Application of product for promoting WBP11 gene expression in preparation of medicine for treating or preventing bronchial pulmonary dysplasia

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses application of a product for promoting WBP11 gene expression in preparation of a medicine for treating or preventing bronchial pulmonary dysplasia. The product for promoting WBP11 gene expression promotes proliferation of human primary umbilical vein endothelial cells by promoting WBP11 gene expression, and promotes the tube forming ability of the human primary umbilical vein endothelial cells in bronchial pulmonary dysplasia.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a product for promoting WBP11 application of the product for promoting gene expression in the preparation of a drug for treating or preventing bronchopulmonary dysplasia. BACKGROUND

[0002] Bronchopulmonary dysplasia (BPD) is a common complication in extremely preterm infants, which not only seriously affects the survival rate of preterm infants, but also increases the risk of long-term chronic lung disease. BPD can lead to frequent respiratory infections, neurodevelopmental delay, long-term dependence on oxygen therapy, and limited movement in preterm infants, which can last into school age or even longer. Pulmonary vascular development is one of the important stages of lung development. The formation of pulmonary capillaries and postnatal alveolar formation are a tightly coupled process. While alveolar development is occurring, the pulmonary microvascular network expands synchronously with the alveolar septum to form a barrier for gas exchange. However, early birth and its clinical high-risk factors such as high-concentration oxygen therapy can disrupt this process, not only damaging the development of pulmonary capillaries, leading to a decrease in the number of capillaries, but also causing alveolar development disorders, ultimately reducing the area for gas exchange, leading to bronchopulmonary dysplasia. Currently, there is a lack of effective treatment strategies for BPD. SUMMARY

[0003] To develop a treatment strategy for BPD, the present application provides WBP11 application of the product for promoting gene expression in the preparation of a drug for treating and / or preventing bronchopulmonary dysplasia. WBP11 The product for promoting gene expression promotes WBP11 The expression of the gene promotes the proliferation of human primary umbilical vein endothelial cells HUVEC and the tube formation ability of human primary umbilical vein endothelial cells HUVECs in BPD.

[0004] The present application provides a product for promoting WBP11 application of the product for promoting gene expression in the preparation of a drug for treating or preventing bronchopulmonary dysplasia.

[0005] The product for promoting WBP11 The product for promoting gene expression promotes WBP11 The expression of the gene promotes the proliferation of human primary umbilical vein endothelial cells and the tube formation ability of human primary umbilical vein endothelial cells in BPD.

[0006] Further, the product for promoting WBP11 gene expression comprises WBP11 a plasmid overexpressing the gene or an adenovirus overexpressing the gene as an effective ingredient. WBP11

[0007] Further, the product for promoting WBP11 ​The overexpression plasmid of the gene is obtained by connecting the gene to an adenovirus vector. WBP11 The gene is connected to the adenovirus vector.

[0008] Further, the adenovirus vector is a pDC316-EGFP plasmid.

[0009] Further, WBP11 The step of connecting the gene to the adenovirus vector is as follows: connecting the WBP11 cDNA sequence to the adenovirus vector, transforming to Escherichia coli and screening by antibiotics, picking single clone for expansion culture to extract the plasmid, and obtaining the overexpression plasmid of the gene. WBP11 The overexpression plasmid of the gene.

[0010] Further, the overexpression plasmid of the gene is used for the following steps. WBP11 The adenovirus is obtained by virus packaging. WBP11 The overexpression plasmid of the gene is used for the following steps.

[0011] Further, the virus packaging step is as follows: co-transfecting the overexpression plasmid of the gene and a helper plasmid into 293A cells and collecting the overexpression adenovirus by lysis. WBP11 The overexpression plasmid of the gene is used for the following steps. WBP11 The overexpression adenovirus is obtained.

[0012] Further, the helper plasmid is pBHGloxΔE1,3Cre.

[0013] Further, the function of the drug is as follows: Promoting migration of human umbilical vein endothelial cells; Promoting proliferation of human umbilical vein endothelial cells; Improving tube formation ability of human umbilical vein endothelial cells HUVECs in bronchopulmonary dysplasia.

