SNP molecular markers related to hybridization spot growth traits of jinhu and applications
By developing SNP molecular markers related to the growth traits of golden tiger hybrid spots and using genotyping of SNP1, SNP2 and SNP3 loci, the problem of uneven growth traits in golden tiger hybrid spots was solved, enabling early screening and breeding, and improving breeding efficiency and returns.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YAZHOU BAY INNOVATION RESEARCH INSTITUTE HAINAN TROPICAL OCEAN UNIVERSITY
- Filing Date
- 2026-01-12
- Publication Date
- 2026-04-28
AI Technical Summary
The growth traits of golden tiger hybrids are uneven in the offspring population, which leads to potential damage to the aquaculture industry. Existing technologies make it difficult to efficiently screen out slow-growing individuals.
We developed SNP molecular markers associated with the growth traits of golden tiger hybrid spots, including SNP1, SNP2, and SNP3. By detecting the genotype of these SNP loci, we used amplification primer pairs for PCR amplification and high-throughput sequencing to identify golden tiger hybrid spots with superior growth traits.
It enables early identification and screening of slow-growing individuals, improves breeding efficiency, shortens breeding time, and increases breeding profits.
Smart Images

Figure CN121472432B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of SNP molecular marker technology, and particularly relates to an SNP molecular marker and its application related to the growth traits of golden tiger hybrid spots. Background Technology
[0002] The golden grouper, scientifically known as the blue-bodied large-spotted grouper ( Epinephelus tukula The tiger grouper (scientific name: *Hemiberlesia lataniae*) is one of the larger grouper species, possessing excellent growth traits and resistance to adverse conditions, and is often used as a superior parent fish for hybrid grouper. Epinephelus fuscoguttatus The grouper (Pterocarya spp.) is one of the more common and economically valuable grouper species in China. Its flesh is delicious, and it grows relatively quickly, making it a primary parent species in grouper hybridization breeding. The Golden Tiger Hybrid Grouper is an excellent hybrid grouper variety obtained by crossing male Golden Grouper and female Tiger Grouper. It exhibits significant hybrid vigor in traits such as growth, low-temperature tolerance, and low-oxygen tolerance. However, this vigor is not uniformly expressed in the offspring population, which can potentially harm the aquaculture industry.
[0003] Molecular markers are often closely linked to target traits. Their wide availability, reliable results, and resistance to environmental influences make them an important tool for selective breeding. Therefore, screening SNP loci associated with growth phenotypic traits in golden tiger hybrids, developing molecular markers, culling slow-growing individuals, and maximizing breeding efficiency are pressing technical problems that need to be solved. Summary of the Invention
[0004] Therefore, the purpose of this invention is to provide an SNP molecular marker and its application related to the growth traits of golden tiger hybrid spots.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides a SNP molecular marker related to the growth traits of golden tiger hybrid spots, characterized in that the SNP molecular marker includes one or more of SNP1, SNP2 and SNP3;
[0007] The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and the SNP site of SNP1 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.1 is T or C.
[0008] The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and the SNP site of SNP2 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.2 is T or C;
[0009] The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and the SNP site of SNP3 is the 101st base in the nucleotide sequence shown in SEQ ID NO.3, which is C or T.
[0010] This invention provides an application of substances that detect the above-mentioned SNP molecular markers in the selection of hybrid golden tiger variegated plants with excellent growth traits.
[0011] Preferably, the substance includes one or more of the primer pairs for amplifying SNP1, SNP2, and SNP3.
[0012] Preferably, the nucleotide sequences of the primer pairs amplifying SNP1 are shown in SEQ ID NO.4~SEQ ID NO.5; the nucleotide sequences of the primer pairs amplifying SNP2 are shown in SEQ ID NO.6~SEQ ID NO.7; and the nucleotide sequences of the primer pairs amplifying SNP3 are shown in SEQ ID NO.8~SEQ ID NO.9.
[0013] Preferably, the superior growth traits include one or more of the following: body weight, total length, body length, body height, head length, and caudal peduncle height.
[0014] This invention provides a method for breeding golden tiger hybrids with excellent growth traits, comprising the following steps:
[0015] (1) Extract genomic DNA from the hybrid spot tissue of the golden tiger;
[0016] (2) The genomic DNA is digested with enzymes, the enzyme ends are repaired, adenine is added to the 3' end, the adapter is treated and purified with magnetic beads to obtain the purified product. One or more of the above probes are used to hybridize with the purified DNA to obtain the captured DNA library. The captured DNA library is then subjected to high-throughput sequencing.
