Recombinant engineering strain for biosynthesis of glabridin and construction method and application thereof

By constructing recombinant engineered strains and an in vivo directed evolution system, the problems of resource constraints and high costs in the production of glycyrrhizin have been solved, achieving efficient biosynthesis and low-cost supply, and promoting its widespread application in the fields of medicine, food, and cosmetics.

CN121495821BActive Publication Date: 2026-05-15CHENGDU GECHUN BIOPHARMACEUTICAL CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610040755.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-13
Publication Date
2026-05-15
Estimated Expiration
2046-01-13

AI Technical Summary

Technical Problem

Traditional methods for extracting glycyrrhizin rely on plant-based raw materials, which are limited by resources, have low extraction rates, and are costly, making it difficult to meet the needs of a wide range of applications.

Method used

By constructing recombinant engineered strains, optimizing gene sequences, constructing expression vectors, and combining them with an in vivo directed evolution system, we achieved efficient biosynthesis of glycyrrhizin.

Benefits of technology

It significantly improved the synthesis efficiency of glycyrrhizin, provided a high-purity raw material supply, reduced production costs, and broadened its application areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495821B_ABST
    Figure CN121495821B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant engineering strain for biosynthesis of glabridin and a construction method and application thereof, and belongs to the technical field of synthetic biology and enzyme engineering. The recombinant engineering strain comprises a recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH; wherein the nucleotide sequence of SiTR is shown as SEQ ID NO:1, the nucleotide sequence of SiDR is shown as SEQ ID NO:2, and the nucleotide sequence of PmGDH is shown as SEQ ID NO:3. Through technical means such as optimization of gene sequences, construction of expression vectors and in-vivo directed evolution, the application successfully constructs the recombinant functional strain pTDG- E. coli BL21(DE3) and its evolution strain pTDGm258- E. coli BL21(DE3). The strains can efficiently catalyze the conversion of a substrate into glabridin, and have important industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology and enzyme engineering technology, specifically relating to a recombinant engineered strain for the biosynthesis of glycyrrhizin, its construction method, and its application. Background Technology

[0002] Glabridadin is a compound derived from the legume licorice root (Glycyrrhiza glabra). Glycyrrhiza glabra The isoflavone active ingredients extracted from the roots and stems have the molecular formula C. 20 H 20 O4, with a molecular weight of approximately 324.37, is a white or brown powder, insoluble in water but readily soluble in organic solvents. Based on an isoflavone core, it possesses unique whitening, antioxidant, anti-inflammatory, and antibacterial properties. Glycyrrhizin is found only in *Glycyrrhiza glabra*, primarily distributed in the roots and stems, with a content of approximately 0.1%-0.3% (dry weight) in the dried rhizome, accounting for about 11% of its total flavonoid components. Since only about 100 grams of glycyrrhizin can be extracted from 1000 kg of raw material, the extraction process is complex and costly. Furthermore, this component is sensitive to light and heat and must be stored in a sealed, light-protected environment. Regarding its core efficacy and mechanism, glycyrrhizin exhibits significant whitening effects. It exhibits a 92.11% inhibition rate against mushroom tyrosinase, far exceeding that of α-arbutin, significantly reducing melanin production. It also achieves three-dimensional whitening through "anti-melanin, anti-oxidation, and anti-inflammation" by inhibiting melanin synthesis-related enzymes (such as TRP-1 and TRP-2), scavenging free radicals, and blocking inflammatory signals. Its antioxidant and anti-inflammatory capabilities are also outstanding, with an IC50 value of 23.73 μM for scavenging DPPH free radicals, far exceeding the effect of vitamin C. Within a concentration range of 0.5-20 μmol / L, its ability to inhibit nitric oxide (NO) accumulation surpasses that of dexamethasone, and it can downregulate the expression of pro-inflammatory factors such as TNF-α and IL-6. Simultaneously, it possesses antibacterial activity, with a minimum inhibitory concentration (MIC) as low as 4 μg / mL against Staphylococcus aureus and Enterococcus faecalis, and a MIC of 32 μg / mL against Escherichia coli. Glycyrrhizin has important applications in multiple fields. In the cosmetics industry, as a high-end whitening ingredient, it is widely used in products such as serums, masks, and creams. Its liposome form can enhance transdermal absorption and improve whitening effects. In the pharmaceutical and health product fields, it has cardiovascular protective effects, lowering cholesterol and LDL levels, inhibiting the formation of atherosclerotic plaques; it can also improve diabetic metabolic disorders, inhibit the proliferation of prostate cancer cells, and has neuroprotective potential. However, the production of glycyrrhizin faces many challenges. Traditional extraction relies on plant raw materials, resulting in limited resources, low extraction rates (<0.5% dry weight), and complex purification steps, leading to high costs. Glycyrrhizin, with its multiple effects, has become a focus of interdisciplinary research, but its production bottlenecks urgently need to be overcome to promote wider application. Summary of the Invention