[0014] Compared with the prior art, the beneficial effects of the present application are as follows: The present application first discovers that the splicing factor WBP11 can be used as a disease treatment target. Further research shows that knocking down WBP11 can significantly inhibit the growth of vascular endothelial cells, and overexpression can have a protective effect on BPD damage. Targeted regulation of the expression of WBP11 gene and / or protein can be used for prevention and treatment of bronchopulmonary dysplasia, and has the prospect of drug development. BRIEF DESCRIPTION OF DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the following embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0016] Figure 1 ForWBP11 GAPDH was used as an internal reference to measure its expression in a bronchopulmonary dysplasia injury model. In the figure, A represents human primary umbilical vein endothelial cells (HUVECs) in an in vitro hyperoxia lung injury cell model. WBP11 The expression status was detected by Western blot analysis. B is in A WBP11 Statistical graph of expression levels; C represents the Western blot results of WBP11 protein expression in lung tissue of C57 / 6J newborn suckling rats, an in vivo animal model of hyperoxia-induced lung injury. D is a statistical graph of WBP11 protein expression in the lung tissue of C57 / 6J newborn suckling mice, an in vivo animal model of hyperoxia-induced lung injury. E is a statistical graph showing the expression level of WBP11 mRNA in the lung tissue of C57 / 6J newborn mice, an animal model of hyperoxia-induced lung injury.

[0017] Figure 2 For target WBP11 The inhibitory effect of siRNA sequences; In the figure, A represents the three siRNAs constructed in Example 1 in human primary umbilical vein endothelial cells (HUVECs). WBP11 The Westren Blot detection plot; B consists of three siRNAs: siWBP11#1, siWBP11#2, and siWBP11#3, which have shown effects on human primary umbilical vein endothelial cells (HUVECs) in [the following context is unclear and likely refers to a specific function or effect]. WBP11 Statistical graph of protein expression inhibition; C represents three siRNAs: siWBP11#1, siWBP11#2, and siWBP11#3, which have shown effects on human primary umbilical vein endothelial cells (HUVECs) in [the following context is missing from the original text]. WBP11 A statistical graph showing the suppression of mRNA levels.

[0018] Figure 3 Map of the adenovirus overexpression plasmid pDC316-EGFP-WBP11 for WBP11.

[0019] Figure 4 Fluorescence image of HUVEC infected with WBP11 adenovirus overexpression plasmid and Westren Blot results of overexpression efficiency detection; In the figure, A is the fluorescence image of HUVEC infected with AV-WBP11 viral fluid; Figure B shows the Westren Blot results of AV-WBP11 viral fluid infection of HUVECs to detect overexpression efficiency.

[0020] Figure 5 For overexpression WBP11Image showing the promotion of HUVEC migration in primary human umbilical vein endothelial cells; In the figure, A represents the overexpression of HUVEC in primary human umbilical vein endothelial cells under normoxic conditions. WBP11 Migration plot of the control group (i.e., the group without WBP11 overexpression); B represents the overexpression of HUVECs in primary human umbilical vein endothelial cells under normoxic conditions. WBP11 Migration graph; C is the migration diagram of the WBP11 knockdown control group (i.e., the non-WBP11 knockdown group) in human primary umbilical vein endothelial cells (HUVECs) under normoxic conditions. D is a migration diagram of human primary umbilical vein endothelial cells (HUVECs) with WBP11 knockdown using siWBP11#3 under normoxic conditions. E represents overexpression in human primary umbilical vein endothelial cells (HUVECs) under hyperoxia conditions. WBP11 Migration plot of the control group (i.e., the group without WBP11 overexpression); F represents the overexpression of HUVECs in primary human umbilical vein endothelial cells under hyperoxia conditions. WBP11 Migration graph; G is the migration diagram of the WBP11 knockdown control group (i.e., the non-WBP11 knockdown group) in human primary umbilical vein endothelial cells (HUVEC) under hyperoxia conditions. H represents the migration map of human primary umbilical vein endothelial cells (HUVECs) under hyperoxia conditions, showing the knockdown of WBP11 using siWBP11#3.

[0021] Figure 6 Figure showing the effect of WBP11 on promoting the proliferation of human primary umbilical vein endothelial cells; In the figure, A represents the overexpression control group (CON) and the overexpression group (CON). WBP11 Group (WBP11-OE) 、 The proliferation fluorescence images of the knockdown control group (NC) and the knockdown WBP11 group (siWBP11#3) in human primary umbilical vein endothelial cells (HUVECs) under normoxic and hyperoxic conditions are shown. In the inset, AH represents the fluorescence of the proliferation marker EdU; IP represents the fluorescence of nuclear DAPI; and QX represents the combined fluorescence of EdU and DAPI.

