Primer, detection system, detection method and kit for detecting colletotrichum gloeosporioides on fruits and vegetables based on Cas9
By combining the Cas9 detection method with RPA and CRISPR systems, the problems of long time consumption and low accuracy in traditional Golgi identification are solved, achieving rapid, low-cost detection with high specificity and high sensitivity, suitable for on-site testing.
Patent Information
- Application Number
- CN202511806214.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-06
AI Technical Summary
Traditional methods for identifying the morphology of Colloidal anthrax bacteria are time-consuming and have low accuracy, making it difficult to meet the needs of early rapid diagnosis. Furthermore, PCR-based molecular techniques cannot achieve rapid on-site detection.
By combining recombinase polymerase amplification (RPA) technology with the CRISPR system, primers, detection systems, and kits based on Cas9 were developed. Using RPA forward and reverse primers and sgRNA sequences, combined with dCas9 biotinylated protein, rapid and specific detection of Colloidal anthrax bacteria was achieved.
It can complete rapid testing within 30 minutes, is easy to operate, low in cost, and has high specificity and sensitivity, making it suitable for on-site screening at customs ports and agricultural product markets.
Smart Images

Figure CN121472453A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of detection of Colletotrichum gloeosporioides. Specifically, it is a primer, detection system, detection method and kit for detecting Colletotrichum gloeosporioides on fruits and vegetables based on Cas9. BACKGROUND
[0002] Colletotrichum gloeosporioides is an important pathogenic fungus that harms global agriculture. It has a wide host range and can infect over 200 crops of fruits and vegetables, causing serious economic losses. The infection mechanism of this pathogen is complex, and the latent period is short, posing a serious threat to the yield and quality of fruits and vegetables. Therefore, it is of great significance to establish a rapid and accurate detection technology for the effective prevention and control of this disease.
[0003] Traditional morphological identification methods for this pathogen are time-consuming and low in accuracy, making it difficult to meet the needs of early rapid diagnosis. Although molecular techniques based on PCR (Polymerase Chain Reaction) have improved specificity, they are limited by laboratory equipment and professional operation, and cannot be applied to on-site rapid detection. Therefore, there is an urgent need to develop a rapid and highly sensitive detection method for Colletotrichum gloeosporioides.
[0004] In recent years, the combination of isothermal amplification technology and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system has provided a new path for rapid detection of plant pathogens. Among them, the recombinase polymerase amplification (RPA) technology can realize the rapid amplification of nucleic acids under constant temperature conditions of 37-42℃, greatly reducing the requirements for equipment. By combining RPA with CRISPR system, an integrated detection system can be constructed, which can further increase the detection specificity and achieve high sensitivity and specificity detection of Colletotrichum gloeosporioides. This provides reliable technical support for timely and effective prevention and control of Colletotrichum gloeosporioides, and has important significance for safeguarding agricultural production and food security. SUMMARY
[0005] Therefore, the technical problem to be solved by the present application is to provide a primer, detection system, detection method and kit for detecting Colletotrichum gloeosporioides on fruits and vegetables based on Cas9, in order to solve the problem of long time-consuming and low accuracy of traditional morphological identification methods for Colletotrichum gloeosporioides.
[0006] To solve the above technical problems, the present application provides the following technical solutions:
[0007] Primers for detecting Colletotrichum gloeosporioides on fruits and vegetables based on Cas9 include an RPA forward primer, an RPA reverse primer, and an sgRNA sequence; the nucleotide sequence of the RPA forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the RPA reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the sgRNA sequence is shown in SEQ ID NO.3.
[0008] SEQ ID NO.1: FAM / CCGCCCTGCCCCTGAGCGTACCCCGCCGACA;
[0009] SEQ ID NO.2: ATTTGGCTTAGGAAGACTTACGCACTGGCC;
[0010] SEQ ID NO.3:
[0011] ACTGCTGCTTTTCTGTCTACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.
