SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of Jinhu hybrid spots and application

By developing SNP molecular markers related to the growth traits of golden tiger hybrids and using the genotyping of SNP1, SNP2, and SNP3, the problem of uneven growth traits in golden tiger hybrids was solved, enabling early screening of superior individuals and improving breeding efficiency and profitability.

CN121472432AActive Publication Date: 2026-02-06YAZHOU BAY INNOVATION RESEARCH INSTITUTE HAINAN TROPICAL OCEAN UNIVERSITY +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610031552.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-02-06
Estimated Expiration
2046-01-12

AI Technical Summary

Technical Problem

The growth traits of golden tiger hybrids are uneven in the offspring population, which leads to potential damage to the aquaculture industry. Existing technologies make it difficult to effectively screen out slow-growing individuals.

Method used

We developed SNP molecular markers associated with the growth traits of golden tiger hybrid spots. By detecting the genotypes of SNP1, SNP2, and SNP3, we used amplification primer pairs for PCR amplification and high-throughput sequencing to screen for golden tiger hybrid spots with excellent growth traits.

Benefits of technology

It improves breeding efficiency, enables early identification and elimination of slow-growing individuals, shortens breeding time, and increases breeding profits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472432A_ABST
    Figure CN121472432A_ABST
Patent Text Reader

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of Jinhu hybrid spots and application, and belongs to the technical field of SNP molecular markers. The SNP molecular marker comprises one or more of SNP1 (Single Nucleotide Polymorphism), SNP2 and SNP3 (Single Nucleotide Polymorphism 3); the nucleotide sequences of the SNP1-SNP3 are respectively shown as SEQ ID NO.1-SEQ ID NO.3 in sequence, and the SNP sites of the SNP1-SNP3 are respectively as follows: the basic group at the 101 site in the nucleotide sequence shown as SEQ ID NO.1 is T or C, the basic group at the 101 site in the nucleotide sequence shown as SEQ ID NO.2 is T or C, and the basic group at the 101 site in the nucleotide sequence shown as SEQ ID NO.3 is C or T. The genotype of the SNP loci of the SNP molecular marker is determined through detection, the gold and tiger hybrid spots with excellent growth traits are obtained through breeding, and the breeding income is increased.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker related to the growth trait of a gold-tiger hybrid grouper and application thereof. BACKGROUND

[0002] The gold money spot, the scientific name of which is Epinephelus maculatus, Epinephelus tukula is one of the larger fish in the grouper, which has excellent growth traits and stress resistance, and is often used as an excellent parent of hybrid grouper. The tiger spot, the scientific name of which is Epinephelus fuscoguttatus, Epinephelus fuscoguttatus is one of the more common and high economic value grouper species in China, which has delicious meat and grows faster, and is also one of the main parents of grouper hybrid breeding. The gold-tiger hybrid spot is an excellent hybrid grouper variety obtained by hybridizing male gold money spots and female tiger spots, which shows obvious heterosis in growth, low temperature tolerance and low oxygen tolerance, however, the performance of this advantage in the offspring population is not uniform, which will cause potential damage to the aquaculture industry.

[0003] Molecular markers are often closely related to target traits, and have characteristics such as wide source, reliable results, and not easily affected by the environment, so that it becomes an important means to realize individual selection by means of molecular markers. Therefore, it is a technical problem to be solved at present to screen SNP sites related to growth phenotype traits from gold-tiger hybrid spots, develop molecular markers, eliminate slow-growing individuals, and maximize the breeding benefit. SUMMARY

[0004] In view of this, the purpose of the present application is to provide a SNP molecular marker related to the growth trait of a gold-tiger hybrid spot and application thereof.