[0022] B represents the overexpression control group (CON) and the overexpression control group (CON). WBP11 Group (WBP11-OE) 、 Statistical graph showing the proliferation of human primary umbilical vein endothelial cells (HUVECs) in the knockdown control group (NC) and the knockdown WBP11 group (siWBP11#3) under normoxic and hyperoxic conditions.

[0023] Figure 7 A diagram illustrating how WBP11 promotes tubular formation in primary human umbilical vein endothelial cells. In the figure, A represents the overexpression of HUVEC in primary human umbilical vein endothelial cells under normoxic conditions. WBP11 In vitro tube formation diagram of the control group (i.e., the group without WBP11 overexpression); B represents the overexpression of HUVECs in primary human umbilical vein endothelial cells under normoxic conditions. WBP11 extracorporeal tubing diagram C represents the in vitro tube formation diagram of the human primary umbilical vein endothelial cells (HUVECs) with WBP11 knockdown control (i.e., the group without WBP11 knockdown) under normoxic conditions. D is an in vitro tube formation diagram of human primary umbilical vein endothelial cells (HUVECs) with WBP11 knockdown using siWBP11#3 under normoxic conditions. E represents overexpression in human primary umbilical vein endothelial cells (HUVECs) under hyperoxia conditions. WBP11 In vitro tube formation diagram of the control group (i.e., the group without WBP11 overexpression); F represents the overexpression of HUVECs in primary human umbilical vein endothelial cells under hyperoxia conditions. WBP11 extracorporeal tubing diagram ； G is an in vitro tube formation diagram of the human primary umbilical vein endothelial cells (HUVECs) under hyperoxia conditions, representing the control group with WBP11 knockdown (i.e., the group without WBP11 knockdown). H represents the in vitro tube formation of human primary umbilical vein endothelial cells (HUVECs) using siWBP11#3 to knock down WBP11 under hyperoxia conditions. Detailed Implementation

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0025] The source information of the cells and reagents used in this invention is as follows: Human primary umbilical vein endothelial cells (HUVEC), catalog number: CTCC-0804-PC, Zhejiang Meisen Cell Technology Co., Ltd., China.

[0026] HUVEC medium: ECM medium, catalog number: 1001, ScienCell, USA.

[0027] Transfection reagent: jetPRIME ® Product number: 101000046, Polyplus, USA.

[0028] Cell proliferation assay: BeyoClick™ EdU-594 Cell Proliferation Assay Kit, catalog number: C0078S, Beyotime International Co., Ltd., China.

[0029] Cell tube formation capacity test: Corning® Matrigel® basement membrane matrix, catalog number: 356234, Corning Incorporated, USA.

[0030] Example 1: WBP11 Expression in a bronchopulmonary dysplasia injury model 1. Establishment of a hyperoxia-induced human primary umbilical vein endothelial cell (HUVECs) injury model Human primary umbilical vein endothelial cells (HUVECs) in the logarithmic growth phase were harvested, digested, and resuspended, then cultured at 1 × 10⁻⁶ cells per dish. 6 HUVEC cells were seeded at a density of 10 mL in 10 cm cell culture dishes, with 10 mL of complete culture medium added to each dish. Six culture dishes were set up and divided into two groups: a hyperoxia group and a normoxia group. After the HUVEC cells reached 70% confluence, the cells in the hyperoxia group were placed in a tri-gas incubator and cultured under hyperoxia exposure conditions of 85% O2 and 15% N2. The cells in the normoxia group were placed in a regular cell culture incubator and cultured at 37°C and 5% CO2.

[0031] Cells were collected from the hyperoxia group and the normoxia group after culturing for 0h, 24h and 48h, respectively. Total cellular protein was extracted, and the expression of WBP11 was detected by Western blot.

[0032] The results are as follows Figure 1 A and Figure 1 As shown in Figure B, the expression level of WBP11 increased significantly after 24 h and 48 h of hyperoxia exposure.

