Micropterus salmoides liver cell line as well as construction method and application thereof

Abstract

The invention discloses a Micropterus salmoides liver cell line and a construction method and application thereof, the Micropterus salmoides liver cell line is characterized in that the cell line is preserved in China Center for Type Culture Collection on September 25, 2025, the preservation number is CCTCC NO: C2025296, the cell line is classified and named as Micropterus salmoides liver cell line MSL-NBU Micropterus salmoides, and the construction method comprises the steps of tissue block treatment, primary culture and subculture, the obtained liver cell line of the micropterus salmoides can be continuously subcultured and amplified, and can be repeatedly cryopreserved and recovered; the cell line has the advantages that the cell line can meet scientific research on germplasm resource preservation, cell biology, virology, toxicology, immunology and the like of an economic species of micropterus salmoides, and the MSL is sensitive to viruses such as MSRV and LMBV and can be used for large-scale culture of related viruses, preparation of attenuated vaccines, inactivated vaccines and the like and screening and evaluation of aquatic product virus resisting drugs.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of fish cell culture, and particularly relates to a Micropterus salmoides liver cell line and a construction method and application thereof. BACKGROUND

[0002] Micropterus salmoides, also known as largemouth bass, belongs to Perciformes, Centrarchidae and Micropterus, and has high nutritional value. However, with the increasing degree of artificial intensification and the continuous increase of the breeding density, diseases of Micropterus salmoides frequently occur, especially viral diseases. Micropterus salmoides rhabdovirus (MSRV) and Largemouth bass virus (LMBV) are the main pathogens of viral diseases. In recent years, diseases caused by MSRV and LMBV have broken out in large quantities in the process of Micropterus salmoides breeding, but the prevention and control effect is poor, causing huge economic losses.

[0003] As an in vitro material with biological activity, a cell strain has advantages that cannot be matched by living fish: the culture and maintenance of cells do not require large-scale breeding equipment, and the breeding cost is low; the individual size of cells is uniform, the genetic background is extremely similar, the experimental conditions can be accurately controlled, and the repeatability is good. Therefore, a fish cell line is an important material and model for researches such as virology, physiology, immunology, gene function analysis, environmental toxicant detection, cell engineering breeding and germplasm preservation. At present, there is no related research report on a Micropterus salmoides liver cell line and a construction method thereof at home and abroad. SUMMARY

[0004] The first aspect of the present application aims to provide a Micropterus salmoides liver cell line. The cell line was preserved in the China Center for Type Culture Collection on September 25, 2025, with a preservation number of CCTCC NO: C2025296, named Micropterus salmoides liver cell line MSL-NBU Micropterus salmoides, and the preservation address is Wuhan, China, Wuhan University.

[0005] The second aspect of the present application aims to provide a construction method of the above-mentioned Micropterus salmoides liver cell line, comprising the following steps: Step 1, treatment of tissue blocks: healthy Micropterus salmoides fry is taken, soaked in a 10 mg / mL potassium permanganate solution for 10 min, washed with a PBS buffer, dissected, and then liver tissue is taken out, soaked in alcohol, and then rinsed 4-6 times with pre-cooled PBS buffer containing antibiotics, and finally cut into block-shaped tissue with scissors; ​Step 2, primary culture: the block tissue obtained in step 1 is transferred to a culture dish, evenly arranged and placed upside down in a culture box, and dried for 4-6 h, then culture solution I is added, and the cell migration is observed every day, and the culture solution I is replaced every 72 h by 50%; Step 3, subculture: when the cells grow to fullness, subculture is started, the old culture solution in the culture dish is sucked out, washed with PBS buffer, 1 mL trypsin digestion solution is added to the culture dish, and digestion is carried out, and the cells are expanded by 1:2; after the cells are subcultured to 10 generations, the culture solution I is replaced by culture solution II; after the cells are subcultured to 20 generations, the culture solution II is replaced by culture solution III, and then subculture is continued for 100 generations to obtain a liver cell line of Micropterus salmoides.

[0006] Further, the PBS buffer containing antibiotics in step 1 is a PBS buffer containing 500 IU / mL penicillin and 500 μg / mL streptomycin.

[0007] Further, the culture solution I in step 2 is M199 culture medium containing 15wt% fetal bovine serum, 200 IU / mL penicillin, 200 μg / mL streptomycin, 15 ng / mL basic fibroblast growth factor, 2 ng / mL epidermal growth factor and 1 ng / mL insulin-like cell growth factor.