[0005] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions: The present application provides a SNP molecular marker related to the growth trait of a gold-tiger hybrid spot, characterized in that the SNP molecular marker comprises one or more of SNP1, SNP2 and SNP3. The nucleotide sequence of the SNP1 is shown in SEQ ID NO. 1, and the SNP site of the SNP1 is that the base at position 101 of the nucleotide sequence shown in SEQ ID NO. 1 is T or C. The nucleotide sequence of the SNP2 is shown in SEQ ID NO. 2, and the SNP site of the SNP2 is that the base at position 101 of the nucleotide sequence shown in SEQ ID NO. 2 is T or C. The nucleotide sequence of the SNP3 is shown in SEQ ID NO. 3, and the SNP site of the SNP3 is that the base at position 101 of the nucleotide sequence shown in SEQ ID NO. 3 is C or T.

[0006] The application provides application of a substance for detecting the SNP molecular marker in breeding Jinhu hybrid plaice with excellent growth traits.

[0007] Preferably, the substance comprises one or more of a primer pair for amplifying the SNP1, a primer pair for amplifying the SNP2 and a primer pair for amplifying the SNP3.

[0008] Preferably, the nucleotide sequence of the primer pair for amplifying the SNP1 is shown in SEQ ID NO. 4~SEQ ID NO. 5; the nucleotide sequence of the primer pair for amplifying the SNP2 is shown in SEQ ID NO. 6~SEQ ID NO. 7; and the nucleotide sequence of the primer pair for amplifying the SNP3 is shown in SEQ ID NO. 8~SEQ ID NO. 9.

[0009] Preferably, the excellent growth traits comprise one or more of body weight, total length, body length, body height, head length and tail handle height.

[0010] The application provides a method for breeding Jinhu hybrid plaice with excellent growth traits, comprising the following steps: (1) extracting genomic DNA in tissue of Jinhu hybrid plaice; (2) performing enzyme cutting, end repair, 3' end adenine addition, linker treatment and magnetic bead purification on the genomic DNA to obtain a purified product, hybridizing one or more of the above-mentioned probes with the purified DNA respectively to obtain a captured DNA library, and then performing high-throughput sequencing on the captured DNA library; Alternatively, one or more of the primer pair for amplifying the SNP1, the primer pair for amplifying the SNP2 and the primer pair for amplifying the SNP3 are used to perform PCR amplification on the genomic DNA as a template to obtain one or more of the PCR amplification products of the SNP1, the SNP2 and the SNP3 respectively, and then performing sequencing on the PCR amplification products; (3) determining the genotype of one or more SNP sites of the SNP1~SNP3 of the Jinhu hybrid plaice individual according to the sequencing result, and determining the Jinhu hybrid plaice with excellent growth traits through genotype analysis.

[0011] Preferably, the tissue is tail fin tissue.

[0012] Preferably, the Jinhu hybrid plaice with the genotype of the SNP site of the SNP1 as TT genotype is the Jinhu hybrid plaice with excellent growth traits; and the excellent growth traits are one or more of body weight, body length, body height and head length.

[0013] Preferably, when the genotype of the SNP site of the SNP2 is the CC genotype, the Jinhu crossbred goldfish is a Jinhu crossbred goldfish with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body height, head length and tail handle height.

[0014] Preferably, when the genotype of the SNP site of the SNP3 is the CT genotype, the Jinhu crossbred goldfish is a Jinhu crossbred goldfish with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body length, body height and head length.

[0015] Compared with the prior art, the present application has the following beneficial effects: The present application provides a SNP molecular marker related to the growth traits of Jinhu crossbred goldfish and an application thereof. By detecting and determining the genotype of the SNP site of the SNP molecular marker, the present application can breed Jinhu crossbred goldfish with excellent growth traits, and can greatly improve the breeding efficiency. The present application can identify the early growth individuals of Jinhu crossbred goldfish by using the SNP molecular marker, and can exclude the individuals of Jinhu crossbred goldfish with slow growth as early as possible, which is helpful for early breeding of Jinhu crossbred goldfish, improves the growth performance of Jinhu crossbred goldfish, shortens the breeding time, and improves the breeding income. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 The position of SNP-1 in the genome of the Jinhu crossbred goldfish; Figure 2 The position of SNP-2 in the genome of the Jinhu crossbred goldfish; Figure 3 The position of SNP-3 in the genome of the Jinhu crossbred goldfish; Figure 4 The sequencing peak map for detecting the SNP1 molecular marker by sequencing; Figure 5 The sequencing peak map for detecting the SNP2 molecular marker by sequencing; Figure 6 The sequencing peak map for detecting the SNP3 molecular marker by sequencing. DETAILED DESCRIPTION