[0033] 2. Construction of an animal model of hyperoxia-induced lung injury (1) Newborn C57 / 6J mice within 12 hours of birth were randomly divided into an air group and a hyperoxia group, with 6 mice in each group. Newborn mice in the hyperoxia group were placed in an animal hyperoxia incubator with an oxygen concentration of 85% along with their mothers. Sodium lime was placed in the incubator to absorb excess CO2. The temperature inside the incubator was maintained at 25°C and the humidity at 60%. Newborn mice in the air group were fed in standard cages with their mothers and exposed to the same air in the same room. All other conditions were the same as those in the hyperoxia group. The incubator was opened for 30 minutes every 24 hours to add water, feed, and change the bedding. The general growth status and weight of each group of newborn mice were observed and recorded. Mother mice were exchanged with those in the air group to avoid a decrease in the mothers' feeding ability due to oxygen poisoning and to eliminate the influence of mother mice between the two groups. Hyperoxia exposure lasted for 14 days.

[0034] (2) Lung tissue sample collection Mice were anesthetized on ice, the skin on their chest was cut open, the thoracic cavity was opened, and the lungs were flushed with PBS until white after endotracheal intubation. The lungs were then quickly excised, dried, flash-frozen in liquid nitrogen, and stored at 80°C for the extraction of total RNA and total protein. Western blot and Q-PCR were used to detect the expression of WBP11. WBP11 The nucleic acid coding sequence is shown in SEQ ID NO.1. The upstream primer sequence is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3 for Q-PCR detection. The Q-PCR reaction system is shown in Table 1, and the Q-PCR reaction procedure is shown in Table 2.

[0035] SEQ ID NO.1:

[0036] SEQ ID NO.2: CTGCGGGAAACCTTTGAACG; SEQ ID NO. 3: GGAACACCATGTCCCAGGAG.

[0037] Table 1. Q-PCR reaction system Table 2. Q-PCR Amplification Program GAPDH was used as an internal control for Q-PCR detection. Results are as follows: Figure 1 As shown in E. WBP11 Increased expression was observed in both animal and cell models of BPD under hyperoxia exposure, suggesting... WBP11 It may play an important role in BPD.

[0038] Example 2: Suppression WBP11 Gene expression or overexpression WBP11 The influence of genes on the angiogenesis capacity of human primary umbilical vein endothelial cells (HUVECs).

[0039] I. Suppression WBP11 Effects of gene expression on the angiogenic capacity of human primary umbilical vein endothelial cells (HUVECs) 1. Validation using siRNA to knock down WBP11 Three independent pairs of siRNA sequences targeting WBP11 were synthesized artificially, denoted as siWBP11#1, siWBP11#2, and siWBP11#3. The sense strand sequence of siWBP11#1 is shown in SEQ.ID.NO.4, and the antisense strand sequence is shown in SEQ.ID.NO.5; the sense strand sequence of siWBP11#2 is shown in SEQ.ID.NO.6, and the antisense strand sequence is shown in SEQ.ID.NO.7; the sense strand sequence of siWBP11#3 is shown in SEQ.ID.NO.8, and the antisense strand sequence is shown in SEQ.ID.NO.9. The control siRNA is denoted as siNC, and the sense strand sequence of siNC is shown in SEQ.ID.NO.10, and the antisense strand sequence is shown in SEQ.ID.NO.11. The siRNA sequences were synthesized by Heyuan Biotechnology Co., Ltd.

[0040] SEQ.ID.NO.4:GGAAGAGAGAAUUAAAGAAGATT; SEQ.ID.NO.5: UCUUCUUUAAUUCUCUCUUCCTT.

[0041] SEQ.ID.NO.6: GCGAGAUGAAGACAUGUUAUATT; SEQ.ID.NO.7:UAUAACAUGUCUUCAUCUCGCTT.

[0042] SEQ.ID.NO.8: GGAACUGACUCCUCUUCAAGCTT; SEQ.ID.NO.9: GCUUGAAGAGGAGUCAGUUCCTT.

[0043] SEQ.ID.NO.10:UUCUCCGAACGUGUCACGUTT; SEQ.ID.NO.11: ACGUGACACGUUCGGAGAATT.

[0044] (1) Cell seeding: Human primary umbilical vein endothelial cells (HUVECs) in logarithmic growth phase were seeded into plates and cultured in six-well plates. The seeding cell density was controlled at 60%–70%.