[0012] The detection system for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 includes an RPA pre-amplification reaction mixture and a CRISPR-dCas9 detection mixture. The RPA pre-amplification reaction mixture contains the RPA forward primer and RPA reverse primer from the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9. The CRISPR-dCas9 detection mixture contains the sgRNA sequence and dCas9 biotinylated protein from the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9.
[0013] The above-mentioned detection system for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 involves the following preparation method for dCas9 biotinylated protein: First, the AviTag coding sequence is fused within the frame with the dCas9 sequence in the pET28a plasmid to construct the pET28a-dCas9-AviTag recombinant plasmid; then, the pET28a-dCas9-AviTag recombinant plasmid and BirA plasmid are co-transformed into *Escherichia coli* BL21(DE3) competent cells; the transformed *E. coli* are inoculated into 2×YT medium and isopropyl-β-D-thiogalactoside is added to induce protein expression, while biotin is added to the medium to complete biotinylation modification; the cultured *E. coli* cells are lysed, and the target protein is separated and purified using the AKTA Pure protein purification system; finally, the obtained target protein is verified by SDS-PAGE and Western blot, and the verified dCas9 biotinylated protein is aliquoted and stored at -80℃.
[0014] The nucleotide sequences of the forward and reverse primers used in the above-mentioned detection system for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively, when amplifying the DNA fragment containing the sgRNA target site. SEQ ID NO.4: CGCCGACATTTTTACCCGAC; SEQ ID NO.5: AGGAAGACTTACGCACTGGC.
[0015] The detection method for *Colletotrichum candida* on fruits and vegetables based on Cas9 includes the following steps:
[0016] Step (1): Prepare the RPA pre-amplification reaction mixture and CRISPR-dCas9 detection mixture in the above detection system for detecting Colchicine spores of Colchicine spores on fruits and vegetables based on Cas9; the RPA pre-amplification reaction mixture contains the RPA forward primer and RPA reverse primer in the above primers for detecting Colchicine spores of Colchicine spores on fruits and vegetables based on Cas9; the CRISPR-dCas9 detection mixture contains the sgRNA sequence and dCas9 biotinylated protein in the above primers for detecting Colchicine spores of Colchicine spores on fruits and vegetables based on Cas9.
[0017] Step (2): Place the CRISPR-dCas9 detection mixture on the cap of the reaction tube;
[0018] Step (3): Place the RPA pre-amplification reaction mixture at the bottom of the reaction tube, and add the DNA template solution and magnesium acetate solution to the reaction tube in sequence. Mix well by pipetting and incubate to complete the RPA pre-amplification.
[0019] Step (4): Invert the reaction tube and continue incubation to allow the dCas9 biotinylated protein to fully react with the sgRNA;
[0020] Step (5): After the reaction is complete, add chromatography buffer to the reaction tube and insert the lateral chromatography test strip; when the control line develops color, remove the test strip and record the test result.
[0021] In the above-mentioned detection method for *Colletotrichum candida* on fruits and vegetables based on Cas9, the preparation method of the RPA pre-amplification reaction mixture in step (1) is as follows: 29.5 μL of rehydration buffer, 28.7 μL of nuclease-free water, and 2.4 μL of 6 μmol / L FAM-labeled RPA forward primer and RPA reverse primer are added to the pre-assembled enzyme preparation of the TwistBasic kit. The enzyme preparation is fully dissolved by pipetting and vortexing.
[0022] In the above-mentioned detection method for detecting Colletotrichum gloeosporioides on fruits and vegetables based on Cas9, the preparation method of CRISPR-dCas9 detection mixture in step (1) is as follows: mix 15 μL of 200 nmol / L dCas9 biotinylated protein, 10 μL of 300 nmol / L sgRNA and 5 μL of NEBuffer 2.1 buffer, and incubate at room temperature for later use.