[0017] The present application provides a SNP molecular marker related to the growth traits of Jinhu crossbred goldfish, characterized in that the SNP molecular marker comprises one or more of SNP1, SNP2 and SNP3; The nucleotide sequence of the SNP1 is shown in SEQ ID NO. 1, and the SNP site of the SNP1 is the base T or C at the 101st position in the nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence of the SNP2 is shown as SEQ ID NO. 2, and the SNP site of the SNP2 is the base at position 101 in the nucleotide sequence shown as SEQ ID NO. 2, which is T or C. The nucleotide sequence of the SNP3 is shown as SEQ ID NO. 3, and the SNP site of the SNP3 is the base at position 101 in the nucleotide sequence shown as SEQ ID NO. 3, which is C or T.

[0018] The application provides an application of a substance for detecting the above-mentioned SNP molecular marker in breeding Jinhu hybrid chickens with excellent growth traits.

[0019] In the application, the substance includes one or more of a primer pair for amplifying the above-mentioned SNP1, a primer pair for amplifying the SNP2 and a primer pair for amplifying the SNP3. The nucleotide sequence of the primer pair for amplifying the SNP1 is shown as SEQ ID NO. 4-SEQ ID NO. 5; the nucleotide sequence of the primer pair for amplifying the SNP2 is shown as SEQ ID NO. 6-SEQ ID NO. 7; and the nucleotide sequence of the primer pair for amplifying the SNP3 is shown as SEQ ID NO. 8-SEQ ID NO. 9.

[0020] In the application, the excellent growth traits include one or more of body weight, total length, body length, body height, head length and tail handle height. As a preferred embodiment, when the above-mentioned SNP1 is detected, the excellent growth traits are one or more of body weight, body length, body height and head length. When the above-mentioned SNP2 is detected, the excellent growth traits are one or more of body weight, total length, body height, head length and tail handle height. When the above-mentioned SNP3 is detected, the excellent growth traits are one or more of body weight, total length, body length, body height and head length.

[0021] The application provides a method for breeding Jinhu hybrid chickens with excellent growth traits, which includes the following steps: (1) extracting genomic DNA in Jinhu hybrid chicken tissues; (2) performing enzyme cutting, end repair, 3' end adenine addition, linker treatment and magnetic bead purification on the genomic DNA to obtain a purified product, hybridizing one or more of the above-mentioned probes with the purified product respectively to obtain a captured DNA library, and then performing high-throughput sequencing on the captured DNA library; Alternatively, one or more of the primer pair for amplifying the SNP1, the primer pair for amplifying the SNP2 and the primer pair for amplifying the SNP3 are used to perform PCR amplification on the genomic DNA as a template to obtain one or more of the PCR amplification products of the above-mentioned SNP1, SNP2 and SNP3, and then the PCR amplification products are sequenced. (3) According to the sequencing result, the genotype of the SNP site of one or more of SNP1-SNP3 of the individual of Jinhu hybrid catfish is determined, and the Jinhu hybrid catfish with excellent growth traits is determined through genotype analysis.

[0022] In the present application, genomic DNA in the tissue of Jinhu hybrid catfish is extracted, and the tissue is preferably tail fin tissue. In the present application, genomic DNA is extracted from tail fin tissue, tail fin tissue can be directly obtained from the fish body, and the fish body does not need to be bred to a certain weight to obtain it, and the survival of the fish body is not damaged. The present application does not have special limitations on the way of extracting genomic DNA in the tissue of Jinhu hybrid catfish, and can be extracted by conventional methods in the art, such as using a DNA extraction kit known in the art according to the instructions.

