Monoclonal antibody of West Nile virus non-structural protein NS1 and application thereof

Abstract

The invention discloses a variable region amino acid sequence of a monoclonal antibody of a West Nile virus non-structural protein NS1 and application of the variable region amino acid sequence, and belongs to the technical field of medicines. According to the invention, West Nile virus non-structural protein NS1 expressed by human embryo kidney 293 cells is used as an antigen to immunize a rabbit, B cells capable of being specifically combined with the West Nile virus non-structural protein NS1 are screened from rabbit spleen cells through flow sorting, and a signal peptide and a variable region gene fragment of an antibody are cloned through reverse transcription-polymerase chain reaction; according to the present invention, the non-structural protein NS1 of flaviviridae flaviviridae virus is taken as a template, and is connected with a constant region gene to an expression vector, and after mammalian cell expression and purification, the monoclonal antibody which has high affinity and is not combined with the non-structural protein NS1 of other eight viruses of flaviviridae flaviviridae virus is obtained through enzyme-linked immunosorbent assay; the monoclonal antibody has application value in diagnosis and prevention and treatment of West Nile virus infection.

Description

Technical Field

[0001] This invention relates to the field of biomedical engineering technology. Specifically, this invention provides an amino acid sequence of a monoclonal antibody against the West Nile virus non-structural protein NS1 and its application in the development of immunological diagnostic reagents and preventive drugs against West Nile virus infection. Background Technology

[0002] West Nile virus (WNV) is a single-stranded positive-sense RNA virus, belonging to the genus Flaviviridae in the family Flaviviridae, along with other important pathogens such as yellow fever virus, dengue virus, Zika virus, and Japanese encephalitis virus. West Nile virus is primarily transmitted through mosquito bites (mainly Culex mosquitoes), making it a typical arbovirus. In terms of pathogenicity, West Nile virus infection exhibits high heterogeneity in humans. Approximately 80% of infected individuals are asymptomatic. The remaining 20% ​​or so develop West Nile fever, characterized by flu-like symptoms such as fever, headache, fatigue, muscle pain, and rash, which usually resolves spontaneously within days to weeks. Less than 1% of infected individuals (mainly the elderly and those with weakened immune systems) develop severe invasive neurological diseases such as encephalitis, meningitis, or acute flaccid paralysis. These severe cases can lead to permanent neurological damage or even death, with a mortality rate of approximately 3%-15% among infected individuals. Currently, there are no specific antiviral drugs for this virus; treatment is primarily supportive. Epidemiologically, West Nile virus was first discovered in Uganda in 1937 and has long been prevalent in Africa, Europe, the Middle East, and West Asia. Since its introduction to North America in 1999, it has rapidly spread throughout the continent, becoming a significant public health problem in the region. Outbreaks exhibit distinct seasonality and geographic distribution, occurring most frequently during the summer and autumn months when mosquitoes are most active in temperate regions. Virus transmission relies on the bird-mosquito cycle, and human infection is closely related to mosquito density, viral prevalence in bird hosts, and the level of human outdoor exposure. Besides mosquito-borne transmission, a very small number of cases can be transmitted through organ transplantation, blood transfusions, or mother-to-child transmission.

[0003] West Nile virus nonstructural protein 1 (NS1) antibodies have significant application value in the diagnosis and prevention of yellow fever. The West Nile virus NS1 protein plays a crucial role in infection and pathogenesis: during the viral replication cycle, large amounts of NS1 protein are synthesized and secreted extracellularly into infected cells and enter the patient's bloodstream. It not only promotes viral replication by regulating the host immune response (such as inhibiting the interferon response), but its extracellular form may also directly or indirectly exacerbate vascular endothelial damage and immunopathology. Based on this, specific antibodies against NS1 exhibit multiple application potentials: in diagnosis, since NS1 is present in high concentrations in the blood early in infection, antibodies against it can be used to establish highly sensitive and specific detection methods (such as ELISA, immunochromatographic test strips, etc.) to achieve early and rapid diagnosis. Such detection can not only differentiate between natural infection and vaccination (because vaccines mainly induce antibodies against structural proteins), but also help monitor viral activity and disease progression. In prevention and treatment, NS1 antibodies have dual strategic value. First, as therapeutic antibodies, they can neutralize extracellular NS1 through passive immunization, reducing its mediated pathological damage and potentially providing an adjunctive treatment for severely ill patients. Second, as an important component of vaccine-induced immunity, NS1-based vaccines can induce the body to produce protective antibodies and cellular immunity, not only inhibiting viral replication but also potentially reducing infection-related immunopathological responses, providing a new direction for developing novel, safe, and effective vaccines. Therefore, antibodies targeting the NS1 protein are not only core targets for developing precision diagnostic tools but also an important foundation for designing novel therapeutic drugs and next-generation vaccines, playing a positive role in the whole-chain prevention and control of yellow fever.