[0003] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a recombinant engineered strain for the biosynthesis of glycyrrhizin, its construction method, and its application. By constructing a specific recombinant engineered strain, high-efficiency biosynthesis of glycyrrhizin can be achieved, providing a new pathway for the supply of raw materials for related pharmaceutical, food, and cosmetic industries.

[0004] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a recombinant engineered strain for biosynthesis of glycyrrhizin is provided, the recombinant engineered strain comprising the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH; wherein, the nucleotide sequence of SiTR is shown in SEQ ID NO:1, the nucleotide sequence of SiDR is shown in SEQ ID NO:2, and the nucleotide sequence of PmGDH is shown in SEQ ID NO:3.

[0005] The method for constructing the recombinant engineered strain for the biosynthesis of glycyrrhizin includes the following steps:

[0006] (1) Synthesize nucleotide sequences such as SiTR, SiDR and PmGDH as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3;

[0007] (2) SiTR was ligated to pRSFDuet-1 plasmid to obtain pRSFDuet-SiTR plasmid;

[0008] (3) Connect SiDR to pRSFDuet-SiTR plasmid to obtain pRSFDuet-SiDR-SiTR plasmid;

[0009] (4) PmGDH was ligated to the pET28a vector to obtain the pET28a-PmGDH plasmid;

[0010] (5) Using pET28a-PmGDH plasmid as a template, T7-PmGDH expression cassette was obtained by PCR amplification, and then assembled with pRSFDuet-SiDR-SiTR plasmid by Gibson Assembly to obtain recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH.

[0011] (6) The recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH was transformed into competent cells to obtain a recombinant engineered strain for the biosynthesis of glycyrrhizin.

[0012] Among them, competent cells are E. coli BL21(DE3), the recombinant engineered strain is pTDG- E. coli BL21(DE3).

[0013] Furthermore, the primer sequences for PCR amplification in step (5) are as follows:

[0014] PmGDH-F: 5'-CGTCATGCGATCGCCAACATGTAACACGATGCGTCCGGCGTAG-3';

[0015] PmGDH-R: 5'-TTATTGCTCAGCGGTGGCAGCAGCTTAGCCACGACCAGCCTG-3'.

[0016] A fusion plasmid for directed evolution of the recombinant engineered strain used for the biosynthesis of glycyrrhizin, the fusion plasmid being pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB, is prepared by fusing T7RNAP with adenine deaminase TadA-8e using the Gibson Assembly method to form the fusion plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB.

[0017] The method for directed evolution of the above-mentioned recombinant engineered strains used for the biosynthesis of glycyrrhizin includes the following steps:

[0018] (1) The fusion plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB and the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH were simultaneously transformed into competent cells to obtain recombinant functional strains.

[0019] (2) The recombinant functional strains were cultured in a medium containing glycyrrhizin intermediate and the mutants with the strongest tolerance to the intermediate were screened out.

[0020] (3) The mutants were cultured and screened, and strains with high content of target product were selected as recombinant strains for directed evolution.

[0021] Among them, competent cells are E. coli DH5α, the recombinant strain of directed evolution is pTDGm258- E. coli DH5α.

[0022] Furthermore, in step (1), the fusion plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB and the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH were simultaneously transformed into competent cells using the heat shock method.

[0023] A recombinant bacterial strain prepared using the directed evolution method described above has been named Recombinant. Escherichia coli ZRG-1 was deposited on September 29, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20252150.

[0024] The application of the above-mentioned recombinant engineered strains and directed-evolution recombinant strains in the synthesis of glycyrrhizin.

[0025] A method for synthesizing glycyrrhizin includes the following steps:

[0026] The recombinant engineered strain or the directed evolution recombinant strain is cultured, and then the strain is induced to express protein. Glucose and glycyrrhizin intermediate are added to the culture medium, and the culture is continued until glycyrrhizin is synthesized.

[0027] Furthermore, protein expression was induced in recombinant engineered strains or directed-evolutionized recombinant strains at 25°C for 20 hours using 0.4 mM isopropyl-β-D-thiogalactoside.

