Compound bacterium enzyme preparation containing acetylxylan esterase AxeA16138 and application of compound bacterium enzyme preparation in fermentation of highland barley straw
By using acetylxylan esterase AxeA16138 in synergistic fermentation with compound microorganisms, the problem of low utilization efficiency of barley straw resources in Tibet has been solved, significantly improving the nutritional value and palatability of straw, and providing a reliable microbial-enzyme synergistic strategy for the high-value utilization of straw resources in high-altitude and cold regions.
Patent Information
- Application Number
- CN202511521699.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2026-02-10
AI Technical Summary
Existing technologies are insufficient to effectively utilize barley straw resources in Tibet, especially due to its low crude protein and high crude fiber content, resulting in poor feed palatability and limited nutritional value. Traditional improvement methods pose safety and environmental pollution risks, and microbial fermentation is not ideal in its degradation efficiency of hemicellulose, particularly in its limited ability to remove acetyl groups from xylan chains.
The synergistic fermentation technology of acetylxylan esterase AxeA16138 and compound microorganisms significantly improves the nutritional value of highland barley straw by combining acetylxylan esterase AxeA16138 with xylanase and using compound microbial enzyme preparations including Lactobacillus plantarum, Bacillus licheniformis, Bacillus subtilis and Aspergillus niger.
It significantly increased the crude protein and crude fat content in barley straw, reduced the crude fiber and ammonia nitrogen content, improved the nutritional quality and feed value of straw, and provided a theoretical basis for the high-value feed utilization of straw resources in high-altitude and cold regions.
Smart Images

Figure CN121495902A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of enzyme preparation and microbial fermentation, and particularly relates to a complex microbial enzyme preparation containing acetyl xylan esterase AxeA16138 and application of the complex microbial enzyme preparation in fermentation of highland barley straw. BACKGROUND
[0002] Highland barley straw is the main byproduct of crops in Tibet. Statistical data over the years show that the highland barley and wheat straw resources in the region are abundant, but only part of them is directly used as forage for ruminants, and a considerable proportion of the straw resources cannot be effectively utilized, and the problem of resource waste is more prominent. Tibet is a high-altitude region, and its special natural environment leads to a fragile grassland ecosystem, and the phenomenon of insufficient seasonal supply of pasture is more obvious, which has formed certain constraints on the development of local livestock and poultry industry dominated by yak, Tibetan pig and other characteristic breeds. There are obvious limitations in directly using highland barley straw as feed: the crude protein content is low, the crude fiber content is high, and the neutral detergent fiber and acid detergent fiber contents are also at a high level (on a dry basis). Such nutritional composition characteristics lead to poor palatability and limited nutritional value of the feed, which not only makes it difficult to meet the nutritional needs of monogastric animals such as Tibetan pigs, but also has a relatively limited utilization efficiency in ruminants.
[0003] The traditional methods for improving the quality of straw feed at present mainly include physical crushing and chemical ammoniation treatment. Physical crushing can improve the palatability of feed to some extent, but cannot change the chemical composition of fiber structure; chemical ammoniation can increase the crude protein content, but has problems such as great operation risk, environmental pollution caused by ammonia volatilization, and potential harm to animal health caused by residual ammonia. Microbial fermentation technology provides a new way to solve the problem of straw feed. Research shows that complex microbial fermentation can degrade fiber components through synergistic metabolism of microbial flora, but the degradation efficiency of conventional microbial fermentation on hemicellulose in highland barley straw is still not ideal, especially the removal capacity of acetyl groups on xylan chains is limited.
