to apply high-quality SNP loci to genome-wide association analysis, while the top three principal components of genotype, sex, and age were used as covariates.

[0049] As shown in Table 3, in the correlation analysis between SNP locus genotype and shear force of the longissimus dorsi muscle, this SNP locus showed a very strong negative correlation with shear force. R =-0.8757, P =4.24×10 -7 .

[0050] Table 3. Correlation analysis between SNP sites and shear force of the longissimus dorsi muscle in Yunling goats.

[0051]

[0052] One-way ANOVA was used to detect the differences in shear force of the longissimus dorsi muscle among Yunling goats with GG, AA, and AG genotypes. Holm-Sidak multiple comparisons were used for post-hoc tests based on the ANOVA, including comparisons between GG and AA genotypes, GG and AG genotypes, and AG and AA genotypes.

[0053] Table 4. Correlation analysis between SNP locus genotypes and shear force of the longissimus dorsi muscle in Yunling goats.

[0054]

[0055] like Figure 1 As shown in Table 4, among individual samples of Yunling goats, there were significant differences in the shear force of the longissimus dorsi muscle among individuals with different genotypes at this SNP locus: the average shear force of the longissimus dorsi muscle in Yunling goats with the GG genotype was 41.32 N, the average shear force in Yunling goats with the AG genotype was 57.50 N, and the average shear force in Yunling goats with the AA genotype was 66.07 N; the maximum shear force of the longissimus dorsi muscle in Yunling goats with the GG genotype was 51.9 N, the maximum shear force in Yunling goats with the AG genotype was 59.28 N, and the maximum shear force in Yunling goats with the AA genotype was... The maximum shear force of the longissimus dorsi muscle in Yunling goats with the GG genotype is 66.7 N; the minimum shear force of the longissimus dorsi muscle in Yunling goats with the GG genotype is 35.41 N, the minimum shear force of the longissimus dorsi muscle in Yunling goats with the AG genotype is 56.4 N, and the minimum shear force of the longissimus dorsi muscle in Yunling goats with the AA genotype is 65.66 N; the standard deviation of the mean shear force of the longissimus dorsi muscle in Yunling goats with the GG genotype is 5.52 N, the standard deviation of the mean shear force of the longissimus dorsi muscle in Yunling goats with the AG genotype is 1.09 N, and the standard deviation of the mean shear force of the longissimus dorsi muscle in Yunling goats with the AA genotype is 0.56 N.

[0056] Based on the above results, the sequence shown in SEQ ID NO.1 is a SNP molecular marker related to goat meat quality. There is an A / G polymorphism at 139bp of the sequence shown in SEQ ID NO.1. The genotype of this SNP site is AG or GG. The tenderness of the longest back muscle of goats is greater than that of the longest back muscle of goats with the AA genotype.

[0057] Example 2: Development and validation of detection reagents for SNP molecular markers related to goat meat quality

[0058] Based on the molecular marker sequence information in Example 1, a primer set for amplifying the sequence shown in SEQ ID NO.1 was designed. This primer set consists of an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

[0059] SEQ ID No. 2: 5'-AAAAATAAACAAAGATCCCCAGCA-3'.

[0060] SEQ ID No. 3: 5'-TGTGTTGCTTTTTCAGTGGACT-3'.

[0061] Using the Yunling goat DNA extracted in Example 1 as a template, PCR amplification was carried out using the above primer set according to the following reaction system and procedure to obtain PCR amplification products. The PCR amplification products were detected by 1.5 w / v% agarose gel electrophoresis.

[0062] Each 25 μL reaction mixture contains: 12.5 μL of 2x Taq Plus Master Mix II, 2 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, and 8.5 μL of ddH2O.

[0063] The reaction program was as follows: pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 57.6℃ for 40 s, extension at 72℃ for 60 s, repeated 35 times; extension at 72℃ for 5 min.

[0064] Figure 2 The electrophoresis results of nine samples are shown, and it can be seen that all nine samples have a single bright band at the 201bp position.

[0065] The obtained PCR amplification product was sent to the Kunming branch of Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequence of the amplification product is shown in SEQ ID NO.1. Based on the peak diagram of the sequencing results, the genotype at position 139 of the SEQ ID NO.1 sequence was determined.

[0066] When the SNP site at 139bp of SEQ ID NO.1 has only one A base peak, it indicates that the genotype of this SNP site is AA; when the SNP site at 139bp of SEQ ID NO.1 has only one G base peak, it indicates that the genotype of this SNP site is GG; when the SNP site at 139bp of SEQ ID NO.1 has both A base peaks and G base peaks, it indicates that the genotype of this SNP site is AG.

[0067] like Figure 3 As shown, Figure 3Figure A in the diagram shows that the SNP site at 139bp of SEQ ID NO.1 has only one A base peak, indicating that the genotype of this SNP site is AA. Figure 3 Figure B shows that the SNP site at 139bp of SEQ ID NO.1 has only one G base peak, indicating that the genotype of this SNP site is GG.

[0068] The tenderness of goat meat was determined based on the genotyping results of the SNP sites in the sequence shown in SEQ ID NO.1: the AA type corresponds to the longest dorsi muscle with the greatest shear force and the lowest tenderness; the AG type corresponds to the longest dorsi muscle with the second greatest shear force; and the GG type corresponds to the longest dorsi muscle with the smallest shear force and the most tender meat. Therefore, the preferred genotype is the GG type.

[0069] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0070] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a detection reagent for SNP molecular markers related to goat meat quality traits, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP site is located at position 139 from the 5' end of the sequence shown in SEQ ID NO.1, and its polymorphism is A or G; the application is for breeding or identifying goat meat quality traits; the breed of goat is Yunling goat; the meat quality trait is the tenderness of the longest back muscle.

2. The application of the detection reagent for SNP molecular markers related to goat meat quality traits according to claim 1, characterized in that, The longest back muscle of Yunling goats with the genotype AG or GG at the SNP locus has a greater tenderness than that of Yunling goats with the genotype AA.

3. The application of the detection reagent for SNP molecular markers related to goat meat quality traits according to claim 1, characterized in that, The detection reagent is a primer set for detecting the SNP molecular markers associated with goat meat quality; the primer set consists of an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A method for determining the tenderness of the longest muscle on the back of a Yunling goat, characterized in that, Includes the following steps: DNA was extracted from the Yunling goats to be tested; Using the primer set described in claim 3, a PCR reaction was performed with the DNA of the Yunling goat to be tested as a template to obtain PCR products; The PCR products were sequenced to obtain the genotypes of the SNP sites shown in SEQ ID NO.1; Based on the genotype of the SNP locus, the tenderness of the longest back muscle of Yunling goats was determined: the tenderness of the longest back muscle of Yunling goats with the genotype of AG or GG at the SNP locus was greater than that of Yunling goats with the genotype of AA.

5. The method for determining the tenderness of the longest muscle on the back of Yunling goat according to claim 4, characterized in that, The PCR reaction system consisted of: 12.5 μL of 2x Taq Plus Master Mix II, 2 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, and 8.5 μL of ddH2O.

6. The method for determining the tenderness of the longest muscle on the back of Yunling goat according to claim 4, characterized in that, The PCR reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57.6℃ annealing for 40 s, 72℃ extension for 60 s, for 34 to 36 cycles; 72℃ extension for 5 min.

Images