[0045] (2) Preparation of transfection complex Preparation of the control group transfection complex: Add 30 nM control siRNA (siNC), 4 μL transfection reagent (jetPRIME), and 200 μL buffer (jetPRIME Buffer) to a 1.5 mL EP tube, vortex for 10 s, and incubate at room temperature for 10 minutes, avoiding the presence of air bubbles. The resulting control group transfection complex is abbreviated as NC.

[0046] Preparation of the transfection complex in the experimental group: Preparation of siWBP11#1 transfection complex: Add 30 nM siWBP11#1, 4 μL of transfection reagent, and 200 μL of buffer to a 1.5 mL EP tube, vortex for 10 s, and incubate at room temperature for 10 minutes, avoiding the presence of air bubbles. The obtained siWBP11#1 transfection complex is abbreviated as siWBP11#1.

[0047] Preparation of siWBP11#2 transfection complex: Add 30 nM siWBP11#2, 4 μL of transfection reagent, and 200 μL of buffer to a 1.5 mL EP tube, vortex for 10 s, and incubate at room temperature for 10 minutes, avoiding the presence of air bubbles. The obtained siWBP11#2 transfection complex is abbreviated as siWBP11#2.

[0048] Preparation of siWBP11#3 transfection complex: Add 30 nM siWBP11#3, 4 μL of transfection reagent, and 200 μL of buffer to a 1.5 mL EP tube, vortex for 10 s, and incubate at room temperature for 10 minutes, avoiding the presence of air bubbles. The obtained siWBP11#3 transfection complex is abbreviated as siWBP11#3.

[0049] (3) Add the prepared transfection complexes to each well of a 6-well plate after 12 h of culture. Add 2 mL of ECM medium to each well, and add 200 μL of each transfection complex. Gently mix in a crosswise direction and place in a standard cell culture incubator. Continue culturing at 37°C and 5% CO2. After 48 h of culture, collect cells and detect their composition using Western blot and Q-PCR. WBP11 Was the price drop successful?

[0050] The results are as follows Figure 2 As shown, siWBP11#1, siWBP11#2, and siWBP11#3 designed in this embodiment of the invention were all successfully knocked down. WBP11 Gene expression. Among them, siWBP11#3 showed the highest knockdown efficiency, achieving over 70% knockdown efficiency at the RNA level and approximately 50% knockdown efficiency at the protein level in HUVECs. Therefore, siWBP11#3 was used for WBP11 knockdown in subsequent examples.

[0051] 0. Overexpression WBP11 The influence of genes on the angiogenesis capacity of human primary umbilical vein endothelial cells (HUVECs).

[0052] (1) The construction process of the adenovirus overexpression plasmid of WBP11 is as follows: The WBP11 cDNA sequence shown in SEQ.ID.NO.12 was artificially synthesized. The double-underlined bold part at the start end of the sequence is the Kozak sequence, and the double-underlined bold part at the end is the FLAG tag sequence.

[0053] SEQ.ID.NO.12:

[0054] Using the WBP11 cDNA sequence shown in SEQ.ID.NO.12 as a template, PCR amplification was performed using the forward primer F shown in SEQ.ID.NO.13 and the reverse primer R shown in SEQ.ID.NO.14. The amplification products were collected to obtain the DNA product of the WBP11 sequence.

[0055] Table 3 PCR amplification primer information Using NEB Nhe I and Hin The PCR amplification products were double-digested with restriction endonucleases of dIII. Following the system in Table 4, the digestion products of WBP11 sequence DNA were recovered after reacting at 37°C for 30 minutes.

[0056] Table 4 Double enzyme digestion system Then, using pDC316-EGFP plasmid as a vector, the same restriction enzyme digestion procedure and system were used to digest the plasmid, and the digestion products of pDC316-EGFP plasmid were recovered. Then, following the system in Table 5 below, the digestion products of WBP11 sequence DNA and pDC316-EGFP plasmid were ligated at 16°C for 1 hour to obtain the ligation product.