[0004] Acetyl xylan esterase can specifically hydrolyze acetyl groups on the xylan backbone, but there is no systematic research on the use of acetyl xylan esterase with carbohydrate-binding module (CBM) family 1 members in combination with complex microorganisms for highland barley straw fermentation, and the development of efficient enzyme and microbial fermentation technology is of great significance to improve the utilization efficiency of straw resources for feed in Tibet. SUMMARY
[0005] Based on the above needs, the purpose of the present application is to provide a complex microbial enzyme preparation containing acetyl xylan esterase AxeA16138 and its application in fermented highland barley straw, the present application provides the amino acid sequence of acetyl xylan esterase AxeA16138 and the nucleotide sequence of the coding gene thereof, through the combination of xylanase and synergistic complex microbial fermentation of highland barley straw, the acetyl xylan esterase AxeA16138 significantly improves the nutritional value of highland barley straw , and has important guiding significance for the feedstuff of straw resources in Tibet region and the large-scale fermentation production.
[0006] In order to realize the above-mentioned purpose of the application, the following technical solutions are adopted in the present application: The present application provides a complex microbial enzyme preparation containing acetyl xylan esterase AxeA16138, the complex microbial enzyme preparation comprises a complex enzyme preparation and a complex microbial agent, the complex enzyme preparation comprises acetyl xylan esterase AxeA16138 and xylanase; the complex microbial agent comprises lactobacillus plantarum, bacillus licheniformis, bacillus subtilis and aspergillus niger, the amino acid sequence of the acetyl xylan esterase AxeA16138 is shown as SEQ ID No. 1.
[0007] The present application provides the application of the complex microbial enzyme preparation containing acetyl xylan esterase AxeA16138 in fermented highland barley straw.
[0008] Further, the nucleotide sequence of the coding gene of the acetyl xylan esterase AxeA16138 is shown as SEQ ID No. 3.
[0009] Further, the CBM1 member in the acetyl xylan esterase AxeA16138 has adhesion capacity to insoluble microcrystalline cellulose and wheat arabinoxylan.
[0010] Further, the acetyl xylan esterase AxeA16138 has acetyl xylan esterase activity and can degrade ester substances.
[0011] Further, the ester substances include at least one of 4-nitrophenyl acetate, methyl ferulate and ethyl ferulate.
[0012] Further, the primers for cloning the coding gene of the acetyl xylan esterase AxeA16138 are as follows: F: TTTATTTTCAGGGCGGATCCATGGCACCGGACCCGAACTTCCACATCTAC; R: TGGTGGTGGTGGTGCTCGAGATGAACGAGTGGTACTCTCAGTGTCAG.
[0013] Further, the molecular weight of the acetyl xylan esterase AxeA16138 obtained by heterologous expression of the coding gene in an ArcticExpress (DE3) competent strain is 30-35 kDa.
[0014] Further, the method for fermenting the highland barley straw comprises the following steps: mixing the compound enzyme preparation and the bacterial agent, adding the highland barley straw and uniformly mixing, finally, exhausting and sealing and constant temperature fermentation.
[0015] Further, the enzyme dosage of the acetyl xylan esterase AxeA16138 is 10-30 U / g, and the dosage of the xylanase is 150-250 U / g.
[0016] Further, the inoculation amount of each bacterium in the compound bacterial agent is 1×10 7 -1×10 8 CFU / g.
[0017] Further, the fermentation time is 5-65 days, and the fermentation temperature is 25-35 DEG C.
[0018] Further, the fermentation time is 24 days, and the fermentation temperature is 30 DEG C.
[0019] Further, the acetyl xylan esterase AxeA16138 can effectively improve the contents of crude protein, crude fat and lactic acid in the highland barley straw, and significantly reduce the contents of crude fiber, neutral detergent fiber, acid detergent fiber and ammonia nitrogen in the highland barley straw.
[0020] Compared with the prior art, the present application has the following beneficial effects: 1、The acetyl xylan esterase AxeA16138 provided by the present application is derived from an anaerobic fungus Neocallimastix sp. LGM-ZA7, the coding gene allA16138 is synthesized after codon optimization, and is cloned into a pET-28a(+) vector, and is heterologously expressed by using an E. coli ArcticExpress (DE3) strain, then a recombinant enzyme with a molecular weight of about 31.5 kDa is obtained by nickel column affinity chromatography purification, the specific enzyme activity of the recombinant enzyme on 4-nitrophenyl acetate (pNP-acetate) is 15.57±0.27 U / mg, and the carbohydrate binding module CBM1 has a significant enhancing effect on the enzyme activity and stability.