[0017] Alternatively, one or more of the primer pairs for SNP1, SNP2, and SNP3 mentioned above can be used as a template for PCR amplification with genomic DNA to obtain one or more of the PCR amplification products for SNP1, SNP2, and SNP3, respectively, and the PCR amplification products can be sequenced.
[0018] (3) Based on the sequencing results, determine the genotype of one or more SNP loci in SNP1~SNP3 of the golden tiger hybrid individuals, and determine the golden tiger hybrids with excellent growth traits through genotype analysis.
[0019] Preferably, the tissue is caudal fin tissue.
[0020] Preferably, when the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits; the excellent growth traits are one or more of weight, body length, body height and head length.
[0021] Preferably, the golden tiger hybrid spot with the SNP locus of the SNP2 having the CC genotype is a golden tiger hybrid spot with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height.
[0022] Preferably, the golden tiger hybrid patch with the genotype CT at the SNP locus of SNP3 is a golden tiger hybrid patch with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body length, body height and head length.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] This invention provides a SNP molecular marker and its application related to the growth traits of golden tiger hybrids. By detecting and determining the genotype of the SNP loci of the SNP molecular marker, this invention enables the selection of golden tiger hybrids with superior growth traits, significantly improving breeding efficiency. The application of SNP molecular markers in this invention allows for the identification of early-stage golden tiger hybrid individuals, enabling the early exclusion of slow-growing individuals. This facilitates early selection of golden tiger hybrids, improves their growth performance, shortens the breeding time, and increases breeding profits. Attached Figure Description
[0025] Figure 1 The location of SNP-1 in the money spot genome;
[0026] Figure 2 The location of SNP-2 in the money spot genome;
[0027] Figure 3 The location of SNP-3 in the money spot genome;
[0028] Figure 4 This is a sequencing peak diagram for detecting the SNP1 molecular marker through sequencing.
[0029] Figure 5 This is a sequencing peak diagram for detecting the SNP2 molecular marker through sequencing.
[0030] Figure 6 This is a sequencing peak diagram for detecting the SNP3 molecular marker through sequencing. Detailed Implementation
[0031] This invention provides a SNP molecular marker related to the growth traits of golden tiger hybrid spots, characterized in that the SNP molecular marker includes one or more of SNP1, SNP2 and SNP3;
[0032] The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and the SNP site of SNP1 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.1 is T or C.
[0033] The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and the SNP site of SNP2 is that the base at position 101 in the nucleotide sequence shown in SEQ ID NO.2 is T or C;
[0034] The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and the SNP site of SNP3 is the 101st base in the nucleotide sequence shown in SEQ ID NO.3, which is C or T.
[0035] This invention provides an application of substances that detect the above-mentioned SNP molecular markers in the selection of hybrid golden tiger variegated plants with excellent growth traits.
[0036] In this invention, the substance comprises one or more primer pairs for amplifying SNP1, SNP2, and SNP3. The nucleotide sequences of the primer pairs amplifying SNP1 are shown in SEQ ID NO. 4-SEQ ID NO. 5; the nucleotide sequences of the primer pairs amplifying SNP2 are shown in SEQ ID NO. 6-SEQ ID NO. 7; and the nucleotide sequences of the primer pairs amplifying SNP3 are shown in SEQ ID NO. 8-SEQ ID NO. 9.
[0037] In this invention, the superior growth traits include one or more of body weight, total length, body length, body height, head length, and caudal peduncle height. As a preferred embodiment, when SNP1 is tested, the superior growth trait is one or more of body weight, body length, body height, and head length. When SNP2 is tested, the superior growth trait is one or more of body weight, total length, body height, head length, and caudal peduncle height. When SNP3 is tested, the superior growth trait is one or more of body weight, total length, body length, body height, and head length.
[0038] This invention provides a method for breeding golden tiger hybrids with excellent growth traits, comprising the following steps:
[0039] (1) Extract genomic DNA from the hybrid spot tissue of the golden tiger;
[0040] (2) The genomic DNA is digested with enzymes, the enzyme ends are repaired, adenine is added to the 3' end, the adapter is treated and the magnetic beads are purified to obtain the purified product. One or more of the above probes are used to hybridize with the purified product to obtain the capture DNA library. The capture DNA library is then subjected to high-throughput sequencing.