[0028] Further, 50 g / L of glucose and 10 g / L of glycyrrhizin intermediate G5 were added to the culture medium, and then the medium was cultured for 12-48 hours at 25°C and 150 rpm.

[0029] The present invention has the following beneficial effects:

[0030] This invention successfully constructed a recombinant functional strain pTDG- through techniques such as gene sequence optimization, expression vector construction, and directed in vivo evolution. E. coli BL21(DE3) and its evolved strain pTDGm258- E. coli BL21(DE3). These strains can efficiently catalyze the conversion of substrates into glycyrrhizin, which has important industrial application value. Specifically, this invention first optimized the codons and synthesized the daidzein reductases (SiDR and SiTR) of *Slackia isoflavoniconvertens* strain and the glucose 1-dehydrogenase (PmGDH) of *Priestia megaterium* strain, constructing the corresponding expression vector pRSFDuet-SiDR-SiTR-PmGDH (pTDG plasmid for short). Subsequently, through an in vivo directed evolution system, the pTDG plasmid was co-directedly evolved to screen for mutants pTDGm258- that are tolerant to high concentrations of substrates. E. coli BL21(DE3). Functional validation results showed that this evolved strain could convert 35% of the intermediate G5 into glycyrrhizin, significantly improving the synthesis efficiency of glycyrrhizin.

[0031] The efficient whole-cell synthesis method provided by this invention can produce high-purity glycyrrhizin on a large scale, providing sufficient raw material for the research and development and production of related drugs. This will help reduce drug costs and improve drug accessibility. Attached Figure Description

[0032] Figure 1 A schematic diagram of the reaction process for the whole-cell catalytic preparation of glycyrrhizin.

[0033] Figure 2 This is the HPLC high-performance liquid chromatogram of the substrate (intermediate G5).

[0034] Figure 3 This is the mass spectrometry result of the substrate (intermediate G5).

[0035] Figure 4 The 1H NMR spectrum of the substrate (intermediate G5) is shown.

[0036] Figure 5 This is the carbon spectrum of the substrate (intermediate G5).

[0037] Figure 6 pTDGm258- E. coli Mass spectrometry results of BL21(DE3) whole-cell catalytic reaction products.

[0038] Figure 7 pTDGm258- E. coli The hydrogen spectrum of the products of the whole-cell catalytic reaction of BL21(DE3).

[0039] Figure 8 pTDGm258- E. coli Carbon spectrum of BL21(DE3) whole-cell catalytic reaction products.

[0040] Figure 9 pTDGm258- E. coli HPLC high-performance liquid chromatogram of the whole-cell catalytic reaction of BL21(DE3). Detailed Implementation

[0041] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0042] Example 1:

[0043] The main objective of this embodiment is to construct a recombinant engineered strain expressing dihydrogen daidzein reductase SiDR and tetrahydrogen daidzein reductase SiTR. The specific process is as follows:

[0044] I. Construction of the Expression Carrier

[0045] (1) To Slackia isoflavoniconvertens The soybean aglycone reductase (SiTR, GenBank: WP_123220037.1) of the strain was obtained by codon preference optimization of the original amino acid sequence and chemical synthesis by Shanghai Sangon Biotech. The pUC57-SiTR plasmid was then prepared, and the preparation process is as follows:

[0046] The pUC57 plasmid was amplified by PCR using the following primer pairs. After PCR amplification, the backbone pUC57-lined_1 fragment was obtained. This fragment was mixed with the chemically synthesized SiTR gene fragment, and after Gibson Assembly and external sequencing verification, the pUC57-SiTR plasmid was obtained.

[0047] pUC57-Rv_1: 5'-CGACGTCAAATTCAGCCATATGtggtgcactctcagtaca-3', (SEQ ID NO: 17);

[0048] pUC57-Fv_1: 5'-CCATCATCACCACTAACTCGAGagcttggcgtaatcatgg-3', (SEQ ID NO: 18).

[0049] (2) The pUC57-SiTR plasmid was double-digested with NdeI and XhoI, and the SiTR gene fragment was accurately obtained by gel extraction. At the same time, the pRSFDuet-1 plasmid was subjected to the same NdeI / XhoI double digestion to obtain the pRSFDuet-1 backbone. Subsequently, the SiTR gene fragment was ligated to the pRSFDuet-1 backbone using T4 DNA ligase, and the pRSFDuet-SiTR plasmid was successfully constructed.