[0021] 2, The application utilizes the synergistic fermentation technology of composite microorganisms-enzymes to effectively degrade the fiber components of highland barley straw by the synergistic effect of microbial flora and enzyme system, and experiment verifies that acetyl xylan esterase AxeA16138 effectively degrades highland barley straw fiber components, significantly improves the contents of crude protein and crude fat, and improves the nutritional quality and feeding value. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 SDS-PAGE results of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1; Figure 2 Optimal reaction pH result graph of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1; Figure 3 pH stability result graph of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1; Figure 4 Optimal reaction temperature result graph of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1; Figure 5 Temperature stability result graph of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1; Figure 6 CBM1 in the acetyl xylan esterase AxeA16138 has the adhesion ability result graph of insoluble polysaccharide; Figure 7 Specific enzyme activity result graph of purified acetyl xylan esterase AxeA16138 and its CBM1-removed truncated body AxeA16138ACBM1 degrading different ester substrates; Figure 8 Effect of bacteria-enzyme synergistic fermentation of highland barley straw on fermentation quality, wherein A is ammonia nitrogen content change graph, B is lactic acid content change graph, and C is pH value change graph; Figure 9 Effect of bacteria-enzyme synergistic fermentation of highland barley straw on fiber content, wherein A is crude fiber content change graph, B is neutral detergent fiber content change graph, and C is acid detergent fiber content change graph; Figure 10 Effect of fermented highland barley straw on crude protein and crude fat, wherein A is crude protein content change graph, and B is crude fat content change graph. DETAILED DESCRIPTION
[0023] The concept, technical solution of the present application will be described in detail in combination with examples, so as to fully understand the purpose, result and significance of the present application. The experimental methods not specified in the following examples are usually carried out according to the conventional conditions or the conditions recommended by the manufacturer; the materials not specified in the source are all commercially available products.
[0024] Main medium and solution (1) LB liquid medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 10 g / L, sterilized at 115℃ for 15 min; (2) Protein binding (lysis) buffer: 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 10% Glycerol, 0.05% Tween 20, 0.5 mM DTT, 10 mM Imidazole; (3) Protein washing buffer: 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 10% Glycerol, 0.05% Tween 20, 0.5 mM DTT, 20-50 mM Imidazole; (4) Protein elution buffer: 50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 10% Glycerol, 0.05% Tween 20, 0.5 mM DTT, 60-300 mM Imidazole.
[0025] If a solid medium is prepared, 1.6% agar powder is added to the components of the LB liquid medium.
[0026] Example 1: Screening of acetyl xylan esterase AxeA16138 and its truncated body AxeA16138ΔCBM1 removing CBM1 Based on the transcriptome data, the coding gene of CBM-fused acetyl xylan esterase AxeA16138 with a member of Carbohydrate-binding module (CBM) family 1 is screened from a hemicellulose side chain degrading gene cluster of anaerobic fungus Neocallimastix sp. LGM-ZA7 by analyzing differentially expressed genes, and the truncated body removing CBM1 is also provided. The gene encoding acetyl xylan esterase is named as all A16138The name of the acetyl xylan esterase is AxeA16138, and the name of the truncated body thereof removing CBM1 is AxeA16138ΔCBM1, the amino acid sequences of the wild-type enzyme AxeA16138 and the truncated body AxeA16138ΔCBM1 thereof are shown in SEQ ID No. 1 and SEQ ID No. 2.
[0027] The preservation unit of the anaerobic fungus Neocallimastix sp. LGM-ZA7 is China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences; the preservation date is April 12, 2019; and the preservation number of Neocallimastix sp. LGM-ZA7 is CGMCC No. 17591. Neocallimastix sp. The preservation number of Neocallimastix sp. LGM-ZA7 is CGMCC No. 17591.