[0057] Table 5 Connection System The ligation product was added to DH5α competent cells, and after incubation for half an hour, the cells were transformed using a heat shock method (42°C for 90 seconds). The transformed competent cells were then evenly spread on LB solid medium containing 100 μg / ml ampicillin and cultured overnight at 37°C. Plasmids were extracted from the grown single colonies to obtain the desired product. WBP11 The adenovirus overexpression plasmid pDC316-EGFP-WBP11, its map is as follows Figure 3 As shown. WBP11 Adenovirus overexpression plasmids can also be called WBP11 Gene overexpression plasmids.

[0058] Then, the adenovirus overexpression plasmid pDC316-EGFP-WBP11 of WBP11 and the helper plasmid pBHGloxΔE1,3Cre were given to Heyuan Biotechnology Co., Ltd. for virus packaging.

[0059] The virus packaging process is as follows: 293A cells (in 10cm culture dishes) were co-transfected with 2g of adenovirus overexpression plasmid pDC316-EGFP-WBP11 (containing WBP11) and 10g of helper plasmid pBHGloxΔE1,3Cre. Five days after infection, the supernatant was discarded, the cells were gently washed twice with PBS, resuspended in 0.5mL ddH2O, and transferred to 1.5mL EP tubes. The cells were thoroughly lysed by freeze-thaw cycles at 80℃ and 37℃ four times. The cells were centrifuged at 15000rpm for 25min at room temperature to collect cell debris. A portion of the supernatant (mainly containing the adenovirus stock solution) was used to re-infect 293A cells to amplify the virus. The viral fluid was collected and filtered as described above to obtain a sufficient amount of viral fluid. The remainder was added to a final concentration of 10% glycerol and stored at 80℃.

[0060] An adenovirus capable of overexpressing WBP11 was obtained, designated AV-WBP11 adenovirus. This adenovirus can be used to infect human primary umbilical vein endothelial cells (HUVECs) and overexpress WBP11 intracellularly.

[0061] (2) Cell preparation Human primary umbilical vein endothelial cells (HUVECs) in good growth condition were digested, counted, and added to 6-well plates to reach a density of 2 × 10⁻⁶ cells / well. 5 Cells / well. Incubate overnight at 37°C with 5% CO2 to ensure cell confluence is between 30% and 50% when performing viral infection the next day.

[0062] (3) Viral infection and fluid replacement The culture medium volume for infection in 6-well plates was 1 mL. 1 mL of ECM medium (ScienCell, catalog number: 1001) and 2 μL of AV-WBP11 adenovirus were added to the corresponding wells. Four hours after the addition of AV-WBP11 adenovirus, ECM medium was added to bring the culture volume to 2 mL. Fourteen hours post-infection, the virus-containing medium was aspirated, replaced with fresh ECM medium, and the plates were incubated at 37°C in a 5% CO2 incubator.

[0063] (4) Observe fluorescence and verify efficiency, the method is as follows: Fluorescence was observed under a microscope 48 hours after infection, with an infection efficiency of approximately 80%. Based on the fluorescence images and Westren Blot results, as... Figure 4 As shown, WBP11 protein can be significantly overexpressed at MOI=50. MOI=50 was selected for subsequent experiments.

[0064] III. Knock Down WBP11 and overexpression WBP11 Effects on angiogenesis in BPD 1. Transwell cell migration assay Human primary umbilical vein endothelial cells (HUVECs) were treated with siWBP11#3 for 48 hours to knock down WBP11, and were designated as the siWBP11#3 group; human primary umbilical vein endothelial cells (HUVECs) were treated with AV-WBP11 virus for 48 hours to overexpress WBP11, and were designated as the WBP11-OE group. 1.3 × 10⁻⁶ cells from the siWBP11#3 group and the WBP11-OE group were collected respectively. 4 After resuspending the cells in 200 μL of ECM medium containing 0.5% fetal bovine serum, they were added to the upper chamber of a Transwell for culture. 600 μL of ECM medium containing 5% fetal bovine serum was added to the lower chamber of the Transwell. HUVECs were allowed to migrate for 24 h under normoxic and hyperoxic conditions, respectively. They were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet for 30 min. After staining, the chamber was washed, unmigrated cells were removed with cotton swabs, and photographs were taken. Figure 5 As shown, knockdown of WBP11 inhibits the migration of human primary umbilical vein endothelial cells in BPD; overexpression of WBP11 enhances the migration ability of human primary umbilical vein endothelial cells in BPD, reversing the weakening of cell migration ability caused by BPD.