[0041] Alternatively, one or more of the primer pairs for SNP1, SNP2, and SNP3 mentioned above can be used as a template for PCR amplification with genomic DNA to obtain one or more of the PCR amplification products for SNP1, SNP2, and SNP3, respectively, and the PCR amplification products can be sequenced.
[0042] (3) Based on the sequencing results, determine the genotype of one or more SNP loci in SNP1~SNP3 of the golden tiger hybrid individuals, and determine the golden tiger hybrids with excellent growth traits through genotype analysis.
[0043] In this invention, genomic DNA is extracted from the tissue of a golden tiger hybrid fish, preferably caudal fin tissue. This invention extracts genomic DNA directly from the caudal fin tissue, eliminating the need for the golden tiger hybrid fish to reach a certain weight, and without harming the fish's survival. This invention does not specify a particular method for extracting genomic DNA from the golden tiger hybrid fish tissue; conventional methods in the art can be used, such as using a known DNA extraction kit following the instructions.
[0044] In this invention, the preparation method of the purified product includes: (1) extracting genomic DNA from the golden tiger hybrid spot to obtain genomic DNA; (2) fragmenting the genomic DNA with enzymes, repairing the enzyme ends of the fragmented DNA fragments, and adding A to the 3' end to obtain DNA fragments with A added to the 3' end; (3) adding adapters to the DNA fragments with A added to the 3' end to obtain adapter-added DNA fragments; (4) purifying the adapter-added DNA fragments with magnetic beads, performing PCR, performing library quantification and fragment size analysis to obtain the purified product.
[0045] In this invention, the PCR amplification system comprises: 10 µL of 2×Taq PCR mix (any commercially available Taq polymerase kit for general PCR); 20 ng of genomic DNA; 2 µL of mixed primers (upstream and downstream primer concentrations of 10 pmol / µL each); and deionized water to a total volume of 20 µL. The PCR amplification program is as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 20 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, for 30 cycles; and a final extension at 72 °C for 3 min.
[0046] In this invention, after obtaining the PCR amplification product, the PCR amplification product is sequenced to determine the genotype of one or more SNP loci from SNP1 to SNP3 in the golden tiger hybrid individuals. Genotype analysis is then used to identify golden tiger hybrids with superior growth traits. This invention does not specifically limit the sequencing method; conventional sequencing methods in the art can be used. The method for determining golden tiger hybrids with superior growth traits is as follows: Golden tiger hybrids with the genotype TT at SNP1 are considered to have superior growth traits; the superior growth traits are one or more of body weight, body length, body height, and head length. Golden tiger hybrids with the genotype CC at SNP2 are considered to have superior growth traits; the superior growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height. When the genotype of the SNP locus at SNP3 is CT, the golden tiger hybrid is considered to have superior growth traits; these superior growth traits include one or more of body weight, total length, body length, body height, and head length. This invention, through the detection of the SNP locus genotype of SNP molecular markers, allows for the identification and screening of growth traits in early-stage individuals, thereby selecting individuals with rapid growth potential for breeding. This reduces breeding costs, increases breeding profits, and enables molecular-assisted breeding of golden tiger hybrids.
[0047] In this invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.
[0048] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0049] Example 1
[0050] Based on the whole-genome resequencing results of 202 grouper cultivars, three SNP loci, namely SNP-1, SNP-2, and SNP-3, were identified. Since the Golden Tiger Hybrid Grouper is an excellent hybrid grouper variety obtained by crossing male grouper cultivars and female tiger grouper, this study investigated whether SNP-1, SNP-2, and SNP-3 in the grouper cultivars exhibit the same variation patterns in the Golden Tiger Hybrid Grouper genome. The sequence information of the SNP molecular markers screened in this invention is as follows:
[0051] The nucleotide sequence of the SNP-1 molecular marker is as follows:
[0052] TTATGGACGTGTTCTGGTATAGACACGGTAAATAACTGTTGTTTGGAGAGAAACTTTCTGTAACTCTTTCCTCTTCCCTGAAACCAGCTCAACATTTCCT CGTCGACACATCAGATGAGTTGTTGTGTAGATTTCAAACCTTGGCTCAGAGTTGCACATGTTTACAGATATCGATCGAAACTGTCCAAAGTGGTGACAATA (SEQ ID NO.1), where the underlined bases are SNP sites.