[0004] Compared to mouse monoclonal antibodies, rabbit monoclonal antibodies have a series of unique advantages in molecular structure, immune mechanism, and engineering: 1. Broader immune recognition spectrum: Rabbits have a larger B cell pool, enabling the generation of a wider and more diverse antibody spectrum, which is beneficial for recognizing more types of antigenic epitopes; 2. Higher affinity and specificity: Rabbit antibodies mature for affinity through a dual mechanism of high-frequency somatic hypermutation and unique gene conversion, and their complementarity-determining region structure is unique. These characteristics together make them generally exhibit higher affinity and specificity for antigens; 3. Stronger structural stability: Rabbit antibodies contain an additional disulfide bond in the variable region of the heavy chain, and there is also a linking disulfide bond between the variable region and the constant region. This unique disulfide bond network significantly enhances the structural stability of the molecule; 4. Easier humanization: Rabbit monoclonal antibodies are easy to humanize, and several humanized rabbit monoclonal antibody drugs have already been marketed. Summary of the Invention

[0005] This invention uses the West Nile virus non-structural protein NS1 as the target antigen to immunize New Zealand white rabbits, prepare rabbit monoclonal antibodies, and obtain two monoclonal antibodies with independent epitopes and no cross-reactivity with NS1 proteins of other mosquito-borne viruses in the Flaviviridae family and Flavivirus genus.

[0006] Specifically, the monoclonal antibody against the West Nile virus nonstructural protein NS1 provided by the present invention is characterized in that: the amino acid sequence of the antibody includes a variable region of the antibody heavy chain and a variable region of the antibody light chain;

[0007] The amino acid sequence of the variable region of the antibody heavy chain is shown in SEQ ID NO:2;

[0008] The amino acid sequence of the variable region of the antibody light chain is shown in SEQ ID NO:4.

[0009] Furthermore, the monoclonal antibody against the West Nile virus non-structural protein NS1 provided by the present invention is characterized in that:

[0010] Applications of antibodies in the preparation of immunological diagnostic reagents and preventive drugs for West Nile virus infection;

[0011] A diagnostic reagent, characterized in that it contains the aforementioned antibody.

[0012] A preventive or therapeutic drug, characterized in that it contains the aforementioned antibody. Attached Figure Description

[0013] Figure 1 ELISA detection of the binding of monoclonal antibody 6H2B5 to the non-structural protein NS1 of nine viruses in the genus Flaviviridae of the family Flaviviridae.

[0014] Figure 2 Immunofluorescence assays were performed to detect the binding of monoclonal antibody 6H2B5 to HuH7 cells infected with West Nile virus strains NY2000 and W956 (but not to uninfected NC cells). Detailed Implementation

[0015] The implementation of the present invention will be described in detail below with reference to the embodiments and accompanying drawings. The following embodiments are implemented based on the technical solution of the present invention, providing specific implementation methods and operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. All operations involving West Nile virus in this invention are performed in the Biosafety Level 3 Laboratory of the Naval Medical University of the Chinese People's Liberation Army.

[0016] I. Main Experimental Materials

[0017] 1. West Nile virus non-structural protein NS1, amino acid sequence can be found in GenBank: MZ605381.2; Yellow fever virus non-structural protein NS1, specifically the non-structural protein NS1 of the West African wild strain FJYF03 / 2016 yellow fever virus, amino acid sequence can be found in GenBank: KY587416.1; Dengue virus serotypes 1-4 non-structural protein NS1, amino acid sequences can be found in GenBank: MW315195.1, PX492105.1, PP711274.1, PX492106.1 respectively; Zika virus non-structural protein NS1, amino acid sequence can be found in GenBank: MH882546.1; Japanese encephalitis virus non-structural protein NS1, amino acid sequence can be found in GenBank: L48961.1; Tick-borne encephalitis virus non-structural protein NS1, amino acid sequence can be found in GenBank: PQ015165.1. The above-mentioned protein was recombinantly expressed by freestyle 293F cells grown in suspension culture in serum-free medium by the Department of Biomedical Protection, Naval Medical University of the Chinese People's Liberation Army.

