Primer for absolute quantitative detection of abundance of biological bacterium BFo1 in Frankliniella occidentalis and detection method

By designing specific primers BFo1-qPCR-F and BFo1-qPCR-R and combining them with real-time PCR technology, we achieved absolute quantitative detection of the abundance of BFo1, a symbiotic bacterium in western flower thrips. This solved the problem of low detection efficiency in existing technologies and improved the accuracy and efficiency of detection.

CN121472437APending Publication Date: 2026-02-06INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511817401.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately detecting the abundance of the microorganism BFo1 in western flower thrips, which affects research on its reproduction and resistance.

Method used

Specific primers BFo1-qPCR-F and BFo1-qPCR-R were designed and combined with real-time PCR technology to achieve absolute quantitative detection of BFo1, a symbiotic bacterium in western flower thrips, by constructing a plasmid standard curve.

Benefits of technology

A rapid and accurate method is provided that can detect the abundance of endosymbiotic bacteria in western flower thrips with only 15 samples, improving detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472437A_ABST
    Figure CN121472437A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of abundance detection of biological bacteria, and discloses a primer for absolute quantitative detection of abundance of biological bacteria BFo1 in Frankliniella occidentalis and a detection method, the primer comprises an upstream primer BFo1-qPCR-F and a downstream primer BFo1-qPCR-R; the nucleotide sequence of the upstream primer BFo1-qPCR-F is shown as SEQ ID No.3, and the nucleotide sequence of the upstream primer BFo1-qPCR-F is specifically ACTTTCAGTGGGGAGGAAGG; the nucleotide sequence of the downstream primer BFo1-qPCR-R is as shown in SEQ ID No.4, and the nucleotide sequence of the downstream primer BFo1-qPCR-R is specifically TGTCAAGGCCAGGTAAGGTT. According to the method, the abundance of the endosymbiotic bacteria can be detected only by 15 samples, and a more convenient, efficient and feasible method for detecting the abundance of the endosymbiotic bacteria of the Frankliniella occidentalis is provided for technicians in the field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological bacteria abundance detection, in particular to a primer and a detection method for absolutely quantitatively detecting the abundance of biological bacteria BFo1 in the body of western flower thrips. BACKGROUND

[0002] Western flower thrips [Frankliniella occidentalis (Pergande)] belongs to Thysanoptera, Thripidae and Frankliniella, and is an invasive pest with important economic significance worldwide. The nymphs and adults of western flower thrips usually hide in the flower or leaf back, pierce and suck the sap of the young parts of plants through the rasp-like mouthparts, causing the leaves to wrinkle and deform. At the same time, it can also transmit a variety of viruses, including tomato spotted wilt virus, embedded spot virus, impatiens necrotic spot virus and maize chlorotic mottle virus, etc. TSWV can cause serious damage to tomatoes, peppers and tobacco and other crops, and its harm cannot be ignored. Western flower thrips has a hidden life habit, and female insects usually lay eggs in the epidermal tissue of plants, and nymphs are mostly concentrated in the flowers of plants. After developing to the pupal stage, they naturally fall into the soil, and then the adult insects emerge. The body length of adult insects is about 2 mm, and the body size of male insects is slightly smaller than that of female insects. Western flower thrips is a haploid-diploid organism, and female adults can produce male haploid offspring through parthenogenesis and female diploid offspring through mating with male adults. The reproduction speed is fast, the egg production is large, the generations overlap seriously, and the field control is extremely difficult. Therefore, it is particularly important to develop a new control method for western flower thrips, and the endosymbiotic bacteria in insects have important functions in the physiology, reproduction and resistance of the host.