[0028] Example 2: Heterologous expression and purification of acetyl xylan esterase AxeA16138 and truncated body thereof removing CBM1 I. Synthesis and transformation of acetyl xylan esterase AxeA16138 and truncated body gene thereof 1. The coding genes of the original acetyl xylan esterase and the truncated body thereof removing CBM1 are codon-optimized according to the codon bias of Escherichia coli, and the nucleotide sequences of the optimized coding genes are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. The target gene fragment is directly synthesized by Nanjing Qikexing Biotechnology Co., Ltd., and is seamlessly cloned into the vector pET-28a (+) to obtain a recombinant plasmid containing the target gene.
[0029] This example provides primers for cloning the coding genes of the acetyl xylan esterase AxeA16138 and the truncated body thereof, specifically: The primers for cloning the coding gene of the acetyl xylan esterase AxeA16138 are: F: TTTATTTTCAGGGCGGATCCATGGCACCGGACCCGAACTTCCACATCTAC (SEQ ID No. 5); R: TGGTGGTGGTGGTGCTCGAGATGAACGAGTGGTACTCTCAGTGTCAG (SEQ ID No. 6).
[0030] The primers for cloning the coding gene of the acetyl xylan esterase truncated body are: F: TTTATTTTCAGGGCGGATCCATGGCACAGGAGCCG (SEQ ID No. 7); R: TGGTGGTGGTGGTGCTCGAGTTAGCAGTTACCGTTGATGGATGC (SEQ ID No. 8).
[0031] 2. Take 1-2 μL plasmid and add to 50 μL of ArcticExpress (DE3) competent strain, place on ice for 30 min, then maintain in a 42 °C water bath for 30 sec. Then place on ice again for 2 min, add 950 μL of antibiotic-free liquid LB medium. Shake at 37 °C, 200 rpm for 1 h. Centrifuge the sample at room temperature, 5000 rpm for 1 min, take out 900 μL supernatant and resuspend. Spread 100 μL of the concentrated bacterial solution on an LB solid plate containing kanamycin (100 μg / mL), and incubate at 37 °C overnight until multiple colonies grow.
[0032] II. Expression and purification of acetyl xylan esterase AxeA16138 and its truncated body 1. Select 2-3 clones of each plasmid in liquid LB medium containing kanamycin (100 μg / mL), gentamicin sulfate (20 μg / mL), and shake at 37 °C, 220 rpm overnight (for inoculation).
[0033] 2. Inoculate the grown bacterial solution into LB liquid medium (containing kanamycin 100 μg / mL and gentamicin sulfate 20 μg / mL) at a ratio of 1%, and shake at 30 °C, 220 rpm until the OD 600 of the bacterial solution is 0.4-0.6 (usually 4-6 h), then add IPTG at a final concentration of 0.5 mM, and induce at 12 °C, 200 rpm for 24 h.
[0034] 3. After induction, centrifuge the bacterial solution at 4 °C, 8000 rpm for 10 min, add protein lysis buffer and protease inhibitor (PMSF), and use a new zhi ultrasonic cell disruptor (SCIENTZ-150, Ningbo, China) to disrupt the bacterial cells. After disruption, centrifuge at 4 °C, 12000 rpm for 40 min, and collect the supernatant for protein purification.
[0035] 4. Use gravity column with Ni 2+ Tanrose filler affinity chromatography method to purify the protein, first use Tris-HCl protein binding buffer (containing 10 mM imidazole) to balance the nickel column.
[0036] 5. After adding the supernatant containing the crude enzyme solution to a nickel column, react and bind at 4 °C for 30-60 min. Discard the flow-through portion. First, elute weakly bound proteins with protein elution buffer, then gradually elute the target protein with Tris-HCl protein elution buffer containing 60-300 mM imidazole. Collect the fractions according to different elution conditions, and use SDS-PAGE to determine the specific imidazole concentration of the eluted target protein.