[0050] (3) To Slackia isoflavoniconvertensThe soybean aglycone reductase (SiDR, GenBank: WP_123220036.1) of the strain was chemically synthesized by Shanghai Sangon Biotech after codon bias optimization of the original amino acid sequence. The SiDR gene sequence was obtained by double digestion with BamHI and HindIII by the chemically synthesized SiDR gene and pUC57 plasmid. After gel recovery, the SiDR gene fragment was ligated to the pRSFDuet-SiTR backbone using T4 DNA ligase. After the positive clones were sent for sequencing to verify their correctness, the pUC57-SiDR plasmid was obtained.

[0051] (4) The pUC57-SiDR plasmid was double-digested with BamHI and HindIII, and the SiDR gene fragment was accurately obtained by gel extraction. At the same time, the pRSFDuet-SiTR plasmid was subjected to the same BamHI / HindIII double digestion to obtain the pRSFDuet-SiTR backbone. Subsequently, the SiDR gene fragment was ligated to the pRSFDuet-SiTR backbone using T4 DNA ligase, and the pRSFDuet-SiDR-SiTR plasmid was successfully constructed.

[0052] (5) Priestia megaterium The glucose 1-dehydrogenase (PmGDH, GenBank: WP_028407571.1) of the strain was obtained by codon bias optimization of the original amino acid sequence and chemical synthesis by Shanghai Sangon Biotech. The pUC57-PmGDH plasmid was then prepared, and the preparation process is as follows:

[0053] The pUC57 plasmid was amplified by PCR using the following primer pairs. After PCR amplification, the backbone pUC57-lined_3 fragment was obtained. This fragment was mixed with the chemically synthesized PmGDH gene fragment, and after Gibson Assembly and external sequencing verification, the pUC57-PmGDH plasmid was obtained.

[0054] pUC57-Rv_3: 5'-CCAGATCTTTGTACATCATATGtggtgcactctcagtaca-3' (SEQ ID NO: 19);

[0055] pUC57-Fv_3: 5'-CTGGTCGTGGCTAAGCGGCCGCagcttggcgtaatcatgg-3' (SEQ ID NO: 20).

[0056] After double digestion of pUC57-PmGDH plasmid with NdeI / NotI, the resulting PmGDH fragment is ligated to pET28a vector (double digested with NdeI / NotI) to obtain pET28a-PmGDH plasmid.

[0057] (6) Using pET28a-PmGDH plasmid as a template, the T7-PmGDH expression cassette was obtained by PCR amplification using primers PmGDH-F (5'-CGTCATGCGATCGCCAACATGTAACACGATGCGTCCGGCGTAG-3', SEQ ID NO:4) and PmGDH-R (5'-TTATTGCTCAGCGGTGGCAGCAGCTTAGCCACGACCAGCCTG-3', SEQ ID NO:5). After linearization by double digestion with XhoI / AvrII, the resulting vector backbone and the T7-PmGDH expression cassette fragment were assembled by Gibson Assembly to obtain the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH expression vector (abbreviated as pTDG plasmid).

[0058] (6) The recombinant plasmid pTDG was transformed into the target plasmid using the heat shock method. E. coli Recombinant functional strain pTDG- was obtained from BL21(DE3) competent cells. E. coli BL21(DE3).

[0059] II. Recombinant functional strain pTDG- E. coli BL21(DE3) Functional Verification

[0060] According to the method described by Kinoshita T et al. in Chem. Pharm. Bull. 2005, 53(7): 847-849 (published on 2005-07-12), from licorice root. Glycyrrhiza glabraIntermediate G5 was isolated and purified from the rhizome of *Glycyrrhiza glabra*. The specific process was as follows: The purchased *Glycyrrhiza glabra* rhizome was dried, pulverized, and repeatedly extracted five times with dichloromethane (DCM). The extracts were combined, and the extract was concentrated using a rotary evaporator to remove the DCM solvent, thus obtaining a dichloromethane extract of *Glycyrrhiza glabra* rhizome. 150 g of the dichloromethane extract of *Glycyrrhiza glabra* rhizome was weighed and separated into eight fractions by silica gel column chromatography according to literature methods. The third fraction was collected and controlled by TLC. Fractions from tubes 15-20 were combined and separated sequentially by silica gel column chromatography (eluting with CHCl3-acetone), Sephadex LH-20 (eluting with MeOH-CHCl3 3:1), and RP-8 reversed-phase silica gel column chromatography (eluting with MeOH-H2O) to obtain glabroisoflavanone A (250 mg). Glabroisoflavanone A was subsequently named intermediate G5.