[0053] The nucleotide sequence of the SNP-2 molecular marker is as follows:
[0054] TGTCAAACAGCCGAGGTTGAAGTATGTTACTGTTTAAATGAAGAACTAAACTAACATTGTGTGTGTTTATCAGAAAGACTTGAGAACATGTGGACTTA C AACATGTCTGCCATACCAATTGTCTTTCTGAACTGTCGCACGTAATAGCCAACCCCAACTGACCTCTTGACGAACAGTTTAAGCTAAAGGTTGACTCAAA (SEQ ID NO.2), where the underlined bases are SNP sites.
[0055] The nucleotide sequence of the SNP-3 molecular marker is as follows:
[0056] ACAATATTCTGAATCTGATTCAAGTCATGTAAACAGCATGTTCTGTTTGGATATTCTGAATTAAAAGAGCACTTCCAAGTCTAAGGCCATGGTTCTTTGC C GGAAAATGGTAGATCACCTCCTCTGGGTTGGAAGTGAGTTACGGCCCCACGCGAAGGAGTTCTAGAATCTTAGGGTCTAGTTCACAAGTGGAGGTAAAAT (SEQ ID NO.3), where the underlined bases are SNP sites.
[0057] In the *Symplocos cuspidata* genome, SNP-1 is located in an intron region of the multiple epidermal growth factor-like domains protein 10 (Megf10) gene (see [link to relevant documentation]). Figure 1 ).
[0058] In the genome of *Symplocos cuspidata*, SNP-2 is located upstream of the 5' end of the monocarboxylate transporter 12 gene (Mct12 or Slc16a12) (see [link to relevant documentation]). Figure 2 ).
[0059] In the genome of the money spot, SNP-3 is located downstream of the 3' end of the matrix metalloproteinase-14 (Mmp14) gene (see...). Figure 3 ).
[0060] (1) Sequence comparison of SNP1 associated with growth traits of golden tiger hybrid and SNP-1 associated with money tree hybrid.
[0061] DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 4 (The bases in the box are SNP1 sites).
[0062] Figure 4 The results showed that the SNP sites of SNP1 and SNP-1 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP1, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-1 in the money patch, as shown in SEQ ID NO.1.
[0063] (2) Sequence comparison of SNP2 associated with growth traits of golden tiger hybrid and SNP-2 associated with money tree hybrid.
[0064] DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 5 (The bases in the box are SNP2 sites).
[0065] Figure 5 The results showed that the SNP sites of SNP2 and SNP-2 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP2, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-2 in the money patch, as shown in SEQ ID NO.2.
[0066] (3) Sequence comparison of SNP3 associated with growth traits of golden tiger hybrid and SNP-3 associated with money tree hybrid.
[0067] DNA was extracted from the caudal fin of the golden tiger hybrid and sequenced. The results are shown below. Figure 6 (The bases in the box are SNP3 sites).
[0068] Figure 6The results showed that the SNP sites of SNP3 and SNP-3 were located in the same positions in the money patch and the golden tiger hybrid patch. Sequencing results showed that the sequence of SNP3, which is associated with the growth trait of the golden tiger hybrid patch, is the same as the sequence of SNP-3 in the money patch, as shown in SEQ ID NO.3.
[0069] In summary, the SNP sites of SNP1 to SNP3 mentioned above all show the same variation in the genomes of the money patch and the golden tiger hybrid patch (see Table 1).
[0070] Table 1. Relevant information of three SNP molecular markers in the money patch and golden tiger hybrid spots.
[0071]
[0072] Example 2
[0073] A method for selecting superior growth traits of golden tiger hybrids includes the following steps:
[0074] This method uses the Money Spot 20K liquid chromatography chip to detect any of the SNP1~SNP3 genotypes described in Example 1 of the Golden Tiger hybrid spot. The Money Spot 20K liquid chromatography chip is suitable for large batches of samples (≥30 samples). The product name, Money Spot 20K liquid chromatography chip, was purchased from Huazhi Biotechnology Co., Ltd., with product number CGPS-Money Spot 20K-P1-V1. The specific steps are as follows:
[0075] (1) DNA was extracted from the collected samples (tail fins of golden tiger hybrids) using the magnetic bead method (any commercially available DNA extraction kit is acceptable). The DNA was then detected using a UV spectrophotometer. The required DNA concentration was greater than 10 ng / μL, and the sample purity was between 1.8 and 2.2 for 260 / 280. Integrity was mainly determined by agarose gel electrophoresis (gel concentration: 1%; voltage: 120V; electrophoresis time: 25 min; loading volume: 1 μL). The sample was required to have a clear main band and no obvious degradation.