[0037] 6. Collect the relatively pure eluted fraction based on the SDS-PAGE results, add TEV enzyme and incubate overnight at 4 °C (at least 16 h). After completion, bind again using nickel bead packing material; this time, collect via flow-through (the target protein with the tagged edge cannot adhere to the column and will fall off with the flow-through). After appropriate concentration, determine the protein concentration using a Nanodrop 8000 spectrophotometer and analyze the protein purity using SDS-PAGE.
[0038] To ensure normal heterologous expression of both wild-type acetylxylan esterase AxeA16138 and its truncated variant, this invention optimized their codon bias, resynthesized the genes, and cloned them into the vector pET-28a(+). Heterologous expression was then performed using *E. coli* strain ArcticExpress (DE3). The SDS-PAGE results of acetylxylan esterase AxeA16138 and its truncated variant are shown below. Figure 1 As shown, the results indicate that the purity of the purified acetylxylan esterase AxeA16138 and its truncated form can reach over 90%. The actual molecular weight of the expressed AxeA16138 is approximately 31.5 kDa, and the actual molecular weight of AxeA16138ΔCBM1 is approximately 27.8 kDa, which can be used to determine the biochemical characteristics of the enzyme.
[0039] Example 3: Biochemical characteristics of acetylxylan esterase AxeA16138 and its truncated form 1. Optimal reaction pH of acetylxylan esterase AxeA16138 and its truncated form 4-Nitrophenylacetic acid ester ( p Using NP-acetate as the substrate (working concentration 4 mM) and the enzyme protein at a working concentration of 0.5 µM, reaction systems were set up with pH values of 4.5, 5.5, 6.5, 7.0, 7.5, 8.0, 9.0, and 10.0, respectively, with reaction temperatures of 37 ℃ and reaction times of 5 min. Immediately after reaction, the samples were transferred to a microplate reader, and the OD value was measured at 405 nm. Because 4-nitrophenol ( pThe specific activity of NP is greatly affected by pH, and different concentrations need to be prepared at each pH to plot the standard curve. Finally, the highest specific activity is set as 100%, and the relative activity under other pH conditions is calculated to obtain the optimal reaction pH of acetylated xylan esterase AxeA16138 and its truncated form.
[0040] The optimal reaction pH results for the acetylationylan esterase AxeA16138 and its truncated form are as follows: Figure 2 As shown, the optimal reaction pH is 6.5.
[0041] 2. pH stability of acetylxylan esterase AxeA16138 and its truncated form The pH stability was determined by placing the enzyme protein in buffer solutions with pH values of 3.5, 4.5, 5.5, 6.5, 7.5, 8.0, 9.0, and 10.0, incubating at 4 °C for 16 h, and then measuring the specific enzyme activity. The highest specific enzyme activity was counted as 100% to calculate the relative enzyme activity at different pH values.
[0042] The pH stability results of the acetylationylan esterase AxeA16138 and its truncated form are as follows: Figure 3 As shown, the pH stability of acetylxylan esterase AxeA16138 was significantly reduced after removing CBM1.
[0043] 3. Optimal reaction temperature of acetylxylan esterase AxeA16138 and its truncated form Based on the optimal pH values of acetylxylan esterase AxeA16138 and its truncated form obtained above, buffer systems for the reactions were prepared at the optimal reaction pH for acetylxylan esterase AxeA16138 and its truncated form, respectively. Using 4-nitrophenylacetate as the substrate (working concentration of 4 mM), and with an enzyme protein working concentration of 0.5 µM, the reaction systems were simultaneously maintained at 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, and 60°C for 5 min, respectively. Other steps and enzyme activity calculation methods were the same as those for determining the optimal pH.
[0044] The optimal reaction temperature of the acetylationylan esterase AxeA16138 and its truncated form is as follows: Figure 4 As shown, the optimal reaction temperatures are 40 ℃ and 35 ℃, respectively.