[0061] Recombinant functional strain pTDG- E. coli BL21(DE3) was cultured in Luria-Bertani (LB) medium containing 0.5% (w / v) yeast extract, 1% (w / v) tryptone, and 1% (w / v) sodium chloride at 37°C until the optical density (OD) at 600 nm was reached. 600nm The concentration was approximately 0.8. Protein expression was induced for 20 hours at 25°C using 0.4 mM isopropyl-β-D-thiogalactoside (from Sigma-Aldrich). Glucose to a final concentration of 50 g / L and intermediate G5 (DMSO for dissolution) to a final concentration of 0.5 g / L were added to the fermentation broth, followed by further incubation at 25°C and 150 rpm for 12 hours. Samples were taken at specific time points for high-performance liquid chromatography (HPLC) analysis. The results showed that only 0.3% of intermediate G5 (substrate) was converted to glycyrrhizin.

[0062]

[0063] Example 2:

[0064] The main objective of this embodiment is to construct an in vivo directed evolution system, and the specific process is as follows:

[0065] I. Construction of T7RNAP-deaminase fusion system

[0066] The fusion plasmid of T7RNAP and adenine deaminase (TadA-8e) was constructed using the Gibson Assembly method, and the specific process is as follows:

[0067] (1) Using the Escherichia coli BL21(DE3) genome as a template, the pT7RNAP fragment was amplified using primers T7 RNApol-F (5'-gcgactcctgcattaggaaatAGGCCTATGAACACGATTAACATCG-3', SEQ ID NO:6) and T7 RNApol-R (5'-CGCGAACGCGAAGTCCGAC-3', SEQ ID NO:7).

[0068] (2) The Linker-tadA-8e-UGI whole gene was synthesized (by Shanghai Sangon Biotech Co., Ltd.) and the sequence was stored in the pUC19 universal cloning vector to construct the pUC19-tadA-8e-UGI plasmid.

[0069] (3) Using pUC19-tadA-8e-UGI plasmid as a template, the tadA-8e fragment was amplified using primers tadA-8e-F (5'-TGACATCTTAGAGTCGGACTTCGCGTTCGCGTCAGGTAGATCTTCAGGAGGGTC-3', SEQ ID NO:9) and tadA-8e-R (5'-ctttaccagactcgagggtaccgacgTCAggaactaccCACCTTCCTC-3', SEQ ID NO:10).

[0070] (4) The pACYC-Duet-1 plasmid was amplified using primers pACYC-LF (5'-cgtcggtaccctcgagtc-3', SEQ ID NO:11) and pACYC-LR (5'-AGGCCTatttcctaatgcaggagtcgc-3', SEQ ID NO:12) to obtain the pACYC-L fragment.

[0071] (5) The amplified fragment tadA-8e and pT7RNAP fragment were assembled with the vector pACYC-L using Gibson Assembly to obtain the recombinant plasmid. Then, the pLacUV5-lac operator fragment (sequence: ) was inserted into the StuI site.

[0072] CAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT (SEQ ID NO:22), finally yielding the pACYC-pLacUV5-T7RNAP-TadA8e-UGI plasmid.

[0073] (6) Using pK18mobSacB plasmid as a template, the SacB fragment was amplified by PCR using primers SacB-F (5'-tcgtctactagcgcagcttaattaaccacatatacctgccgttc-3', SEQ ID NO:13) and SacB-R (5'-gttattgctcagcggtggcagcagcgcgtttttatttgttaactgt-3', SEQ ID NO:14); the pACYC-pLacUV5-T7RNAP-TadA8e-UGI plasmid was digested with AvrII and dephosphorylated with calf intestinal alkaline phosphatase CIAP. The resulting vector fragment and the SacB fragment were then assembled by Gibson Assembly to obtain the recombinant plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB (abbreviated as pTTUS plasmid).

[0074] II. Construction of an In vivo Directed Evolution System

[0075] Transform the constructed pTTUS plasmid into E. coli The corresponding engineered strains were obtained from DH5α. E. coli DH5α-pTTUS. Add appropriate amounts of chloramphenicol (20 µg / mL) and IPTG (0.4 mM) to LB medium and incubate at 37°C and 250 rpm for 4 hours.