[0076] (2) The DNA sample was digested with a fragmentation enzyme to repair the enzyme ends and add an A base to the 3' end. The fragment size was detected by agarose gel electrophoresis. The fragment range was between 100 and 500 bp.
[0077] (3) The sequencing adapter and DNA fragment were ligated using T4 ligase, and the ligation product was purified using purification magnetic beads. The size of the purified product was detected by agarose gel electrophoresis, and the fragment range was between 150 and 500 bp.
[0078] (4) The purified product was amplified and enriched, and fragments were screened using purified magnetic beads. The concentration of the fragment-screened product was detected by Qubit fluorescence quantitative PCR, and the fragment size was detected by agarose gel electrophoresis. The library fragments were between 200 and 400 bp.
[0079] (5) Take 200 ng of the constructed library, concentrate the library, add probe (money-spot 20K liquid phase chip) and hybridization reagent, and incubate at 50℃ for 16-24 hours to complete the hybridization reaction. Use capture magnetic beads to capture the target segment, wash the captured product with washing buffer to remove non-specific binding fragments, and then perform a round of PCR amplification. Use purification magnetic beads to purify the amplification product. Use a Qubit fluorescence quantitative PCR instrument to detect the library concentration and agarose gel electrophoresis to detect the fragment size. The library fragments are between 200 and 400 bp. After the concentration and fragment size are qualified, use the MGI high-throughput sequencing platform to sequence the library. The sequencing read length is PE150.
[0080] (6) The raw data after high-throughput sequencing were processed by quality control filtering, and adapter fragments and low-quality reads were removed using FASTP software to obtain high-quality Clean Reads. The obtained Clean Reads were compared with the reference genome using BWA software and the positions were sorted to obtain the sorted BAM file. The BAM file was analyzed for variant sites using GATK software to obtain the base information of the target sites (SNP1~SNP3 in Example 1).
[0081] When the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of weight, body length, body height and head length.
[0082] When the genotype of the SNP locus of SNP2 is CC, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body height, head length and caudal peduncle height.
[0083] When the genotype of the SNP locus of SNP3 is CT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body length, body height and head length.
[0084] Example 3
[0085] Traditional PCR amplification and Sanger sequencing can also be used to detect golden tiger hybrid spots with excellent growth traits. The specific method is as follows:
[0086] (1) Take the tail fin tissue of 84 golden tiger hybrids and extract the genomic DNA of the tail fin of the golden tiger hybrids using an animal tissue genomic DNA extraction kit (any commercial DNA extraction kit is acceptable).
[0087] (2) Design primer pairs for amplifying SNP1, SNP2 and SNP3 as described in Example 1. The nucleotide sequences of the primer pairs are as follows:
[0088] SNP1-F: 5`-CATAAAAAGAGCCGAGCCAC-3` (SEQ ID NO.4);
[0089] SNP1-R: 5`-ATAGATGTTGCTCTCAGCGG-3` (SEQ ID NO.5);
[0090] SNP2-F: 5`-TGAAACAGTGAGACCGGAAC-3` (SEQ ID NO.6);
[0091] SNP2-R: 5`-GATGCCTAAAGCCACCTTAC-3` (SEQ ID NO.7);
[0092] SNP3-F: 5`-TTGTTCTTGACTGGTGGAGG-3` (SEQ ID NO.8);
[0093] SNP3-R: 5`-TAAGGCTCAGCTTCCTCTTC-3` (SEQ ID NO. 9).
[0094] Using primer pairs for amplifying SNP1, SNP2, and SNP3, PCR amplification was performed with the aforementioned caudal fin genomic DNA as templates. The lengths of the PCR amplification products were 380 bp, 379 bp, and 384 bp, respectively.
[0095] The PCR amplification system was as follows: 10 µL of 2×Taq PCR mix (any commercially available Taq polymerase kit for general PCR); 20 ng of genomic DNA; 2 µL of mixed primers (upstream and downstream primer concentrations were 10 pmol / µL); and deionized water was added to bring the total volume to 20 µL.
[0096] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ final extension for 3 min.
[0097] (3) Then, Sanger sequencing was performed on each PCR amplification product to determine the genotype of the SNP locus of each golden tiger hybrid individual.
[0098] When the genotype of the SNP locus of SNP1 is TT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of weight, body length, body height and head length.