[0008] Further, the culture solution II in step 3 is M199 culture medium containing 15wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin; and the culture solution III is M199 culture medium containing 10wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin.

[0009] The third aspect of the present application aims to provide the application of the above-mentioned liver cell line of Micropterus salmoides, including the culture and detection of viruses. The viruses are Micropterus salmoides rhabdovirus (MSRV) and Large mouth bass rana virus (LMBV).

[0010] Further, the application of the above-mentioned liver cell line of Micropterus salmoides in preparing the separation and identification of MSRV and LMBV products is provided. The separation and identification process is as follows: the cells are incubated with MSRV and LMBV, observed under a microscope every 12 h, and the cell morphological changes are recorded; when 90% of the cells show cytopathic effect, the culture supernatant is collected, MSRV is extracted for RNA, reversed into cDNA for detection, and LMBV is extracted for DNA for PCR detection.

[0011] Compared with the prior art, the application has the advantages that the application discloses a Micropterus salmoides liver cell line and a construction method and application thereof, the cell line is preserved in the China Center for Type Culture Collection on September 25, 2025, has a preservation number of CCTCC NO: C2025296, is named as Micropterus salmoides liver cell line MSL-NBU Micropterus salmoides, and is stable in passage. The MSL has been successfully passed for more than 100 generations and has a good growth state, a single cell type, controllable conditions, a good cryopreservation and recovery state. The cell line is sensitive to viruses such as MSRV and LMBV, can be used for large-scale culture of related viruses, or preparation of attenuated vaccines, inactivated vaccines and the like, or screening and evaluation of anti-aquatic virus drugs, and further realizes prevention and control of related viral diseases. The establishment of the cell line enriches the Micropterus salmoides cell line library, can provide guarantee for pathogen isolation, culture and detection and identification of aquatic animal viral diseases, and provides convenience for researches on infection pathways and infection mechanisms of Micropterus salmoides susceptible viruses and development of viral vaccines. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Fig. 1 is a microscopic Micropterus salmoides liver cell morphology, wherein A is the first generation of Micropterus salmoides liver cells; B is the 10th generation of Micropterus salmoides liver cells; C is the 20th generation of Micropterus salmoides liver cells; D is the 100th generation of Micropterus salmoides liver cells, and bar = 100 μm; Figure 2 Fig. 3 is a species source PCR detection result diagram of MSL; Figure 3 Fig. 4 is a cell morphology change of MSL infected by MSRV and LMBV, and Mock refers to a control group without virus infection; Figure 4 Fig. 5 is a PCR detection result after virus infection of MSL, wherein A is MSRV infection, M: DNA marker, 1: uninfected cells, 2: MSRV infected cells; B is LMBV infection, M: DNA marker, 2: uninfected cells; 3: LMBV infected cells. DETAILED DESCRIPTION

[0013] The application will be further described in detail in combination with the embodiments of the drawings. I. EMBODIMENT Embodiment 1, construction of Micropterus salmoides liver cell line (abbreviated as MSL), the specific steps are as follows: Step 1, preparation work before experiment: configuration of culture solution I, II and III Culture solution I is M199 medium containing 15wt% fetal bovine serum, 200 IU / mL penicillin, 200 μg / mL streptomycin, 15 ng / mL basic fibroblast growth factor (FGF), 2 ng / mL epidermal growth factor (EGF) and 1 ng / mL insulin-like cell growth factor (IGF).

[0015] Culture solution II is M199 medium containing 15wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin.

[0016] Culture solution III is M199 medium containing 10wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin.

[0017] Step 2, treatment of tissue blocks Healthy large-mouth bass fry (6 cm in length) were taken, soaked in 10 mg / mL potassium permanganate solution for 15 min, washed with PBS buffer, dissected, and liver tissues were taken out. The liver tissues were soaked in 75% alcohol for 15 s, rinsed 5 times with pre-cooled PBS buffer containing 500 IU / mL penicillin and 500 μg / mL streptomycin in a biological safety cabinet, and finally cut into 1 mm 3 left and right blocks with scissors.

[0018] Step 3, primary culture The treated tissue blocks were transferred to culture dishes, evenly distributed and arranged in a certain order, and then placed upside down in an incubator. After 6 h of air drying, the residual liquid in the culture dishes was discarded, and culture solution I was added. The cell migration was observed every day, and the culture solution I was replaced by 50% every 72 h.