[0023] In the above-mentioned detection method for *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9, in step (3), the amount of DNA template solution added is 4.5 μL, the concentration of gene copies in the DNA template solution is greater than or equal to 3 gene copies / μL; the amount of magnesium acetate solution added is 2.5 μL, the molar concentration of magnesium acetate solution is 280 mmol / L; the incubation conditions are 37℃ for 25 min.
[0024] In the above-mentioned detection method for detecting Colletotrichum gloeosporioides on fruits and vegetables based on Cas9, the incubation conditions in step (4) are 37°C for 4 min; and in step (5), the chromatography buffer is HybriDetect Milenia chromatography buffer.
[0025] The kit for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9 includes the above-mentioned detection system for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9.
[0026] The technical solution of the present invention achieves the following beneficial technical effects:
[0027] This invention develops primers, a detection system, a detection method, and a kit for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9. The detection method for *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 combines a CRISPR system, RPA technology, and LFA test strips (lateral chromatography test strips). It can complete rapid detection within 30 minutes, is simple to operate, and has low cost. Furthermore, it offers advantages such as high specificity, high sensitivity, speed, and low cost, providing a convenient technical tool for rapid on-site screening of *Colletotrichum gloeosporioides* in scenarios such as customs ports and agricultural product markets. Attached Figure Description
[0028] Figure 1The Cg-tub-6F / R RPA amplification results in this embodiment of the invention; in the figure, M represents DL2000 Marker; 1 is *C. fructicola*; 2 is *C. coccodes*; 3 is *C. truncatum*; 4 is *C. boninense*; 5 is *C. spaethianumthe*; 6 is *C. sojae*; 7 and 8 are *C. gloeosporioides*.
[0029] Figure 2 The activity verification results of sgRNA in the embodiments of this invention, where M represents DL2000 Marker;
[0030] Figure 3 The optimization results of RPA primer concentration in the embodiments of this invention;
[0031] Figure 4 Optimization results of RPA reaction time in the embodiments of this invention;
[0032] Figure 5 Optimization results of bio-dCas9 concentration in the embodiments of this invention;
[0033] Figure 6 Optimization results of the optimal ratio of bio-dCas9 / sgRNA in the embodiments of the present invention;
[0034] Figure 7 The optimization results of CRISPR-dCas9 reaction time in the embodiments of the present invention;
[0035] Figure 8 The sensitivity verification results of the integrated detection system for *Colletotrichum gloeosporioides* in this embodiment of the invention; in the figure, 0.5, 1, 2, 3, 4, 8 and 80 represent the gradient dilution concentrations of genomic DNA, in units of gene copies / μL;
[0036] Figure 9The specificity verification results of the integrated detection system for *C. gloeosporioides* in this embodiment of the invention; in the figure, 1 and 2 are *C. gloeosporioides*; 3 is *C. fructicola*; 4 is *C. coccodes*; 5 is *C. truncatum*; 6 is *C. boningensis*; 7 is *C. spaethianumthe*; 8 is *C. sojae*; 9 is *Fusarium moniliforme*; 10 is *Alteranaria alternata*; 11 is *Botrytis cinerea*.
[0037] Figure 10 The test results of each sample using the integrated detection system for Colletotrichum gloeosporioides in this embodiment of the invention (CK is a blank control). Detailed Implementation
[0038] The materials and reagents involved in this embodiment are as follows: 6 strains of *Colletotrichum gloeosporioides*, 6 other anthracnose complex strains, and 15 other plant pathogenic fungi of various genera. The Magnetic Bead Method Plant Genomic DNA Extraction Kit (DP342), enzyme-free sterile water, and RNase inhibitor (40 U / µL, NG209) were purchased from Tiangen Biotech (Beijing) Co., Ltd.; the Qubit® dsDNA HS Assay Kit was purchased from Thermo Fisher Scientific, USA; the Recombinase Polymerase Amplification (RPA) Kit (TwistAmp® Basic) was purchased from TwistDX, UK; the Lateral Chromatography Test Strip (LFA strip) was purchased from Beijing Lanbolide Trading Co., Ltd.; dCas9 protein, pET28a plasmid, AviTag (short peptide tag), and BirA (biotin ligase) were purchased from Shanghai Jinan Technology Co., Ltd.; and the Guideit™ Complete sgRNA Screening System was purchased from Beijing Liuhetong Economic and Trade Co., Ltd.