[0099] When the genotype of the SNP locus of SNP2 is CC, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body height, head length and caudal peduncle height.
[0100] When the genotype of the SNP locus of SNP3 is CT, the golden tiger hybrid spot is a golden tiger hybrid spot with excellent growth traits, and the excellent growth traits are one or more of body weight, total length, body length, body height and head length.
[0101] Example 4
[0102] Association analysis of SNP molecular markers with growth traits
[0103] Eighty-four golden tiger hybrid individuals living in the same environment and at the same growth stage were selected. Phenotypic data were measured for all 84 individuals, including weight, body length, total length, body height, head length, caudal peduncle length, and caudal peduncle height. Weight was measured using an electronic scale. Measurable data for body length, total length, body height, head length, caudal peduncle length, and caudal peduncle height were read using vernier calipers.
[0104] Using the locus information from Example 1 and the method described in Example 2, the genotypes of the SNP loci of 84 golden tiger hybrids were detected for the SNP1, SNP2, and SNP3 molecular markers from Example 1, respectively, to select golden tiger hybrids with superior growth traits, and the association analysis between each SNP molecular marker and growth traits was performed.
[0105] Based on the phenotypic data of 84 golden tiger hybrid spots, nonparametric tests using SPSS software were used to test the normality of the phenotypic data. When the sample size is greater than 50, the Kolmogorov-Smirnov test result is favored. In the nonparametric test results, a p-value greater than or equal to 0.05 indicates that the data follows a normal distribution.
[0106] Table 2. Normal distribution test results of growth trait data of golden tiger hybrids.
[0107]
[0108] The results in Table 2 show that the weight, body length, head length, and caudal peduncle height of the golden tiger hybrid do not follow a normal distribution, while the total length, body height, and caudal peduncle length follow a normal distribution.
[0109] Genetic diversity information (such as gene frequency and genotype frequency) of SNP loci was calculated using software such as Popgen32, haploview, and vcftools.
[0110] Table 3. Gene frequencies and genotype frequencies of SNP sites with different SNP molecular markers in golden tiger hybrid spots.
[0111]
[0112] The results in Table 3 show that the golden tiger hybrid spots exhibited the presence of TT homozygous, TC heterozygous, and CC homozygous genotypes at the SNP1 molecular marker, but the frequency of the CC homozygous genotype was low; the golden tiger hybrid spots showed the absence of the TC heterozygous genotype at the SNP2 molecular marker; and the golden tiger hybrid spots showed the absence of the TT homozygous genotype at the SNP3 molecular marker.
[0113] Using SPSS statistical analysis software, analysis of variance and multiple comparisons were performed on the genotypes of SNP1, SNP2, and SNP3 molecular markers in Example 1. For phenotypic data following a normal distribution, analysis of variance and LSD multiple comparisons were used; for phenotypic data not following a normal distribution, the Kruskal-Wallis nonparametric rank-sum test and Nemenyi nonparametric multiple comparisons were used. In the evaluation results, the significance of phenotypic differences among the genotypes of each SNP molecular marker was determined by the p-value; a p-value less than or equal to 0.05 indicated significant phenotypic differences between different genotypes.
[0114] Table 4. Differences in growth traits between SNP1 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)
[0115]
[0116] Note: Letters in the same row indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes.
[0117] The results in Table 4 show that the golden tiger hybrid individuals with the TT genotype at the SNP1 locus had significantly higher growth traits in weight, body length, body height, and head length than those with the CC and / or CT genotypes.
[0118] Table 5. Differences in growth traits between SNP2 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)
[0119]
[0120] Note: Letters in the same line indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes; " / " indicates that no difference was detected.
[0121] The results in Table 5 show that the golden tiger hybrid individuals with the CC genotype at the SNP2 locus had significantly higher growth traits in terms of body weight, total length, body height, head length, and caudal peduncle height than those with the TT genotype.
[0122] Table 6. Differences in growth traits between SNP3 locus genotypes and golden tiger hybrid spots (mean ± standard deviation)
[0123]
[0124] Note: Letters in the same line indicate significant differences (p<0.05); the numbers in parentheses are the sample sizes; " / " indicates that no difference was detected.
[0125] The results in Table 6 show that the golden tiger hybrid individuals with the CT genotype at the SNP3 locus had significantly higher growth traits in weight, total length, body length, body height, and head length than those with the CC genotype.