[0076] III. Mutation Efficiency Assessment

[0077] The mutation efficiency was assessed using the pET28a-T7promotor-ampR plasmid (ampR, the ampicillin resistance gene) as the mutation target, regulated by the T7 promoter. The pET28a-T7promotor-ampR plasmid was introduced into... E. coli DH5α-pTTUS was cultured on LB agar plates (both containing kanamycin and with or without ampicillin). Mutation efficiency was calculated using the formula: Mutation efficiency = (Number of colonies on plates containing both ampicillin and kanamycin / Number of colonies on kanamycin plates) × 100%. The results showed that... E. coli The mutation frequency of DH5α-pTTUS induced by IPTG for 24 h was 2.01 ± 0.21 × 10⁻⁶. 2 Bacterial genes have a low spontaneous mutation rate, approximately 10 per generation. 9 -10 8 In vivo mutation efficiency increased significantly by approximately 10%. 5 times.

[0078] Example 3:

[0079] The main objective of this embodiment is the directed evolution of the pTDG plasmid, and the specific process is as follows:

[0080] The pTDG plasmid (i.e., the three genes SiDR, SiTR, and PmGDH regulated by the T7 promoter) was selected for co-directional evolution; the recombinant pTTUS plasmid and the recombinant pTDG plasmid were simultaneously transformed into [a specific gene] using the heat shock method. E. coli Recombinant functional strain pTTUS-pTDG- was obtained in DH5α competent cells. E. coli DH5α; Appropriate amounts of antibiotics and lactose, as well as different concentrations of intermediate G5 (DMSO for solubilization) (4 g / L, 6 g / L, 8 g / L, 10 g / L, 15 g / L, 20 g / L) were added to the culture medium to progressively screen for mutants tolerant to high concentrations of intermediate G5. To terminate the evolutionary process, the functional strain pTTUS-pTDG- E. coli DH5α culture was inoculated into LB medium containing 5% sucrose, with only 25 μg / ml kanamycin added, and then cultured overnight at 37°C. After the above culture process, the obtained mutants were functionally screened. Through a series of rigorous screening procedures, a recombinant strain pTDGm258- that could tolerate 10 g / L intermediate G5 was successfully obtained. E. coli DH5α.

[0081] The specific cultivation and screening process is as follows:

[0082] Single clones were inoculated into 96-well deep-well plates (500 µL / well) using LB medium containing 0.5% glycerol and 50 µg / mL Kans. -1 ; 37℃, 400 rpm, shake for 6 h, take 50µL for preservation; the remaining culture medium, OD 600 Adjust the concentration to 1.0. Add 0.1 mM M IPTG, incubate at 30℃, 400 rpm, shake for 16 h, centrifuge, and collect the bacterial pellet. For the transformation reaction, add G5 to a final concentration of 3 mM (30 µL of 0.1 M stock solution, dissolved in DMSO), and add 20 g / L glucose and 0.5 mM NADP. + The reaction was carried out in 50 mM PBS at pH 7.5 at 37°C and 300 rpm for 2 h; centrifuged at 4000 g for 10 min, and the supernatant was collected. The target product was detected by HPLC; strains with high levels of the target product were selected.

[0083] Example 4:

[0084] The main objective of this embodiment is pTDGm258- E. coliBL21(DE3) (which is a pRSFDuet-SiDR-SiTR-PmGDH mutant, abbreviated as Recombinant) Escherichia coli ZRG-1, this strain was deposited on September 29, 2025 at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, accession number CCTCC NO: M20252150. The flowchart for the whole-cell synthesis of glycyrrhizin is shown below. Figure 1 The specific process is as follows:

[0085] From pTDGm258- E.Coli DH5α extracts pTDGm258 plasmid and transforms pTDGm258 plasmid into DH5α. E. coli Recombinant strain pTDGm258- was obtained from BL21 (DE3) competent cells. E. coli BL21(DE3); recombinant functional strain pTDGm258- E. coli BL21(DE3) was cultured in Luria-Bertani (LB, containing 25 µg / ml kanamycin) medium containing 0.5% (w / v) yeast extract, 1% (w / v) tryptone and 1% (w / v) sodium chloride at 37°C until the optical density (OD) at 600 nm was reached. 600nm The concentration was approximately 0.8. Protein expression was induced for 20 hours at 25°C using 0.4 mM isopropyl-β-D-thiogalactopyranoside (from Sigma-Aldrich). Glucose to a final concentration of 50 g / L and intermediate G5 (DMSO for dissolution) to a final concentration of 10 g / L were added to the fermentation broth, followed by incubation at 25°C and 150 rpm for another 12 hours. Samples were taken at specific time points for high-performance liquid chromatography (HPLC) analysis. The results showed that 35% of intermediate G5 (substrate) was converted to glycyrrhizin. The HPLC results of intermediate G5 (substrate) are shown below. Figure 2 As shown; the mass spectrometry results of intermediate G5 are as follows. Figure 3 As shown, the NMR results are as follows Figure 4-5 As shown; pTDGm258- E. coli BL21(DE3) whole-cell catalysis was used to prepare glycyrrhizin. The product, after purification by column chromatography, was then analyzed by mass spectrometry and nuclear magnetic resonance (NMR). The mass spectrometry results are as follows: Figure 6 As shown, the NMR results are as follows Figure 7-8 As shown, the HPLC results of the product are as follows. Figure 9 As shown in the figure. The results indicate that the product is glycyrrhizin.