[0003] Insects and microorganisms have a certain complex relationship for a long time. Insect symbiotic microorganisms exist on the body surface, in the intestinal tract, blood cavity or cells of insects. In the long-term co-evolution, they co-evolve with the host and establish a long-term interaction relationship. They play an active function in providing nutrition for the host, resisting various external stresses, regulating host resistance, etc. Western flower thrips has two known dominant symbiotic bacteria BFo1 and BFo2 in the body. Removing these two endosymbiotic organisms may lead to a decrease in individual reproduction level and a decrease in population growth. In the previous stage, the laboratory found and isolated the western flower thrips endosymbiotic bacteria BFo1 through metagenomic sequencing and in vitro microbial culture method. To clarify the difference in the abundance of this population in the western flower thrips sensitive strain, it is of important practical significance to provide a method for detecting the abundance of endosymbiotic bacteria in small insects such as western flower thrips. SUMMARY

[0004] In view of this, the present application provides a primer and a detection method for absolutely quantitatively detecting the abundance of biological bacteria BFo1 in western flower thrips, aiming to solve at least one of the problems in the prior art.

[0005] The present application provides a primer for absolutely quantitatively detecting the abundance of biological bacteria BFo1 in western flower thrips, which comprises an upstream primer BFo1-qPCR-F and a downstream primer BFo1-qPCR-R. The nucleotide sequence of the upstream primer BFo1-qPCR-F is shown in SEQ ID No. 3, specifically: ACTTTCAGTGGGGAGGAAGG. The nucleotide sequence of the downstream primer BFo1-qPCR-R is shown in SEQ ID No. 4, specifically: TGTCAAGGCCAGGTAAGGTT.

[0006] The present application also provides a method for absolutely quantitatively detecting the abundance of biological bacteria BFo1 in western flower thrips according to the primer of the above technical solution, comprising the following steps: (1) Extract the total DNA of western flower thrips adults, use the 16S RNA gene sequence of BFo1 as a template, and perform PCR amplification with a cloning primer pair, then connect and transform the amplification product to construct a recombinant plasmid, measure the plasmid concentration and calculate the copy number, and perform 10-fold gradient dilution to obtain a series of concentration plasmid standards; (2) Use the series of concentration plasmid standards as a template, and perform a fluorescence quantitative PCR reaction with a specific primer pair, use the logarithmic value (lgC) of the initial copy number of the plasmid as the abscissa, and the Ct value as the ordinate, construct an lgC-Ct standard curve and obtain a regression equation; (3) Extract the total DNA of the western flower thrips sample to be tested, use it as a template, and perform a fluorescence quantitative PCR reaction with a specific primer pair, calculate the gene copy number of BFo1 in the sample to be tested according to the regression equation of step (2), and realize absolute quantitative detection of the abundance.

[0007] Preferably, the specific primer pair is the upstream primer BFo1-qPCR-F and the downstream primer BFo1-qPCR-R of claim 1.

[0008] Preferably, the cloning primer pair comprises an upstream primer BFo1-F and a downstream primer BFo1-R, the sequence of the upstream primer BFo1-F is shown in SEQ ID No. 1, specifically GGCAGGCCTAACACATG; and the sequence of the downstream primer BFo1-R is shown in SEQ ID No. 2, specifically ACAACACGAGCTGACGACA.

[0009] Preferably, the fluorescent quantitative PCR reaction system is: 2x FastReal qPCR Premix (SYBR Green) 10ul, 10umol / L forward and reverse primers each 1ul, template 1ul, and ddH2O to 20ul.

[0010] Preferably, the fluorescent quantitative PCR reaction program is: 95 DEG C pre-denaturation 2min; 95 DEG C denaturation 5s, 60 DEG C annealing 10s, 72 DEG C extension, a total of 40 cycles.

[0011] Preferably, the sample to be tested in step (3) is a sensitive strain or a resistant strain of adult.

[0012] Preferably, the accession number of the 16S RNA gene sequence of the BFo1 in step (1) is EU029105.1.