[0019] Step 4, subculture Subculture: after the cells were fully grown, subculture was performed. The old culture solution in the culture dish was sucked out with a pipette, washed once with PBS buffer, and 1 mL trypsin digestion solution was added to the culture dish. After standing and digestion, the culture was expanded at a ratio of 1:2, and microscopic observation was performed every day. After the cells were subcultured to the 10th generation, the culture solution I was replaced with culture solution II. After the cells were subcultured to the 20th generation, the culture solution II was replaced with culture solution III. Then the subculture was continued under the above conditions for 100 generations.

[0020] From Figure 1 A, Figure 1 B, Figure 1 C and Figure 1As can be seen from FIG. 1, the primary cultured liver cells of Micropterus salmoides are morphologically diverse, mainly showing epithelial-like cells and fibrous-like cells, and the cells gradually show the characteristics of fibrous-like cells as the number of generations increases. The Micropterus salmoides liver cell line is named MSL-NBU Micropterus salmoides liver cell line, and was preserved in the China Center for Type Culture Collection on September 25, 2025, at the address of Wuhan University, Wuhan, China, with the preservation number of CCTCC NO: C2025296. Step 5, cell cryopreservation: when the cells are in the logarithmic growth phase and the cell monolayer reaches about 90% of the bottom of the culture dish, cryopreservation is performed. Taking a 6 cm culture dish as an example, remove the original culture medium with a pipette, add 1 mL of 0.05wt% trypsin solution for digestion, add 2 mL of culture medium III, centrifuge at 800 rpm / min for 5 min to remove the culture medium, add 1 mL of cell cryopreservation solution (containing 90% fetal bovine serum and 10% DMSO), mix well with a pipette, and then prepare a cell suspension. Add the cell suspension to a cryopreservation tube, label it, and then place it in a cryopreservation box. After overnight storage at -80°C, transfer it to a liquid nitrogen tank for storage.

[0021] Step 6, cell recovery: remove the cryopreserved cells from the liquid nitrogen tank and quickly transfer them to a 30°C constant temperature water bath to shake back and forth to promote rapid thawing. After the ice in the cryopreservation tube melts, use a pipette gun to aspirate the cell suspension into a 1.5 mL centrifuge tube, add 2 mL of culture medium III, centrifuge at 800 rpm / min for 10 min, remove the supernatant with a pipette to remove DMSO in the cryopreservation solution, resuspend the precipitated cells with 1 mL of culture medium III, and move them to a new culture dish. After adding culture medium III, place it in a 25°C constant temperature incubator for culture. Observe the cell morphology and growth status every day, and find that the recovered cells are fibrous-like and grow well.

[0022] Example 2, species source analysis of Micropterus salmoides liver cell line MSL Using mitochondrial DNA 16S rRNA and cytochrome oxidase subunit I (COI) Cytochrome oxidase subunit I,(COI) was used to identify the species origin of largemouth bass hepatocytes. Primers were: COI-F: 5'-TTTGGTGCTTGAGCCGGAATA-3'; COI-R: 5'-ATGCCCGCAGCGAGGACT-3'; 16S-F: 5'-AACCCCCTAATTTTACCAGAC-3'; 16S-R: 5'-AAAGGGGATTGCGCTGTTAT-3'. Genomic DNA was extracted from 100th generation MSL cells using a blood / tissue / cell genomic extraction kit, followed by PCR experiments. PCR was performed in 25 μL reaction volumes using Novizan GreenTaq enzyme, with 35 cycles of pre-denaturation at 95℃ for 5 min, followed by extension at 72℃ for 10 min at 95℃ for 15 s, 55℃ for 15 s, and 72℃ for 1 min. The PCR products were then verified by agarose gel electrophoresis. Figure 2 As shown, the PCR product band size ranges from 500 bp to 750 bp. COI 655 bp and 16S (730 bp), consistent with expectations. The PCR amplification product was then sequenced and compared with that of the largemouth bass. COI Sequence (GenBank No. MT455395.1) and 16S rRNA Sequence alignment (GenBank No. AY742550.1) revealed a homology of over 99%, proving that MSL originated from largemouth bass.

[0023] Example 3: Susceptibility of MSL to MSRV and LMBV Susceptibility of 100th generation MSL cells to MSRV and LMBV was assessed. MSL cells were seeded in 6-well plates, and when the cell density reached approximately 90%, the old culture medium was removed, and the cells were infected with MSRV (multiple of infection 0.01) and LMBV (multiple of infection 0.1), respectively. Cell status was observed daily, such as… Figure 3 As shown, both MSRV and LMBV infection of MSL cells can induce cytopathic effects, and obvious cell rounding, shedding and cytoplasmic vacuolation are observed 12 h after infection, with the cytopathic effect becoming more severe at 24 h.