[0018] 2. West Nile virus strains NY2000 and W956 were constructed and preserved using reverse genetics technology in the Biosafety Level 3 Laboratory of the Naval Medical University of the Chinese People's Liberation Army.

[0019] II. Experimental Methods and Results

[0020] 1. Preparation and identification process of rabbit monoclonal antibodies

[0021] New Zealand rabbits were immunized with recombinant West Nile virus non-structural protein NS1 combined with complete Freund's adjuvant. 0.2 mg of West Nile virus non-structural protein NS1 was dissolved in phosphate-buffered saline (PBS) to a final volume of 0.5 ml, and then thoroughly emulsified with 0.5 ml of complete Freund's adjuvant. The mixture was administered subcutaneously at multiple sites. Booster immunizations were given at 3, 6, and 9 weeks after the initial immunization, for a total of three times. For booster immunizations, 0.1 mg of West Nile virus non-structural protein NS1 was used, with incomplete Freund's adjuvant administered subcutaneously. Three weeks after each immunization, blood was collected from the marginal ear vein, and IgG antibodies in the rabbit serum were detected using ELISA (method described below). After week 12, rabbits were anesthetized with isoflurane, and blood was collected via cardiac puncture. After the rabbits died, their spleens were harvested, cut into small pieces, ground and filtered on a nylon mesh to prepare a single-cell suspension. Single spleen cells expressing the West Nile virus non-structural protein NS1 IgG antibody were sorted using flow cytometry. These single spleen cells were seeded into 96-well plates and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin. The 96-well plates were placed in a 37°C cell culture incubator with 5% CO2 and saturated humidity for approximately 7-10 days. When the cells covered the bottom of the wells, the presence of West Nile virus non-structural protein NS1 IgG antibody in the cell culture supernatant was detected by ELISA. Total RNA was extracted from antibody-positive cells, and the antibody heavy chain signal peptide and variable region gene (Signal-VH), and light chain signal peptide and variable region gene (Signal-VL) were amplified using reverse transcription polymerase chain reaction. PCR products were recovered by agarose gel electrophoresis and inserted into the pMD18T vector (Takara). After DNA sequencing, the antibody heavy chain Signal-VH was spliced ​​with rabbit IgG1 CH1-CH2-CH3 to form a complete heavy chain gene, and the light chain Signal-VL gene was spliced ​​with the rabbit light chain constant region gene to form a complete antibody light chain gene. The full-length heavy chain and light chain genes were then inserted into the cloning site of the mammalian cell expression vector pcDNA3.4 to construct expression plasmids. The antibody heavy chain and light chain expression plasmids were co-transfected into 293T cells at a 1:2 mass ratio. The presence of West Nile virus non-structural protein NS1 IgG antibodies in the cell culture supernatant was detected by ELISA. The IgG antibody-positive supernatant was used to determine its neutralizing activity using a viral microneutralization assay. If the monoclonal antibody exhibits virus-neutralizing activity, recombinant expression is performed on freestyle 293F cells grown in suspension culture in serum-free medium. Freestyle 293F cells are cultured to 300 ml (1L volume culture flask) until the cell density reaches 1×10⁻⁶ cells / mL. 6At a concentration of / ml, the antibody heavy chain and light chain expression plasmids were co-transfected into freestyle 293F cells using polyethylenimine (PEI) reagent. After culturing the cells for 72 hours, the antibody was purified from the culture supernatant using Staphylococcus aureus Protein A affinity chromatography and then identified by ELISA and immunofluorescence.

[0022] 2. ELISA identification of rabbit anti-West Nile virus non-structural protein NS1 IgG antibody