[0039] In addition to the biological materials and reagents described above, all other materials and reagents mentioned in this invention can be purchased from commercial channels at home and abroad, and will not be described in detail here.
[0040] 1. Genome extraction
[0041] Genomic DNA was extracted from all tested strains using the Magnetic Bead Plant Genomic DNA Extraction Kit (DP342). DNA concentration was quantified using a Qubit® 2.0 fluorometer and a Qubit® dsDNA HS Assay Kit. DNA samples were stored at -20°C until use.
[0042] 2. Design and screening of RPA primers and sgRNA
[0043] (1) RPA primer design
[0044] The target strain and anthrax complex were analyzed by amplification and sequencing of the β-tubulin gene (TUB). The obtained sequences were compared with the TUB gene sequences of 20 strains of 12 anthrax complexes (including *Colletotrichum gloeosporioides*) in the NCBI database, and sequence analysis was performed using SnapGene and Primer 6 software. Based on the differential sites of the TUB gene between *Colletotrichum gloeosporioides* and other strains, RPA-specific primers were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0045] (2) RPA primer screening
[0046] The designed RPA-specific primers were subjected to RPA amplification to screen primers. Following the instructions of the TwistAmp® Basic kit (TwistDx), each reaction system was 50 µL, containing 29.5 µL TwistAmp rehydration buffer, 8.65 µL enzyme-free sterile water, 2.4 µL (10 µM) each of forward and reverse primers, an appropriate amount of purified DNA template (anthrax DNA), and 2.5 µL magnesium acetate (MgAc). The reaction system was incubated at 37°C for 20 min in a nucleic acid amplification instrument before the RPA reaction. The amplified products were observed by electrophoresis on a 2% agarose gel, and the results are shown below. Figure 1 As shown, the primer pair (forward primer: Cg-tub-6F, reverse primer: Cg-tub-6R) is specific for *Colletotrichum gloeosporioides*. The forward primer of the primer pair was labeled with FAM (Follicular Unit Extraction), which was synthesized by Beijing Qingke Biotechnology Co., Ltd. Specific sequence information is shown in Table 1.
[0047] (3) sgRNA design
[0048] The sgRNA design for the CRISPR-dCas9 detection system uses RPA amplification products containing protospacer adjacent motifs (PAMs) as templates. The specific PAM sequence of the Cas9 protein is NGG. The amplification fragment of the RPA-specific primers (Cg-tub-6F / Cg-tub-6R) is 175 bp. Based on this fragment and the PAM sequence position, the target sequence (ACTGCTGCTTTTCTGTCTAC) was designed. The sgRNA was synthesized by Qingke Biotechnology Co., Ltd. Specific sequence information is shown in Table 1.
[0049] Table 1. RPA amplification primer sequences and sgRNA sequences
[0050]
[0051] 3. Biotinylation of dCas9 protein
[0052] First, the AviTag coding sequence (GLNDIFEAQKIEWHE, 15 amino acids) was fused in-frame with the dCas9 sequence in the pET28a plasmid to construct the pET28a-dCas9-AviTag recombinant plasmid. This plasmid and the BirA plasmid were co-transformed into *E. coli* BL21(DE3) competent cells. Protein expression was induced using 2×YT medium supplemented with isopropyl-β-D-thiogalactoside (IPTG), and biotin was added to the medium to complete biotinylation modification. After cell lysis, the target protein was isolated and purified using the AKTA Pure protein purification system. Finally, the biotinylated dCas9 protein (i.e., bio-dCas9 protein), which passed SDS-PAGE and Western blot validation, was aliquoted and stored at -80℃.