[0023] In the present application, the preparation method of the purified product comprises: (1) extracting genomic DNA of Jinhu hybrid catfish to obtain genomic DNA; (2) performing enzyme cutting fragmentation on the genomic DNA, repairing the enzyme cutting ends of the broken DNA fragments, and performing 3' end A addition to obtain 3' end A-added DNA fragments; (3) adding adapters to the 3' end A-added DNA fragments to obtain adapter-added DNA fragments; (4) performing magnetic bead purification on the adapter-added DNA fragments, performing PCR, performing library quantification and fragment size analysis, and obtaining the purified product.

[0024] In the present application, the PCR amplification system is: 2x Taq PCR mix (any Taq polymerase kit for ordinary PCR on the market) 10 μL; 20 ng of genomic DNA; mixed primers (the concentrations of the upstream and downstream primers are 10 pmol / μL, respectively) 2 μL; and deionized water is added to a total system of 20 μL. The PCR amplification program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 3 min.

[0025] In this invention, after obtaining the PCR amplification product, the PCR amplification product is sequenced to determine the genotype of one or more SNP loci from SNP1 to SNP3 in the golden tiger hybrid individuals. Genotype analysis is then used to identify golden tiger hybrids with superior growth traits. This invention does not specifically limit the sequencing method; conventional sequencing methods in the art can be used. The method for determining golden tiger hybrids with superior growth traits is as follows: Golden tiger hybrids with the genotype TT at SNP1 are considered to have superior growth traits; the superior growth traits are one or more of body weight, body length, body height, and head length. Golden tiger hybrids with the genotype CC at SNP2 are considered to have superior growth traits; the superior growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height. When the genotype of the SNP locus at SNP3 is CT, the golden tiger hybrid is considered to have superior growth traits; these superior growth traits include one or more of body weight, total length, body length, body height, and head length. This invention, through the detection of the SNP locus genotype of SNP molecular markers, allows for the identification and screening of growth traits in early-stage individuals, thereby selecting individuals with rapid growth potential for breeding. This reduces breeding costs, increases breeding profits, and enables molecular-assisted breeding of golden tiger hybrids.

[0026] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1 Based on the whole-genome resequencing results of 202 grouper cultivars, three SNP loci, namely SNP-1, SNP-2, and SNP-3, were identified. Since the Golden Tiger Hybrid Grouper is an excellent hybrid grouper variety obtained by crossing male grouper cultivars and female tiger grouper, this study investigated whether SNP-1, SNP-2, and SNP-3 in the grouper cultivars exhibit the same variation patterns in the Golden Tiger Hybrid Grouper genome. The sequence information of the SNP molecular markers screened in this invention is as follows: The nucleotide sequence of the SNP-1 molecular marker is as follows: TTATGGACGTGTTCTGGTATAGACACGGTAAATAACTGTTGTTTGGAGAGAAACTTTCTGTAACTCTTTCCTCTTCCCTGAAACCAGCTCAACATTTCCT CGTCGACACATCAGATGAGTTGTTGTGTAGATTTCAAACCTTGGCTCAGAGTTGCACATGTTTACAGATATCGATCGAAACTGTCCAAAGTGGTGACAATA (SEQ ID NO.1), where the underlined bases are SNP sites.

[0029] The nucleotide sequence of the SNP-2 molecular marker is as follows: TGTCAAACAGCCGAGGTTGAAGTATGTTACTGTTTAAATGAAGAACTAAACTAACATTGTGTGTGTTTATCAGAAAGACTTGAGAACATGTGGACTTA C AACATGTCTGCCATACCAATTGTCTTTCTGAACTGTCGCACGTAATAGCCAACCCCAACTGACCTCTTGACGAACAGTTTAAGCTAAAGGTTGACTCAAA (SEQ ID NO.2), where the underlined bases are SNP sites.