[0045] 4. Temperature stability of acetylxylan esterase AxeA16138 and its truncated form Temperature stability was determined by placing the enzyme-containing protein reaction system at 42 °C and 50 °C for 5 min, 10 min, 20 min, 30 min, 40 min, 50 min, and 60 min, respectively. The remaining enzyme activity at each time point was taken as the relative enzyme activity for that time point, and the specific enzyme activity at the optimum temperature was taken as the relative enzyme activity at 0 min. The calculation of enzyme activity was the same as that for determining the optimum reaction temperature.
[0046] The temperature stability results of the acetylationylan esterase AxeA16138 and its truncated form are as follows: Figure 5 As shown, the temperature stability of CBM1 was significantly reduced after acetylxylan esterase removed it.
[0047] 5. Adhesion ability of CBM1 in acetylxylan esterase AxeA16138 to insoluble polysaccharides The adhesion ability of CBMs to insoluble polysaccharides (insoluble wheat arabinoxylan and microcrystalline cellulose) was determined using the solid-state loss method. A series of different CBM protein concentrations (5-100 µM) were set up, and each CBM was bound to the substrate (final concentration 30 mg / mL) at 4 °C for 30 min, followed by centrifugation at 4 °C and 1000 rpm for 1 min. The supernatant was collected and the absorbance was measured at 280 nm. The protein concentration in the supernatant was calculated by subtracting the protein content in the supernatant after binding from the protein content before binding. This was finally converted into the amount of CBM protein bound per gram of substrate at the corresponding CBM concentration. The relationship between the CBM concentration before binding and the amount of CBM bound per gram of substrate at the corresponding concentration was established using binding-saturation nonlinear fitting.
[0048] The adhesion ability of CBM1 in the acetylationan esterase AxeA16138 to insoluble wheat arabinoxylan and microcrystalline cellulose was as follows: Figure 6 As shown, it exhibits significant adhesion to insoluble microcrystalline cellulose and wheat arabinoxylan.
[0049] 6. Specific enzyme activities of acetylxylan esterase AxeA16138 and its truncated form in the degradation of different esters 4-Nitrophenylacetic acid ester pNP-acetate (working concentration 4 mM), methyl ferulate, and ethyl ferulate (both working concentrations 2 mM) were used as substrates to determine the degradation of different substrates by acetylxylan esterase AxeA16138 and its truncated form. The working concentration of acetylxylan esterase AxeA16138 and its truncated form was 0.5 µM. The buffer solution required for the reaction was prepared according to the previously determined optimal pH, and the reaction conditions and procedures were the same as those for the determination of the optimal temperature.
[0050] The specific enzyme activities of the acetylationan esterase AxeA16138 and its truncated form in degrading different esters are as follows: Figure 7 As shown, the specific enzyme activity of acetylxylan esterase AxeA16138 in degrading different esters was significantly higher than that of its truncated form, and its degradation of 4-nitrophenylacetate (…) was also significantly higher. p The NP-acetate had the highest specific enzyme activity, at 15.57 ± 0.27 U / mg; while the truncated form had a weaker specific enzyme activity, with the highest being 0.23 ± 0.03 U / mg.
[0051] As shown above, the acetylxylan esterase AxeA16138 screened, heterologously expressed, and purified in this invention has acetylxylan esterase activity and exhibits the highest specific enzyme activity in the degradation of 4-nitrophenylacetate (pNP-acetate). Therefore, acetylxylan esterase AxeA16138 was selected to be combined with xylanase to further explore the efficacy of enzyme AxeA16138 in the fermentation of highland barley straw.