[0013] Compared with the prior art, the beneficial effects of the present application are: The present application provides an absolute quantitative method for detecting the endosymbiont of the western flower thrips, which only needs 15 samples to complete the detection of the endosymbiont abundance, and provides a more convenient, efficient and feasible method for detecting the endosymbiont abundance of the western flower thrips for those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0014] Various other advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The accompanying drawings are intended to only illustrate preferred embodiments and are not considered limiting of the present application. Moreover, like reference numerals denote like parts throughout the several views in the drawings. In the drawings: Figure 1 The schematic diagram of the PCR and agarose gel electrophoresis results is shown in the following table. DETAILED DESCRIPTION

[0015] Various exemplary embodiments of the present application will now be described in detail with reference to the drawings. The detailed description is not to be considered to limit the application in any way, but rather to explain certain aspects, features, and embodiments of the application. It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0016] In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range within any stated range or within any stated range of intermediate values is also included in the present application. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0017] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0018] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is intended to include all such modifications and variations in the scope of the present application.

[0019] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” and the like are open-ended terms that are intended to denote the inclusion of elements or steps without excluding other elements or steps.

[0020] The present application provides a primer for absolutely quantitatively detecting the abundance of symbiotic bacteria BFo1 in Frankliniella occidentalis, which comprises an upstream primer BFo1-qPCR-F and a downstream primer BFo1-qPCR-R. The nucleotide sequence of the upstream primer BFo1-qPCR-F is shown in SEQ ID No. 3, specifically: ACTTTCAGTGGGGAGGAAGG. The nucleotide sequence of the downstream primer BFo1-qPCR-R is shown in SEQ ID No. 4, specifically: TGTCAAGGCCAGGTAAGGTT.

[0021] The present application also provides a method for absolutely quantitatively detecting the abundance of symbiotic bacteria BFo1 in Frankliniella occidentalis according to the primer described in the above technical solution, which comprises the following steps: (1) Extract the total DNA of Frankliniella occidentalis adult, use the 16S RNA gene sequence of BFo1 as a template, and perform PCR amplification with cloning primers, then connect and transform the amplification product to construct a recombinant plasmid, measure the plasmid concentration and calculate the copy number, and perform 10-fold gradient dilution to obtain a series of concentrations of plasmid standard products; (2) Use the series of concentrations of plasmid standard products as a template, and perform fluorescence quantitative PCR reaction with specific primers, use the logarithmic value (lgC) of the initial copy number of the plasmid as the abscissa, and the Ct value as the ordinate, construct an lgC-Ct standard curve and obtain a regression equation; (3) extracting total DNA of the sample of the to-be-tested western flower thrips, taking the total DNA as a template, and performing a fluorescent quantitative PCR reaction on the sample by using a specific primer pair, and calculating the gene copy number of BFo1 in the sample to be tested according to the regression equation in step (2), so as to realize absolute quantitative detection of the abundance.

[0022] In the present application, the specific primer pair is the upstream primer BFo1-qPCR-F and the downstream primer BFo1-qPCR-R as claimed in claim 1.

[0023] In the present application, the cloning primer pair comprises an upstream primer BFo1-F and a downstream primer BFo1-R, wherein the sequence of the upstream primer BFo1-F is shown in SEQ ID No. 1, specifically GGCAGGCCTAACACATG; and the sequence of the downstream primer BFo1-R is shown in SEQ ID No. 2, specifically ACAACACGAGCTGACGACA.

[0024] In the present application, the fluorescent quantitative PCR reaction system is as follows: 2x FastReal qPCR Premix (SYBR Green) 10 μL, 10 μmol / L forward and reverse primers each 1 μL, template 1 μL, and ddH2O is added to 20 μL.

[0025] In the present application, the fluorescent quantitative PCR reaction program is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5 s, 60℃ annealing for 10 s, 72℃ extension, a total of 40 cycles.

[0026] In the present application, the to-be-tested western flower thrips sample in step (3) is a sensitive strain or a resistant strain of adult.

[0027] Further preferably, the western flower thrips spinosad sensitive strain (Ivf03) and the resistant near-isogenic line strain (NIL-R) are established by a multi-generation backcross method. The NIL-R is fed with 2.5% spinosad suspension concentrate (SC) (spinosad, American Dow AgroSciences) treated kidney beans, and the current resistance fold to spinosad is 36,000 times. The Ivf03 is fed with fresh kidney beans without contacting any insecticide. The sensitive strain and the resistant strain are bred under the same conditions, with a temperature of 27±1℃, a relative humidity of 65%, and a light cycle of 16L:8D.