[0030] The nucleotide sequence of the SNP-3 molecular marker is as follows: ACAATATTCTGAATCTGATTCAAGTCATGTAAACAGCATGTTCTGTTTGGATATTCTGAATTAAAAGAGCACTTCCAAGTCTAAGGCCATGGTTCTTTGC C GGAAAATGGTAGATCACCTCCTCTGGGTTGGAAGTGAGTTACGGCCCCACGCGAAGGAGTTCTAGAATCTTAGGGTCTAGTTCACAAGTGGAGGTAAAAT (SEQ ID NO.3), where the underlined bases are SNP sites.

[0031] In the *Symplocos cuspidata* genome, SNP-1 is located in an intron region of the multiple epidermal growth factor-like domains protein 10 (Megf10) gene (see [link to relevant documentation]). Figure 1 ).

[0032] In the genome of *Symplocos cuspidata*, SNP-2 is located upstream of the 5' end of the monocarboxylate transporter 12 gene (Mct12 or Slc16a12) (see [link to relevant documentation]). Figure 2).

[0033] In the genome of the money spot, SNP-3 is located downstream of the 3' end of the matrix metalloproteinase-14 (Mmp14) gene (see...). Figure 3 ).

[0034] (1) Sequence comparison of SNP1 associated with growth traits of golden tiger hybrid and SNP-1 associated with money tree hybrid. DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 4 (The bases in the box are SNP1 sites).

[0035] Figure 4 The results showed that the SNP sites of SNP1 and SNP-1 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP1, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-1 in the money patch, as shown in SEQ ID NO.1.

[0036] (2) Sequence comparison of SNP2 associated with growth traits of golden tiger hybrid and SNP-2 associated with money tree hybrid. DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 5 (The bases in the box are SNP2 sites).

[0037] Figure 5 The results showed that the SNP sites of SNP2 and SNP-2 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP2, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-2 in the money patch, as shown in SEQ ID NO.2.

[0038] (3) Sequence comparison of SNP3 associated with growth traits of golden tiger hybrid and SNP-3 associated with money tree hybrid. DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 6 (The bases in the box are SNP3 sites).

[0039] Figure 6 The results showed that the SNP sites of SNP3 and SNP-3 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP3, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-3 in the money patch, as shown in SEQ ID NO.3.

[0040] In summary, the SNP sites of SNP1 to SNP3 mentioned above all show the same variation in the genomes of the money patch and the golden tiger hybrid patch (see Table 1).

[0041] Table 1. Relevant information of three SNP molecular markers in the money patch and golden tiger hybrid spots.

[0042] Example 2 A method for selecting superior growth traits of golden tiger hybrids includes the following steps: This method uses the Money Spot 20K liquid chromatography chip to detect any of the SNP1~SNP3 genotypes described in Example 1 of the Golden Tiger hybrid spot. The Money Spot 20K liquid chromatography chip is suitable for large batches of samples (≥30 samples). The product name, Money Spot 20K liquid chromatography chip, was purchased from Huazhi Biotechnology Co., Ltd., with product number CGPS-Money Spot 20K-P1-V1. The specific steps are as follows: (1) DNA was extracted from the collected samples (tail fins of golden tiger hybrids) using the magnetic bead method (any commercially available DNA extraction kit is acceptable). The DNA was then detected using a UV spectrophotometer. The required DNA concentration was greater than 10 ng / μL, and the sample purity was between 1.8 and 2.2 for 260 / 280. Integrity was mainly determined by agarose gel electrophoresis (gel concentration: 1%; voltage: 120V; electrophoresis time: 25 min; loading volume: 1 μL). The sample was required to have a clear main band and no obvious degradation.

[0043] (2) The DNA sample was digested with a fragmentation enzyme to repair the enzyme ends and add an A base to the 3' end. The fragment size was detected by agarose gel electrophoresis. The fragment range was between 100 and 500 bp.