[0053] 4. sgRNA activity verification
[0054] Using the primer pairs C-tub-PCR-F / C-tub-PCR-R listed in Table 2, PCR amplification was performed according to the Guide-it™ sgRNA kit instructions to obtain the target DNA fragment. For the cleavage reaction, sgRNA was pre-incubated with Cas9 nuclease at 37°C for 5 minutes to form a complex. Subsequently, 2 µL of the amplified product was mixed with 1 µL of 15X Cas9 reaction buffer, 1 µL of 15X BSA solution, 9.5 µL of RNase-free water, and 1.5 µL of the aforementioned complex to form a 15 µL reaction system, which was incubated at 37°C for 1 hour. After the reaction, the enzyme was inactivated by heating at 80°C, and RNase was added to degrade the RNA. The cleavage product was verified by 2% agarose gel electrophoresis; the results are shown in the table below. Figure 2 ;from Figure 2As can be seen, when only dCas9 and target DNA are present, or only target DNA is present, the DNA band remains intact. However, when sgRNA, dCas9, and target DNA are present simultaneously, the target DNA band is successfully cleaved.
[0055] Table 2 Sequences of PCR Amplification Primer Pairs
[0056]
[0057] 5. Construction of a one-tube detection system for Colloidal anthrax
[0058] To improve the feasibility of on-site testing of this technology, this embodiment integrates RPA pre-amplification and CRISPR-dCas9 detection into a single reaction tube, avoiding complex steps such as opening the tube. The specific operation procedure is as follows:
[0059] (1) Construction of RPA pre-amplification reaction system
[0060] The RPARPA pre-amplification reaction mixture was prepared using the TwistBasic kit from TwistDX. 29.5 μL of rehydration buffer, 28.7 μL of nuclease-free water, and 2.4 μL of 10 μM FAM-labeled upstream and downstream primers were added to the pre-assembled enzyme preparation provided by the TwistBasic kit. The enzyme preparation was thoroughly dissolved by pipetting and vortexing.
[0061] (2) Preparation of CRISPR-dCas9 detection mixture
[0062] Mix 15 μL of 200 nM bio-dCas9 protein, 10 μL of 300 nM sgRNA with 5 μL of NEBuffer 2.1 buffer, and incubate at room temperature for later use.
[0063] (3) Operation procedure of the one-tube detection system for Colloidal anthrax
[0064] The operation procedure of the one-tube detection system for Colloidal anthrax bacteria constructed in this embodiment includes the following steps:
[0065] Step a: Place the RPA pre-amplification reaction mixture at the bottom of the reaction tube;
[0066] Step b: Place the CRISPR-dCas9 detection mixture on the reaction tube cap;
[0067] Step c: Add 4.5 μL of DNA template to the reaction tube; the concentration of the DNA template is 4.19 × 10⁻⁶. 4 Gene copies / μL;
[0068] Step d: Add 2.5 μL of 280 mM magnesium acetate solution and gently mix by suction and whisking.
[0069] Step e: Incubate at 37℃ for 20 min to complete RPA pre-amplification;
[0070] Step f: After inverting and mixing, continue incubation for 5 min to allow the bio-dCas9 / sgRNA reaction to proceed fully;
[0071] Step g, Lateral chromatography detection: After the reaction is complete, add 80 μL of HybriDetect Milenia chromatography buffer and insert the lateral chromatography test strip directly. Remove the test strip immediately after the control line develops color, record the result within 2 minutes, and take a photograph within 5 minutes.