[0086] The SiTR gene sequence, SiDR gene sequence, PmGDH gene sequence, tadA-8e-UGI sequence, SacB fragment sequence, pET28a-T7promotor-ampR plasmid sequence, and Linker-tadA-8e-UGI sequence in this invention are as follows:

[0087] SiTR gene sequence:

[0088]

[0089] SiDR gene sequence:

[0090] GGATCCGATGGCACAGGAAGTCAAGGCTCCAAAGATTAGCGGCGCTCCGGAATTCGGCAAATGGATCAGCCCGGAAGAAAGCGTCGGTCAGCGCCTGAAAGGTAAAAAGATTCTGCTGACCGGTACCACCAAAGGTGTGGGCCACGTAGCTCAGGAACTGCTGTGCGCTCACGGCGCCTTCGTATGCGGTTCCGGTCGTACTCCGGGTGCAGCGGCAGCTTATGCGGATGAACTGAAAGCTAAAGGCTACAAAGCTGCTGGCTTTGATTGCGATCTGGCCGATTACGAGGCGGTTAAGAAATGGGTCGCGCAGTGCGCGGAACTGATGGGCGGTATCGACGTAGTGATCAACAACGCTTCCCACCCGGGTATGGCACCGTTCGAAGCGATGGACGTAGAAACCTGGAACTACGGCATCCGCAACGAACTGGACCTGGTTTACAACGTGTGTAATTGCGCTTGGCCGTACCTGAAGGAAGGCAACGGTGCTAACATCATCATCACCTCCAGCACCGTCGGCCTGCAAGGCTCTAATTCTCCGCAGGCCTGTCACGCTGCGGCTAAAGGCGCGTGTCTGGCTCTGGCACGTCAGCTGGCGGCTGAAGGCGGTCCATTCGGCATTCGTTGCAACTCTGTAACTCCGGGTCTGGTTTGGACCGAGGCGATGGCAAACATTCCGAAGGAAATGGCATCCGGTCTGGTTGCTGCTCAGACTACCCAACGTGCGATCGACCCGATCGACATTGCGTATGCTTACCTGTTCCTGGCTTCCGACGAAGCTCGTCAGATCACCGCGGCCAACATCCCGGTTGATGGTGGCTGCTCCGGTGCAACCACGGGCGCCATGCAGGGTGAAATCGCGTAAAAGCTT (SEQ ID NO:2);

[0091] PmGDH gene sequence:

[0092] CATATGATGTACAAAGATCTGGAAGGTAAAGTAGTTGTTATCACTGGCTCTTCTACGGGCCTGGGCAAGTCCATGGCGATTCGTTTCGCTACCGAGAAAGCAAAAGTGGTTGTTAACTACCGCAGCAAGGAAGATGAGGCCAACAGCGTGCTGGAAGAAATCAAAAAAGTTGGCGGTGAAGCGATCGCAGTGAAGGGTGATGTTACCGTCGAAAGCGATGTAATCAACCTGGTACAGTCCGCGATTAAAGAGTTTGGCAAGCTGGACATCATGATCAACAACGCAGGCCTGGAAAACCCGGTAAGCTCCCACGAAATGAGCCTGAGCGATTGGAATAAAGTCATCGACACTAACCTGACCGGTGCATTCCTGGGCTCCCGTGAAGCGATTAAATACTTCGTTGAGAACGACATTAAAGGCACGGTGATCAACATGAGCAGCGTACACGAGAAGATCCCATGGCCACTGTTCGTACATTACGCTGCCAGCAAAGGTGGTATGAAACTGATGACCGAAACCCTGGCCCTGGAATACGCGCCGAAAGGCATTCGTGTTAACAACATCGGTCCGGGCGCAATCAATACCCCGATCAACGCCGAAAAATTCGCGGACCCGGAACAGCGTGCAGATGTAGAGAGCATGATCCCAATGGGCTACATTGGCGAACCGGAAGAAATCGCGGCTGTTGCCGCTTGGCTGGCCTCCTCTGAAGCATCTTACGTTACGGGCATCACTCTGTTTGCCGATGGCGGTATGACGCAGTACCCGTCTTTTCAGGCTGGTCGTGGCTAAGCGGCCGC (SEQ ID NO:3);