[0044] (3) The sequencing adapter and DNA fragment were ligated using T4 ligase, and the ligation product was purified using purification magnetic beads. The size of the purified product was detected by agarose gel electrophoresis, and the fragment range was between 150 and 500 bp.

[0045] (4) The purified product was amplified and enriched, and fragments were screened using purified magnetic beads. The concentration of the fragment-screened product was detected by Qubit fluorescence quantitative PCR, and the fragment size was detected by agarose gel electrophoresis. The library fragments were between 200 and 400 bp.

[0046] (5) Take 200 ng of the constructed library, concentrate the library, add probe (money-spot 20K liquid phase chip) and hybridization reagent, and incubate at 50℃ for 16-24 hours to complete the hybridization reaction. Use capture magnetic beads to capture the target segment, wash the captured product with washing buffer to remove non-specific binding fragments, and then perform a round of PCR amplification. Use purification magnetic beads to purify the amplification product. Use a Qubit fluorescence quantitative PCR instrument to detect the library concentration and agarose gel electrophoresis to detect the fragment size. The library fragments are between 200 and 400 bp. After the concentration and fragment size are qualified, use the MGI high-throughput sequencing platform to sequence the library. The sequencing read length is PE150.

[0047] (6) The raw data after high-throughput sequencing were processed by quality control filtering, and adapter fragments and low-quality reads were removed using FASTP software to obtain high-quality Clean Reads. The obtained Clean Reads were compared with the reference genome using BWA software and the positions were sorted to obtain the sorted BAM file. The BAM file was analyzed for variant sites using GATK software to obtain the base information of the target sites (SNP1~SNP3 in Example 1).

[0048] When the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of weight, body length, body height and head length.

[0049] When the genotype of the SNP locus of SNP2 is CC, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body height, head length and caudal peduncle height.

[0050] When the genotype of the SNP locus of SNP3 is CT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body length, body height and head length.

[0051] Example 3 Traditional PCR amplification and Sanger sequencing can also be used to detect golden tiger hybrid spots with excellent growth traits. The specific method is as follows: (1) Take the tail fin tissue of 84 golden tiger hybrids and extract the genomic DNA of the tail fin of the golden tiger hybrids using an animal tissue genomic DNA extraction kit (any commercial DNA extraction kit is acceptable).

[0052] (2) Design primer pairs for amplifying SNP1, SNP2 and SNP3 as described in Example 1. The nucleotide sequences of the primer pairs are as follows: SNP1-F: 5`-CATAAAAAGAGCCGAGCCAC-3` (SEQ ID NO.4); SNP1-R: 5`-ATAGATGTTGCTCTCAGCGG-3` (SEQ ID NO.5); SNP2-F: 5`-TGAAACAGTGAGACCGGAAC-3` (SEQ ID NO.6); SNP2-R: 5`-GATGCCTAAAGCCACCTTAC-3` (SEQ ID NO.7); SNP3-F: 5`-TTGTTCTTGACTGGTGGAGG-3` (SEQ ID NO.8); SNP3-R: 5`-TAAGGCTCAGCTTCCTCTTC-3` (SEQ ID NO. 9).

[0053] Using primer pairs for amplifying SNP1, SNP2, and SNP3, PCR amplification was performed with the aforementioned caudal fin genomic DNA as templates. The lengths of the PCR amplification products were 380 bp, 379 bp, and 384 bp, respectively.

[0054] The PCR amplification system was as follows: 10 µL of 2×Taq PCR mix (any commercially available Taq polymerase kit for general PCR); 20 ng of genomic DNA; 2 µL of mixed primers (upstream and downstream primer concentrations of 10 pmol / µL); and deionized water to a total volume of 20 µL.

[0055] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 3 min.

[0056] (3) Then, Sanger sequencing was performed on each PCR amplification product to determine the genotype of the SNP locus of each golden tiger hybrid individual.