[0126] In summary, this invention utilizes three SNP loci that are significantly associated with the growth of golden tiger hybrid spots to provide molecular markers for the selection of superior individuals with golden tiger hybrid spots. This invention can be used alone or in combination by detecting the genotypes of SNP1 to SNP3 loci, thereby improving the accuracy of detecting and screening superior individuals with golden tiger hybrid spots.
[0127] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker associated with the growth traits of golden tiger hybrid spots, characterized in that, The SNP molecular marker is one or more of SNP1, SNP2, and SNP3; The nucleotide sequence of the SNP1 molecular marker is shown in SEQ ID NO.1, where the base at position 101 of SEQ ID NO.1 is either T or C; The nucleotide sequence of the SNP2 molecular marker is shown in SEQ ID NO.2, where the base at position 101 of SEQ ID NO.2 is either T or C; The nucleotide sequence of the SNP3 molecular marker is shown in SEQ ID NO.3, where the base at position 101 of SEQ ID NO.3 is C or T; The growth traits of SNP1 are one or more of the following: body weight, body length, body height, and head length. The growth traits of SNP2 are one or more of the following: body weight, total length, body height, head length, and caudal peduncle height. The growth traits of SNP3 are one or more of the following: body weight, total length, body length, body height, and head length.
2. The application of a substance for detecting the SNP molecular marker described in claim 1 in the selection of hybrid golden tiger variegated ... When the SNP1 genotype is TT, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, body length, body height and head length; When the SNP2 genotype is CC, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height. When the SNP3 genotype is CT, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body length, body height and head length.
3. The application according to claim 2, characterized in that, The substance comprises one or more of the primer pairs for amplifying SNP1, SNP2, and SNP3 as described in claim 1, or the substance comprises one or more of the probes for detecting SNP1, SNP2, and SNP3 as described in claim 1.
4. The application according to claim 3, characterized in that, The nucleotide sequences of the primer pairs for amplifying SNP1 are shown in SEQ ID NO.4~SEQ ID NO.5; the nucleotide sequences of the primer pairs for amplifying SNP2 are shown in SEQ ID NO.6~SEQ ID NO.7; and the nucleotide sequences of the primer pairs for amplifying SNP3 are shown in SEQ ID NO.8~SEQ ID NO.
9.
5. A method for breeding golden tiger hybrids with superior growth traits, characterized in that, Includes the following steps: (1) Extract genomic DNA from the hybrid spot tissue of the golden tiger; (2) The genomic DNA is digested with enzymes, the enzyme ends are repaired, adenine is added to the 3' end, the adapter is treated and purified with magnetic beads to obtain the purified product. One or more of the probes for detecting SNP1, SNP2 and SNP3 described in claim 1 are hybridized with the purified DNA to obtain a captured DNA library. The captured DNA library is then subjected to high-throughput sequencing. Alternatively, one or more of the primer pairs for SNP1, SNP2, and SNP3 described in claim 1 can be used to perform PCR amplification with genomic DNA as a template to obtain one or more of the PCR amplification products of SNP1, SNP2, and SNP3 described in claim 1, and the PCR amplification products can be sequenced. (3) Based on the sequencing results, determine the genotype of one or more SNP loci among SNP1, SNP2 and SNP3 in the golden tiger hybrid individuals, and determine the golden tiger hybrids with excellent growth traits through genotype analysis. When the SNP1 genotype is TT, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, body length, body height and head length; When the SNP2 genotype is CC, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body height, head length, and caudal peduncle height. When the SNP3 genotype is CT, the golden tiger hybrid is a golden tiger hybrid with excellent growth traits; the excellent growth traits are one or more of body weight, total length, body length, body height and head length.
6. The method according to claim 5, characterized in that, The tissue in question is caudal fin tissue.
7. The method according to claim 5, characterized in that, The nucleotide sequences of the primer pairs for amplifying SNP1 are shown in SEQ ID NO.4~SEQ ID NO.5; the nucleotide sequences of the primer pairs for amplifying SNP2 are shown in SEQ ID NO.6~SEQ ID NO.7; and the nucleotide sequences of the primer pairs for amplifying SNP3 are shown in SEQ ID NO.8~SEQ ID NO.9.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of fir and tiger hybrid spots and application of SNP molecular marker
CN119193867A
Composition for identifying epinephelus fuscoguttatus, epinephelus coioides and hybrid filial generation of epinephelus fuscoguttatus and application of composition
CN121160888A