[0065] 2. EdU detection of proliferation rate HUVECs cells from the siWBP11#3 group and the WBP11-OE group were respectively stored at 5 × 10⁻⁶ cells per well. 4 Cells were seeded into 12-well plates and treated under normoxic and hyperoxic conditions for 24 hours each. Then, EdU (5-ethynyl-2'-deoxyuridine) was added to the culture medium to a final concentration of 10 μM. After incubation for 2 hours, experiments were performed according to the Beyotime EdU detection kit (catalog number: C0078S). The proportion of EdU-positive cells was recorded using a fluorescence microscope. Figure 6 As shown, knockdown of WBP11 inhibited the proliferation of human primary umbilical vein endothelial cells (HUVECs); overexpression of WBP11 promoted the proliferation of human primary umbilical vein endothelial cells (HUVECs).

[0066] 3. Tube formation test, the method is as follows: Human primary umbilical vein endothelial cells (HUVECs) were treated with siWBP11#3 for 48 hours to knock down WBP11, designated as the siWBP11#3 group; human primary umbilical vein endothelial cells (HUVECs) were treated with AV-WBP11 virus for 48 hours to overexpress WBP11, designated as the WBP11-OE group. Matrix gel (catalog number: 356234, Corning) was added to 48-well plates (100 μL / well) and incubated at 37°C for 30 min. HUVECs treated with siWBP11#3 and AV-WBP11 virus were gently pipetted to suspend them in the culture medium. The cell suspension was added to 48-well plates containing matrix gel, resulting in a concentration of 1.5 × 10⁶ cells per well. 4 Cells were incubated at 37°C for 6 hours under normoxic and hyperoxic conditions, respectively, and the formation of tubular structures was observed. Figure 7 The results showed that knocking down WBP11 in the in vitro tube formation experiment could inhibit the tube formation ability of human primary umbilical vein endothelial cells (HUVECs) in BPD, while overexpression of WBP11 could enhance the tube formation ability of human primary umbilical vein endothelial cells (HUVECs) in BPD.

[0067] In vitro experiments have demonstrated that siWBP11#3 can inhibit the angiogenesis of human primary umbilical vein endothelial cells (HUVECs) in multiple ways, including cell migration, proliferation, and tube formation. Meanwhile, AV-WBP11 can enhance the angiogenesis of human primary umbilical vein endothelial cells (HUVECs) in multiple ways, including cell migration, proliferation, and tube formation.

[0068] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Promote WBP11 Application of gene expression products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia.

2. The promoting method according to claim 1 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, Promote WBP11 Gene expression products WBP11 overexpression plasmids or overexpression of genes WBP11 Adenovirus is the active ingredient.

3. The promoting method according to claim 2 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, The WBP11 Gene overexpression plasmids are used to... WBP11 The gene was obtained by ligating it into an adenovirus vector.

4. The promoting method according to claim 3 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, The adenovirus vector is the pDC316-EGFP plasmid.

5. The promoting method according to claim 3 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, WBP11 The steps for ligating the gene into the adenovirus vector are as follows: the WBP11 cDNA sequence is ligated into the adenovirus vector, transformed into E. coli, and after antibiotic selection, single clones are selected for amplification culture to extract plasmids. WBP11 Gene overexpression plasmids.

6. The promoting method according to claim 2 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, overexpression WBP11 Adenovirus from WBP11 Gene overexpression plasmids are obtained through viral packaging.

7. The promoting method according to claim 6 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, The virus packaging step is as follows: ... WBP11 The gene overexpression plasmid and helper plasmid were co-transfected into 293A cells, and the overexpressed gene was collected by lysis. WBP11 Adenovirus.

8. The promoting method according to claim 7 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, The helper plasmid is pBHGloxΔE1,3Cre.

9. The promotion according to claim 1 WBP11 The application of gene-expressed products in the preparation of drugs for the treatment or prevention of bronchopulmonary dysplasia is characterized by, The function of the drug is: Promotes the migration of human umbilical vein endothelial cells; Promotes the proliferation of human umbilical vein endothelial cells; Enhance the tube-forming ability of human umbilical vein endothelial cells (HUVECs) in bronchopulmonary dysplasia.

Images