[0057] When the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of weight, body length, body height and head length.

[0058] When the genotype of the SNP locus of SNP2 is CC, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body height, head length and caudal peduncle height.

[0059] When the genotype of the SNP locus of SNP3 is CT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body length, body height and head length.

[0060] Example 4 Association analysis of SNP molecular markers with growth traits Eighty-four golden tiger hybrid individuals living in the same environment and at the same growth stage were selected. Phenotypic data were measured for all 84 individuals, including weight, body length, total length, body height, head length, caudal peduncle length, and caudal peduncle height. Weight was measured using an electronic scale. Measurable data for body length, total length, body height, head length, caudal peduncle length, and caudal peduncle height were read using vernier calipers.

[0061] Using the locus information from Example 1 and the method described in Example 2, the genotypes of the SNP loci of 84 golden tiger hybrids were detected for the SNP1, SNP2, and SNP3 molecular markers from Example 1, respectively, to select golden tiger hybrids with superior growth traits, and the association analysis between each SNP molecular marker and growth traits was performed.

[0062] Based on the phenotypic data of 84 golden tiger hybrid spots, nonparametric tests using SPSS software were used to test the normality of the phenotypic data. When the sample size is greater than 50, the Kolmogorov-Smirnov test result is favored. In the nonparametric test results, a p-value greater than or equal to 0.05 indicates that the data follows a normal distribution.

[0063] Table 2. Normal distribution test results of growth trait data of golden tiger hybrids.

[0064] The results in Table 2 show that the weight, body length, head length, and caudal peduncle height of the golden tiger hybrid do not follow a normal distribution, while the total length, body height, and caudal peduncle length follow a normal distribution.

[0065] Genetic diversity information (such as gene frequency and genotype frequency) of SNP loci was calculated using software such as Popgen32, haploview, and vcftools.

[0066] Table 3. Gene frequencies and genotype frequencies of SNP sites with different SNP molecular markers in golden tiger hybrid spots.

[0067] The results in Table 3 show that the golden tiger hybrid spots exhibited the presence of TT homozygous, TC heterozygous, and CC homozygous genotypes at the SNP1 molecular marker, but the frequency of the CC homozygous genotype was low; the golden tiger hybrid spots showed the absence of the TC heterozygous genotype at the SNP2 molecular marker; and the golden tiger hybrid spots showed the absence of the TT homozygous genotype at the SNP3 molecular marker.

[0068] Using SPSS statistical analysis software, analysis of variance and multiple comparisons were performed on the genotypes of SNP1, SNP2, and SNP3 molecular markers in Example 1. For phenotypic data following a normal distribution, analysis of variance and LSD multiple comparisons were used; for phenotypic data not following a normal distribution, the Kruskal-Wallis nonparametric rank-sum test and Nemenyi nonparametric multiple comparisons were used. In the evaluation results, the significance of phenotypic differences among the genotypes of each SNP molecular marker was determined by the p-value; a p-value less than or equal to 0.05 indicated significant phenotypic differences between different genotypes.

[0069] Table 4. Differences in growth traits between SNP1 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)

[0070] Note: Letters in the same row indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes.

[0071] The results in Table 4 show that the golden tiger hybrid individuals with the TT genotype at the SNP1 locus had significantly higher growth traits in weight, body length, body height, and head length than those with the CC and / or CT genotypes.

[0072] Table 5. Differences in growth traits between SNP2 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)

[0073] Note: Letters in the same line indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes; " / " indicates that no difference was detected.

[0074] The results in Table 5 show that the golden tiger hybrid individuals with the CC genotype at the SNP2 locus had significantly higher growth traits in terms of body weight, total length, body height, head length, and caudal peduncle height than those with the TT genotype.

[0075] Table 6. Differences in growth traits between SNP3 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)

[0076] Note: Letters in the same line indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes; " / " indicates that no difference was detected.