[0093] The sequence of tadA-8e-UGI:

[0094] (SEQ)ID NO:8);

[0095] SacB fragment sequence:

[0096]

[0097] pET28a-T7promotor-ampR plasmid sequence:

[0098]

[0099] Linker-tadA-8e-UGI sequence:

[0100] (SEQ)ID NO:21).

[0101] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant engineered strain for the biosynthesis of glycyrrhizin, characterized in that, The recombinant engineered strain includes the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH; wherein the nucleotide sequence of SiTR is shown in SEQ ID NO:1, the nucleotide sequence of SiDR is shown in SEQ ID NO:2, and the nucleotide sequence of PmGDH is shown in SEQ ID NO:

3.

2. The method for constructing the recombinant engineered strain for the biosynthesis of glycyrrhizin according to claim 1, characterized in that, Includes the following steps: (1) Synthesize nucleotide sequences such as SiTR, SiDR and PmGDH as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3; (2) SiTR was ligated to pRSFDuet-1 plasmid to obtain pRSFDuet-SiTR plasmid; (3) Connect SiDR to pRSFDuet-SiTR plasmid to obtain pRSFDuet-SiDR-SiTR plasmid; (4) PmGDH was ligated to the pET28a vector to obtain the pET28a-PmGDH plasmid; (5) Using pET28a-PmGDH plasmid as a template, T7-PmGDH expression cassette was obtained by PCR amplification, and then assembled with pRSFDuet-SiDR-SiTR plasmid by Gibson Assembly to obtain recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH. (6) The recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH was transformed into competent cells to obtain a recombinant engineered strain for the biosynthesis of glycyrrhizin.

3. The construction method according to claim 2, characterized in that, The primer sequences for PCR amplification in step (5) are as follows: PmGDH-F: 5'-CGTCATGCGATCGCCAACATGTAACACGATGCGTCCGGCGTAG-3'; PmGDH-R: 5'-TTATTGCTCAGCGGTGGCAGCAGCTTAGCCACGACCAGCCTG-3'.

4. A method for directed evolution of the recombinant engineered strain for biosynthesis of glycyrrhizin as described in claim 1, characterized in that, Includes the following steps: (1) The fusion plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB and the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH were simultaneously transformed into competent cells to obtain recombinant functional strains. (2) The recombinant functional strains were cultured in a medium containing glabroisoflavanone A, an intermediate of glycyrrhizin, and the mutants with the strongest tolerance to the intermediate were screened out. (3) The mutants were cultured and screened, and strains with high content of target product were selected as recombinant strains for directed evolution.

5. The method according to claim 4, characterized in that, In step (1), the fusion plasmid pACYC-pLacUV5-T7RNAP-TadA8e-UGI-SacB and the recombinant plasmid pRSFDuet-SiDR-SiTR-PmGDH were simultaneously transformed into competent cells using the heat shock method.

6. A recombinant strain of directed evolution, characterized in that, The strain was prepared using the method described in claim 4 and named Recombinant. Escherichia coli ZRG-1 was deposited on September 29, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20252150.

7. The application of the recombinant engineered strain of claim 1 and the directed-evolution recombinant strain of claim 6 in the synthesis of glycyrrhizin using glabroisoflavanone A as a substrate.

8. A method for synthesizing glycyrrhizin, characterized in that, Includes the following steps: The recombinant engineered strain of claim 1 or the directed-evolution recombinant strain of claim 6 is cultured, and then the strain is induced to express protein. Glucose and glabroisoflavanone A, an intermediate of glycyrrhizin, are added to the culture medium, and the culture is continued until glycyrrhizin is synthesized.

9. The method according to claim 8, characterized in that, Protein expression was induced in recombinant engineered strains or directed-evolutionized recombinant strains at 25°C for 20 hours using 0.4 mM isopropyl-β-D-thiogalactoside; 50 g / L glucose and glabroisoflavanone A (an intermediate of glycyrrhizin) at a final concentration of 10 g / L were added to the culture medium, and the culture was continued at 25°C and 150 rpm for 12-48 hours.