[0072] 6. Optimization of the one-tube detection system for Colloidal anthrax
[0073] (1) Optimization of RPA primer concentration:
[0074] In the "(1) Construction of RPA Pre-amplification Reaction System", the concentrations of the "2.4 μL FAM-labeled upstream and downstream primers" were set at five gradients: 2 μM, 4 μM, 6 μM, 8 μM, and 10 μM. The optimal reaction concentration was determined by the brightness and clarity of the bands using 2% agarose gel electrophoresis. The results showed that the bands were brightest and clearest when the primer concentration was 6 µM. (See...) Figure 3 .
[0075] (2) RPA reaction time optimization:
[0076] In the "(3) Operation Procedure for the One-Tube Detection System of Colloidal Anthrax", step e) of the incubation time at 37℃ was set to five time points: 5, 10, 15, 20, and 25 min. The amplification effect was observed by gel electrophoresis. The results showed that bright and clear bands were visible after 25 min of reaction. Figure 4 .
[0077] (3) Optimization of bio-dCas9 concentration:
[0078] The concentrations of "15 μL bio-dCas9 protein" added in "(2) Preparation of CRISPR-dCas9 Detection Mixture" were set at seven concentration gradients: 0, 50, 100, 150, 200, 400, and 800 nM. The results showed that a clear and distinct band was visible in the test line when the bio-dCas9 concentration was 200 nM. Figure 5 .
[0079] (4) Optimization of bio-dCas9 / sgRNA:
[0080] The optimal bio-dCas9 / sgRNA mass ratio was optimized by adjusting the concentration of sgRNA in step (2) CRISPR-dCas9 detection mixture preparation, setting six different ratios (0 / 0, 1 / 0.2, 1 / 0.5, 1 / 1, 1 / 2, and 1 / 5). The results showed that a clear and distinct band was visible in the test line when the bio-dCas9 / sgRNA mass ratio was 1:1 (i.e., the sgRNA concentration was 300 nM). Figure 6 .
[0081] (5) Optimization of CRISPR-dCas9 reaction time:
[0082] The incubation time (i.e., the CRISPR / dCas9 detection reaction time) in "Step f" of the "(3) Operation Procedure of the One-Tube Detection System for Colloidal Anthracnose" was set to 0, 1, 2, 4, 5, and 10 min, respectively. The results showed that a clear and distinct band was visible in the test line at a reaction time of 4 min. (See attached table for details.) Figure 7 .
[0083] 7. Application Testing and Evaluation of the One-Tube Detection System for Colloidal Anthrax
[0084] (1) Sensitivity test
[0085] Genomic DNA was serially diluted to seven concentration gradients: 0.5, 1, 2, 3, 4, 8, and 80 gene copies / μL. The sensitivity of the established integrated detection method was validated. Results showed that the limit of detection for this method was 3 gene copies / µL. (See [link to relevant documentation]). Figure 8 .
[0086] (2) Specificity test
[0087] The specificity of this method was tested using DNA from other pathogen species and DNA from tomatoes, bananas, and peppers. The results showed that only *Colletotrichum gloeosporioides* positive bacteria exhibited clear bands at the test line. Figure 9 .
[0088] (3) Actual sample testing
[0089] DNA from tissues of tomatoes, bananas, mangoes, and peppers artificially inoculated with *Colletotrichum gloeosporioides* was analyzed using the established detection method. Results showed that all positive samples exhibited clear bands, while all negative samples failed to show clear bands. Figure 10 .
Claims
1. Primers for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9, characterized in that, It includes an RPA forward primer, an RPA reverse primer, and an sgRNA sequence; the nucleotide sequence of the RPA forward primer is shown in SEQ ID NO.1, the nucleotide sequence of the RPA reverse primer is shown in SEQ ID NO.2, and the nucleotide sequence of the sgRNA sequence is shown in SEQ ID NO.
3.
2. A detection system based on Cas9 for detecting *Colletotrichum candida* on fruits and vegetables, characterized in that, The mixture includes an RPA pre-amplification reaction mixture and a CRISPR-dCas9 detection mixture; the RPA pre-amplification reaction mixture contains the RPA forward primer and the RPA reverse primer in the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 as described in claim 1; the CRISPR-dCas9 detection mixture contains the sgRNA sequence and dCas9 biotinylated protein in the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 as described in claim 1.