[0028] In the present application, the accession number of the 16S RNA gene sequence of BFo1 in step (1) is EU029105.1.

[0029] Example (1) Preparing experimental instruments RNase-free centrifuge tubes, pipettor, gun head, clean bench, Applied Biosystems 7500 fast real-time fluorescence quantitative PCR system (2) Preparation of experimental reagents pEASY-Blunt Cloning Kit, purchased from Beijing Zison Biotechnology Co., Ltd.; Trizol, purchased from Sigma-Aldrich; FastReal qPCR PreMix (SYBR Green) FastReal fast fluorescence quantitative PCR premix reagent (SYBR Green), purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0, purchased from Baodai Biotechnology (Beijing) Co., Ltd. (3) According to the partial sequence of BFo1 16S RNA (accession number: EU029105.1) retrieved from NCBI, PCR primers were designed for cloning the sequence. In addition, three pairs of upstream primers and downstream primers for absolute quantification of BFo1 were designed. After trial and comparison, the specific primers shown in Table 1 were obtained. The primers were synthesized by Shanghaigene Biotechnology Co., Ltd. The cDNA of Frankliniella occidentalis was used as a template for PCR amplification, and agarose gel electrophoresis was performed to detect the specificity of the primers.

[0030] Table 1 Sequence table

[0031] (4) The total DNA of Frankliniella occidentalis adult was extracted, and the BFo1 sequence was amplified. The amplification product was ligated and transformed to construct a plasmid. The concentration of the plasmid standard was measured by NanoDrop 2000c. The constructed plasmid was diluted by ultrapure water at a gradient of 10 times concentration to 5 different concentrations. The RT-qPCR reaction system: 2x FastReal qPCR Premix (SYBR Green) 10 μL, forward and reverse primers (10 μmol / L) 1 μL each, template 1 μL, and ddH2O to 20 μL. Reaction program: 95℃ 2min; 95℃ 5s, 60℃ 10s, 72℃, 40 cycles.

[0032] The logarithmic value (lgC) of the initial copy number of the serially diluted plasmid template was used as the abscissa, and the Ct value of the serially diluted plasmid template amplification was used as the ordinate to establish the lgC-Ct standard curve, and the corresponding regression equation was obtained, which was y=-3.1537x+65.959, and the correlation coefficient was 0.9991.

[0033] (5) Respectively take 15 head sensitive strain and resistant strain of western flower thrips adult, use TaKaRa DNA extraction kit to extract DNA, take it as template, adopt specific primer pair, namely upstream primer BFo1-qPCR-F and downstream primer BFo1-qPCR-R to carry out fluorescence quantitative PCR reaction, according to the above regression equation, the gene copy number of BFo1 in the sample to be measured is calculated, and the absolute quantitative detection of abundance is realized.

[0034] (6) Result analysis The PCR and agarose gel electrophoresis results of the embodiment are as shown in Figure 1 Based on Figure 1 It can be known that the primer for constructing the plasmid and the primer amplification product for absolute quantification all show single and bright bands, and the size is consistent with the expected fragment size, no non-specific band is generated, and it is proved that the designed primer has good specificity.

[0035] The slope value range between-3.0 and-3.6 can meet the requirement of qRT-PCR on amplification efficiency. The slope of the standard curve prepared in the embodiment is-3.1537, which completely meets the test requirement, indicating that the standard curve of the embodiment can be used for abundance detection and analysis of endosymbiont BFo1.

[0036] The abundance of endosymbiont BFo1 in sensitive and resistant strains is successfully detected by the method, the gene copy number Log value of the sensitive strain is 14.4642±0.6937, the gene copy number Log value of the resistant strain is 10.9828±1.6033, and the abundance value of endosymbiont BFo1 in the sensitive strain is higher than that in the resistant strain. The detection result of the embodiment is consistent with the macro-genome sequencing result, and the abundance of endosymbiont BFo1 in the sensitive strain is higher than that in the resistant strain.