[0023] The non-structural protein NS1 of nine viruses—West Nile virus, yellow fever virus, dengue virus serotypes 1-4, Zika virus, Japanese encephalitis virus, and tick-borne encephalitis virus—was diluted with 50 mM carbonate coating buffer (pH 9.6) to a concentration of 1 μg / ml. 0.1 ml of the solution, containing 0.1 μg of West Nile virus non-structural protein NS1, was added to each well of an ELISA plate and incubated overnight at 4°C. The next day, the coating buffer was removed, and each well was washed once with 0.2 ml of PBS buffer. Then, 0.2 ml of PBS buffer (blocking buffer, pH 7.4) containing 3% bovine serum albumin, 5% goat serum, and 0.05% Tween 20 was added to each well. After standing at room temperature for 2 hours, the blocking buffer was removed, and the plate was washed with 0.05% Tween 20 solution. Wash wells three times with PBS buffer (washing buffer). Then add 0.1 ml of rabbit spleen cell culture supernatant diluted with blocking buffer, culture supernatant co-transfected with antibody expression plasmid into 293T cells, or monoclonal antibody purified from culture supernatant co-transfected with antibody expression plasmid into freestyle 293F cells. Incubate at room temperature on a horizontal shaker with gentle shaking for 30 minutes. Discard the reaction solution in the wells, wash wells five times with washing buffer, then add horseradish peroxidase-labeled anti-rabbit IgG (H+L) (Thermo Biosciences product) diluted 1:2000 with blocking buffer. Incubate at room temperature on a horizontal shaker with gentle shaking for 30 minutes. Discard the enzyme-labeled antibody dilution in the wells, wash wells five times with washing buffer, and add 0.1 ml of substrate solution containing 5,5'-tetramethylbenzidine (TMB) to each well. Incubate at room temperature in the dark for 5 minutes, then add 2 M sulfuric acid 50. Mix μl of the sample and measure the absorbance at a wavelength of 450 nm using an ELISA reader. The reference wavelength is 630 nm.

[0024] Figure 1The ELISA absorbance values ​​(A450-630) of a monoclonal antibody (6H2B5) identifying the West Nile virus non-structural protein NS1 at different concentrations are shown. Rabbit IgG1 (Cell Signaling) was used as a negative control. The results show that the monoclonal antibody specifically binds to the West Nile virus non-structural protein NS1 and does not bind to the NS1 non-structural proteins of the other eight viruses. The deoxynucleotide sequence of the heavy chain variable region gene of the monoclonal antibody is shown in SEQ ID NO:1, and the amino acid sequence of the antibody heavy chain variable region protein deduced from the gene sequence is shown in SEQ ID NO:2. The deoxynucleotide sequence of the light chain variable region gene is shown in SEQ ID NO:3, and the amino acid sequence of the antibody light chain variable region protein deduced from the gene sequence is shown in SEQ ID NO:4.

[0025] Specifically, SEQ ID NO:1: The deoxynucleotide sequence of the heavy chain signal peptide and variable region of monoclonal antibody 6H2B5 (1-60 are the deoxynucleotide sequence of the signal peptide, 61-441 are the deoxynucleotide sequence of the variable region).

[0026] 1 ATGGAGACTG GGCTGCGCTG GCTTCTCCTG GTCGCTGTGC TCAAAGGTGT CCAGTGTCAG

[0027] 61 TCGGTGGAGG AGTCCGGGGG TCGCCTGGTC ACGCCTGGGA CACCCCTGAC ACTCACCTGC

[0028] 121 ACAGCCTCTG GATTCTCCCT CAGTAGTTAC TACATGAGCT GGGTCCGCCA GGCTCCAGGG

[0029] 181 AAGGGGCTGG AATACATCGG AATCATTAGT AATGGTGGTA TGACATCCTA CGCGAGCTGG

[0030] 241 GCGAGAGGCC GATTCACCAT CTCCAAAGCC TCGTCGACCA CGGTGGATCT GAAAATGACC

[0031] 301 AGTCCGACAA CCGAGGACAC GGCCACCTAT TTCTGTGCCA GAGTAAAAAG TCTCACTGCT

[0032] 361 GGTTATACTG CTTATGGTTA TGGTTCCTAT TACGACGGCA TGGACCTCTG GGGCCCAGGG

[0033] 421 ACCCTCGTCA CCGTCTCTTC A

[0034] SEQ ID NO:2: Amino acid sequence of the heavy chain signal peptide and variable region of monoclonal antibody 6H2B5 (1-20 are amino acid sequences of the signal peptide, 21-147 are amino acid sequences of the variable region).

[0035] 1 METGLRWLLL VAVLKGVQCQ SVEESGGRLV TPGTPLTLTC TASGFSLSSY YMSWVRQAPG

[0036] 61 KGLEYIGIIS NGGMTSYASW ARGRFTISKA SSTTVDLKMT SPTTEDTATY FCARVKSLTA

[0037] 121 GYTAYGYGSY YDGMDLWGPG TLVTVSS

[0038] SEQ ID NO:3: Deoxynucleotide sequence of the light chain signal peptide and variable region of monoclonal antibody 6H2B5 (1-69 are the deoxynucleotide sequence of the signal peptide, 70-396 are the deoxynucleotide sequence of the variable region)