[0024] Example 4: PCR detection of MSRV and LMBV infected MSL After MSRV and LMBV infection, supernatant was collected when cell death exceeded 90%. RNA was extracted using a viral genomic DNA / RNA extraction kit to detect MSRV, and DNA was extracted to detect LMBV. Novizan Green Taq assay was used, with primers as follows: MSRV-F: CAAAATTGGGCAAGCGGTCA, MSRV-R: GTGAATGATGCGATGTGGGC; LMBV-F: GTCTTCTGTTACGGGTTCTG, LMBV-R: ATGATGCGGATAATGTTGTG. PCR amplification conditions were: 95℃, 5 min pre-denaturation; 35 cycles of 95℃, 10 s, 55℃, 1 min, and 72℃, 30 s; 72℃, 10 min. Gel electrophoresis results showed that MSRV-infected samples exhibited bands between 250-500 bp, with a size of approximately 423 bp. Figure 4 As shown in Figure A, LMBV-infected cell samples exhibit a band at 1000-2000 bp, approximately 1359 bp in size. Figure 4 As shown in Figure B, the homology between the sequencing results and the corresponding sequences of MSRV and LMBV was over 99%, indicating that the corresponding viruses were detected in MSL infected with MSRV or LMBV.

[0025] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A largemouth bass liver cell line, characterized in that: The cell line was named MSL-NBU Micropterus salmoides, with accession number CCTCC NO: C2025296.

2. A method for constructing the largemouth bass liver cell line according to claim 1, characterized in that... Includes the following steps: Step 1, Tissue block processing: Take healthy largemouth bass fry, soak them in 10 mg / mL potassium permanganate solution for 10 min, wash them with PBS buffer, dissect them, take out liver tissue, soak them in alcohol, rinse them 4-6 times with pre-cooled antibiotic PBS buffer, and then cut the liver tissue into blocks with scissors. Step 2, Primary culture: Transfer the block tissue obtained in Step 1 to a culture dish, arrange it evenly, invert it and place it in an incubator to air dry for 4-6 hours, add culture medium I, observe cell migration every day, and replace 50% of culture medium I every 72 hours. Step 3, Subculture: After the cells have grown to confluence, begin subculture. Aspirate the old culture medium from the culture dish, wash once with PBS buffer, add 1 mL of trypsin digestion solution to the culture dish, let it stand to digest, and expand the culture by subculturing from 1 to 2. After the cells have been subcultured to passage 10, replace culture medium I with culture medium II. After the cells have been subcultured to passage 20, replace culture medium II with culture medium III, and then continue subculturing for 100 passages to obtain the largemouth bass liver cell line.

3. The method for constructing a largemouth bass liver cell line according to claim 2, characterized in that: The antibiotic-containing PBS buffer mentioned in step 1 is a PBS buffer containing 500 IU / mL penicillin and 500 μg / mL streptomycin.

4. The method for constructing a largemouth bass liver cell line according to claim 2, characterized in that: The culture medium I mentioned in step 2 is M199 medium containing 15 wt% fetal bovine serum, 200 IU / mL penicillin, 200 μg / mL streptomycin, 15 ng / mL basic fibroblast growth factor, 2 ng / mL epidermal growth factor and 1 ng / mL insulin-like cell growth factor.

5. The method for constructing a largemouth bass liver cell line according to claim 2, characterized in that: The culture medium II mentioned in step 3 is M199 medium containing 15 wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin; the culture medium III is M199 medium containing 10 wt% fetal bovine serum, 100 IU / mL penicillin and 100 μg / mL streptomycin.

6. The application of the largemouth bass liver cell line according to claim 1, characterized in that: This includes virus culture and detection, preparation of attenuated and inactivated vaccines, and the application of largemouth bass liver cell lines in the screening of antiviral drugs for aquatic animals.

7. The application of the largemouth bass liver cell line according to claim 6, characterized in that: The viruses mentioned are largemouth bass rhabdovirus and largemouth bass iridovirus.

8. The application of the largemouth bass liver cell line according to claim 1 in the isolation and identification of MSRV and LMBV products.

9. The application of the largemouth bass liver cell line according to claim 8 in the preparation, isolation, and identification of MSRV and LMBV products, characterized in that, The separation and identification process is as follows: cells are infected with MSRV and LMBV, observed under a microscope every 12 hours, and cell morphology changes are recorded; when 90% of the cells show cytopathic effects, the culture medium supernatant is harvested for PCR detection.

Images