[0037] Based on the above, the application provides an absolute quantification method for detecting endosymbiont of western flower thrips, and the abundance detection of endosymbiont can be completed by only 15 samples, which provides a more convenient, efficient and feasible abundance detection method for endosymbiont of western flower thrips for the person skilled in the art.

[0038] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the application but not to limit it, although the application has been described in detail with reference to the above embodiments, the person skilled in the art should understand that the specific embodiments of the application can be modified or replaced equivalently without departing from the spirit and scope of the application, and any modification or equivalent replacement without departing from the spirit and scope of the application should be covered in the protection scope of the claims of the application.

Claims

1. A primer for absolutely quantitatively detecting the abundance of biological bacteria BFo1 in Frankliniella occidentalis, characterized in that, The primers comprise an upstream primer BFo1-qPCR-F and a downstream primer BFo1-qPCR-R. The nucleotide sequence of the upstream primer BFo1-qPCR-F is shown in SEQ ID No. 3, specifically: ACTTTCAGTGGGGAGGAAGG. The nucleotide sequence of the downstream primer BFo1-qPCR-R is shown in SEQ ID No. 4, specifically: TGTCAAGGCCAGGTAAGGTT.

2. The method for detecting the abundance of the symbiotic bacteria BFo1 in the body of Frankliniella occidentalis by absolute quantification of the primer according to claim 1, characterized in that, The method comprises the following steps: (1) Extracting total DNA of the adult western flower thrips, using the 16S RNA gene sequence of BFo1 as a template, performing PCR amplification on the template with a cloning primer pair, connecting and transforming the amplification product to construct a recombinant plasmid, measuring the plasmid concentration and calculating the copy number, and performing 10-fold gradient dilution to obtain a series of concentrations of plasmid standards; (2) Using the plasmid standards of the series of concentrations as templates, performing a fluorescent quantitative PCR reaction with a specific primer pair, taking the logarithmic value (lgC) of the initial copy number of the plasmid as the abscissa and the Ct value as the ordinate, constructing an lgC-Ct standard curve and obtaining a regression equation; (3) Extracting total DNA of a western flower thrips sample to be tested, using the total DNA as a template, performing a fluorescent quantitative PCR reaction with a specific primer pair, calculating the gene copy number of BFo1 in the sample to be tested according to the regression equation in step (2), and realizing absolute quantitative detection of the abundance.

3. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The specific primer pair is the upstream primer BFo1-qPCR-F and the downstream primer BFo1-qPCR-R according to claim 1.

4. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The cloning primer pair comprises an upstream primer BFo1-F and a downstream primer BFo1-R, the sequence of the upstream primer BFo1-F is shown in SEQ ID No. 1, specifically: GGCAGGCCTAACACATG; and the sequence of the downstream primer BFo1-R is shown in SEQ ID No. 2, specifically: ACAACACGAGCTGACGACA.

5. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The fluorescent quantitative PCR reaction system is as follows: 2×FastReal qPCR Premix (SYBR Green) 10 μL, 10 μmol / L forward and reverse primers each 1 μL, template 1 μL, and ddH2O to make up to 20 μL.

6. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The fluorescent quantitative PCR reaction program is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5 s, 60℃ annealing for 10 s, 72℃ extension, a total of 40 cycles.

7. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The sample to be tested in step (3) is an adult of a sensitive strain or a resistant strain.

8. The method for absolute quantification of the symbiotic bacteria BFol abundance in the body of the western flower thrips according to claim 2, characterized in that, The accession number of the 16S RNA gene sequence of BFo1 in step (1) is EU029105.1.

Citation Information

Patent Citations

  • Method for detecting bacteria by amplifying conserved region sequence of 16S rDNA

    CN109554441A

  • Method for detecting FoBMPR1 gene tissue expression quantity

    CN117987563A

  • Pest control system

    US20180195137A1

  • Pest control system

    WO2016198852A1