[0077] The results in Table 6 show that the golden tiger hybrid individuals with the CT genotype at the SNP3 locus had significantly higher growth traits in weight, total length, body length, body height, and head length than those with the CC genotype.

[0078] In summary, this invention utilizes three SNP loci that are significantly associated with the growth of golden tiger hybrid spots to provide molecular markers for the selection of superior individuals with golden tiger hybrid spots. This invention can be used alone or in combination by detecting the genotypes of SNP1 to SNP3 loci, thereby improving the accuracy of detecting and screening superior individuals with golden tiger hybrid spots.

[0079] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the growth traits of golden tiger hybrid spots, characterized in that, The SNP molecular markers include one or more of SNP1, SNP2, and SNP3; The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and the SNP site of SNP1 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.1 is T or C. The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and the SNP site of SNP2 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.2 is T or C; The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and the SNP site of SNP3 is the 101st base in the nucleotide sequence shown in SEQ ID NO.3, which is C or T.

2. The application of a substance for detecting the SNP molecular marker as described in claim 1 in the selection of golden tiger hybrids with excellent growth traits.

3. The application according to claim 2, characterized in that, The substance comprises one or more of the primer pairs for amplifying SNP1, SNP2, and SNP3 as described in claim 1, or the substance comprises one or more of the probes for detecting SNP1, SNP2, and SNP3 as described in claim 1.

4. The application according to claim 3, characterized in that, The nucleotide sequences of the primer pairs for amplifying SNP1 are shown in SEQ ID NO.4~SEQ ID NO.5; the nucleotide sequences of the primer pairs for amplifying SNP2 are shown in SEQ ID NO.6~SEQ ID NO.7; and the nucleotide sequences of the primer pairs for amplifying SNP3 are shown in SEQ ID NO.8~SEQ ID NO.

9.

5. The application according to claim 2, characterized in that, The desirable growth traits include one or more of the following: body weight, total length, body length, body height, head length, and caudal peduncle height.

6. A method for breeding golden tiger hybrids with superior growth traits, characterized in that, Includes the following steps: (1) Extract genomic DNA from the hybrid spot tissue of the golden tiger; (2) The genomic DNA is digested with enzymes, the enzyme ends are repaired, adenine is added to the 3' end, the adapter is treated and purified with magnetic beads to obtain the purified product. One or more of the probes described in claim 3 are used to hybridize with the purified DNA to obtain a capture DNA library. The capture DNA library is then subjected to high-throughput sequencing. Alternatively, one or more of the primer pairs for SNP1, SNP2, and SNP3 described in claim 3 or 4 can be used to perform PCR amplification with genomic DNA as a template to obtain one or more of the PCR amplification products for SNP1, SNP2, and SNP3 described in claim 1, and the PCR amplification products can be sequenced. (3) Based on the sequencing results, determine the genotype of one or more SNP loci in SNP1~SNP3 of the golden tiger hybrid individuals, and determine the golden tiger hybrids with excellent growth traits through genotype analysis.

7. The method according to claim 6, characterized in that, The tissue in question is caudal fin tissue.

8. The method according to claim 6, characterized in that, When the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits; the excellent growth traits are one or more of weight, body length, body height and head length.

9. The method according to claim 6, characterized in that, When the genotype of the SNP locus of the SNP2 is CC, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height.

10. The method according to claim 6, characterized in that, When the genotype of the SNP locus of the SNP3 is CT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits; the excellent growth traits are one or more of weight, total length, body length, body height and head length.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker related to growth traits of fir-tiger hybrid spots and application

    CN116837117A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of fir and tiger hybrid spots and application of SNP molecular marker

    CN119193867A

  • Composition for identifying epinephelus fuscoguttatus, epinephelus coioides and hybrid filial generation of epinephelus fuscoguttatus and application of composition

    CN121160888A

  • Growth-related SNP and application in hybrid grouper (epinephelus fuscoguttatus (female) × epinephelus polyphekadion (MALE))

    NL2037172A