[0039] 1 ATGGACACGA GGGCCCCCAC TCAGCTGCTG GGGCTCCTGC TGCTCTGGCT CCCAGGTGCC

[0040] 61 AGATGTGCCT ATGATATGAC CCAGACTCCA GCCTCTGTGG AGGTAGCTGT GGGAGGCACA

[0041] 121 GTCACCATCA AGTGCCAGGC CAGTGAGAGG ATTTTTAACA ATTTAGCCTG GTATCAGCAG

[0042] 181 AAACCAGGGC AGCCTCCCAA ACTCCTGATC TATCTGGCAT CCAAGCTGGC ATCTGGGGTC

[0043] 241 CCATCGCGAT TCAAAGGCAG TGGATCTGGG ACAGAGTACA CTCTCACCAT TAGCGGCGTG

[0044] 301 GAGTGTGCCG ATGCTGCCAC TTACTACTGT CAAGAGGAGT ATGTTTTGAC CGATGTTGAT

[0045] 361 AATGCTTTCGGCGGAGGGACCGAAGTGGTGGTAAA

[0046] SEQ ID NO:4: Amino acid sequence of the light chain signal peptide and variable region of monoclonal antibody 6H2B5 (1-22 are amino acid sequences of the signal peptide, 23-132 are amino acid sequences of the variable region).

[0047] 1 MDTRAPTQLL GLLLLWLPGA RCAYDMTQTP ASVEVAVGGT VTIKCQASER IFNNLAWYQQ

[0048] 61 KPGQPPKLLI YLASKLASGV PSRFKGSGSG TEYTLTISGV ECADAATYYC QEEYVLTDVD

[0049] 121 NAFGGGTEVV VK

[0050] 2. Immunofluorescence detection of antibody binding to West Nile virus-infected cells

[0051] The cultured human hepatocellular carcinoma cell line Huh7 was passaged and seeded into 96-well plates. The culture medium was DMEM medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin (hereinafter referred to as complete DMEM medium), with 10,000 cells per well. The plates were placed in a cell culture incubator at 37°C with 5% CO2 and saturated humidity. After 12 hours of culture, West Nile virus attenuated vaccine strain 17D or West African wild-type strain FJYF03 / 2016 diluted with the culture medium was added to each well. The multiplicity of infection was 0.1-0.2. The plates were then placed in a cell culture incubator and cultured for another 18 hours. The binding of the antibody to the cells was detected by immunofluorescence. The specific procedure is as follows: Remove the culture medium from the culture plate, add 0.1 ml of methanol to each well, place the culture plate at -20°C for 20 minutes, then remove the plate, remove the methanol, wash each well once with phosphate-buffered saline (PBS), then add 0.1 ml of PBS containing 3% bovine serum albumin (BSA) (hereinafter referred to as 3% BSA-PBS), place on a horizontal shaker, and shake slowly at room temperature for 1 hour. Remove the 3% BSA-PBS from the culture plate, add 0.1 ml of 1% BSA-PBS containing antibody 6H2B5 (primary antibody) (antibody diluted 500 times) to each well, and shake slowly at room temperature for 1 hour. Remove the primary antibody working solution from the culture plate, wash each well 3 times with PBS, then add 0.1 ml of 1% BSA-PBS containing Alexa Fluor 488-labeled anti-human IgG (luciferase antibody diluted 1000 times), and shake slowly at room temperature in the dark for 1 hour. Remove the luciferase antibody working solution from the culture plate, and add 0.1 ml of DAPI nuclear staining solution to each well. Incubate at room temperature in the dark for 10 minutes, gently shaking to remove DAPI nuclear staining solution from the culture plate. Wash each well three times with PBS and take pictures using a cell imaging system (BioTekCytation 5 Imaging Reader).

[0052] The results are as follows Figure 2 As shown, the monoclonal antibody 6H2B5 can bind to Huh7 cells infected with West Nile virus strains NY2000 and W956, but does not bind to uninfected HuH7 cells.

[0053] The above test results indicate that the monoclonal antibody 6H2B5 specifically binds to the West Nile virus non-structural protein NS1, but does not bind to the non-structural protein NS1 of other mosquito-borne viruses in the Flaviviridae family and Flavivirus genus.

[0054] The foregoing has shown and described the main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. A monoclonal antibody targeting the West Nile virus non-structural protein NS1, characterized in that, The amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO:2, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

4.

2. The use of the monoclonal antibody as described in claim 1 in the preparation of immunological diagnostic reagents and preventive drugs for West Nile virus infection.

3. A detection reagent, characterized in that, It contains the antibody as described in claim 1.

4. A preventive or therapeutic drug, characterized in that, It contains the antibody as described in claim 1.

Images