3. The detection system for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 2, characterized in that, The preparation method of dCas9 biotinylated protein is as follows: First, the AviTag coding sequence is fused with the dCas9 sequence in the pET28a plasmid to construct the pET28a-dCas9-AviTag recombinant plasmid; then, the pET28a-dCas9-AviTag recombinant plasmid and BirA plasmid are co-transformed into Escherichia coli BL21(DE3) competent cells; the transformed E. coli are inoculated into 2×YT medium and isopropyl-β-D-thiogalactoside is added to induce protein expression, and biotin is added to the medium to complete the biotinylation modification; the cultured E. coli cells are lysed, and the target protein is separated and purified using the AKTA Pure protein purification system; finally, the obtained target protein is verified by SDS-PAGE and Western blot, and the qualified dCas9 biotinylated protein is aliquoted and stored at -80℃.
4. The detection system for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 2, characterized in that, The nucleotide sequences of the forward and reverse primers used to amplify DNA fragments containing sgRNA target sites are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.
5. A method for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9, characterized in that... Includes the following steps: Step (1): Prepare the RPA pre-amplification reaction mixture and CRISPR-dCas9 detection mixture in the detection system for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 as described in claim 2; the RPA pre-amplification reaction mixture contains the RPA forward primer and RPA reverse primer in the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 as described in claim 1; the CRISPR-dCas9 detection mixture contains the sgRNA sequence and dCas9 biotinylated protein in the primers for detecting *Colletotrichum gloeosporioides* on fruits and vegetables based on Cas9 as described in claim 1; Step (2): Place the CRISPR-dCas9 detection mixture on the cap of the reaction tube; Step (3): Place the RPA pre-amplification reaction mixture at the bottom of the reaction tube, and add the DNA template solution and magnesium acetate solution to the reaction tube in sequence. Mix well by pipetting and incubate to complete the RPA pre-amplification. Step (4): Invert the reaction tube and continue incubation to allow the dCas9 biotinylated protein to fully react with the sgRNA; Step (5): After the reaction is complete, add chromatography buffer to the reaction tube and insert the lateral chromatography test strip; when the control line develops color, remove the test strip and record the test result.
6. The detection method for *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 5, characterized in that, In step (1), the preparation method of the RPA pre-amplification reaction mixture is as follows: add 29.5 μL of rehydration buffer, 28.7 μL of nuclease-free water and 2.4 μL of 6 μmol / L FAM-labeled RPA forward primer and RPA reverse primer to the pre-assembled enzyme preparation of the TwistBasic kit, and mix and vortex to fully dissolve the enzyme preparation.
7. The detection method for *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 6, characterized in that, In step (1), the CRISPR-dCas9 detection mixture is prepared as follows: 15 μL of 200 nmol / L dCas9 biotinylated protein, 10 μL of 300 nmol / L sgRNA and 5 μL of NEBuffer 2.1 buffer are mixed and incubated at room temperature for later use.
8. The detection method for *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 7, characterized in that, In step (3), the amount of DNA template solution added is 4.5 μL, and the concentration of gene copies in the DNA template solution is greater than or equal to 3 gene copies / μL; the amount of magnesium acetate solution added is 2.5 μL, and the molar concentration of magnesium acetate solution is 280 mmol / L; the incubation conditions are 37℃ for 25 min.
9. The method for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9 according to claim 8, characterized in that, In step (4), the incubation conditions are 37°C for 4 min; in step (5), the chromatography buffer is HybriDetect Milenia chromatography buffer.
10. A kit for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9, characterized in that... This includes the detection system for detecting *Colletotrichum candida* on fruits and vegetables based on Cas9, as described in any one of claims 2-4.