[0052] Example 4: Application of a compound enzyme preparation containing acetylxylan esterase AxeA16138 in the co-fermentation of barley straw with microbial agents. 1. Materials and Methods 1.1 Test Materials The bacterial agent described in this embodiment is composed of Lactobacillus plantarum (… Lactobacillus plantarum ), Bacillus licheniformis ( Bacillus licheniformis ), Bacillus subtilis ( Bacillus subtilis ), Aspergillus niger ( Aspergillus niger The composite microorganisms prepared by combination, the above four microorganisms were all obtained through commercial channels, among which Aspergillus niger produces pectinase, cellulase and xylanase.
[0053] The enzyme preparations used in this embodiment include: xylanase, purchased from Yuanye Company, with an enzyme activity of 100,000 U / g; and acetylated xylan esterase AxeA16138, which was prepared in Examples 1-2.
[0054] Additionally, barley straw raw material was provided, and the conventional nutritional components of the barley straw raw material are shown in Table 1.
[0055] Table 1. Nutritional composition of highland barley straw (air-dried basis)
[0056] 1.2 Test Methods 1.2.1 Co-fermentation of barley straw by bacteria and enzymes The inoculum containing four microorganisms (Lactobacillus plantarum, Bacillus subtilis, Bacillus licheniformis, and Aspergillus niger) and the compound enzyme preparation (acetylated xylan esterase AxeA16138 and xylanase) were pre-dissolved in 15 g of a compound liquid culture medium (a mixture of MRS, LB, and Czapek's medium). The inoculum concentration for each microorganism was 1 × 10⁻⁶. 7 The enzyme addition amounts were 20 U / g CFU of acetylsylan esterase (AxeA16138) and 200 U / g xylanase, respectively. This mixture was then added entirely to barley straw and thoroughly mixed. Control group 1 received only 15 g of compound culture medium, which contained neither microbial nor enzyme preparations. Control group 2 received four microbial compound inoculants and xylanase pre-dissolved in 15 g of compound culture medium, but without acetylsylan esterase (AxeA16138). After sealing and degassing using a sealing machine, the mixture was placed in a 30°C incubator for static fermentation. Fermentation times were 8, 16, 24, and 60 days, with three replicates per group at each time point. After fermentation, a portion of the samples were collected and an extract was prepared to determine the pH value, lactic acid content, and ammonia nitrogen content of the fermented barley straw feed. Another portion of the samples were frozen and stored at -80℃ for structural observation of the fermented barley straw. The remaining samples were dried in a 65℃ oven, pulverized, and passed through a 40-mesh sieve for subsequent testing.
[0057] 1.3 Index Measurement 1.3.1 Determination and structural analysis of the fermentation quality of highland barley straw Lactic acid content was determined using a lactate kit (A019-2-1, Nanjing Jiancheng Bioengineering Institute). pH was measured using a portable pH meter. Ammonia nitrogen in the fermentation samples was determined using the phenol-sodium hypochlorite colorimetric method.
[0058] 1.3.2 Determination of Nutrients Crude protein, crude fat, crude fiber, neutral detergent fiber, and acid detergent fiber were determined according to the "Feed Analysis and Feed Quality Testing Technology". 1.4 Data Analysis Data were analyzed using SPSS 26.0 software. T-tests were used to analyze different groups at the same time point, and one-way ANOVA was used for the same treatment groups at different time points.
[0059] 2 Results and Analysis Table 2 shows the impact of different number of days on the fermentation quality indicators of barley straw in the synergistic fermentation of bacteria and enzymes, as detailed below: Table 2. Changes in nutrient composition and fermentation quality of barley straw on day 8 of fermentation.
[0060] Table 3. Changes in nutrient composition and fermentation quality of barley straw on day 16 of fermentation.
[0061] Table 4. Changes in nutrient composition and fermentation quality of barley straw on day 24 of fermentation.
[0062] Table 5. Changes in nutrient composition and fermentation quality of barley straw on day 60 of fermentation. .
[0063] 2.1 Effects of synergistic fermentation of barley straw by bacteria and enzymes on ammonia nitrogen, lactic acid, and pH Ammonia nitrogen results as follows Figure 8 As shown in Figure A, the ammonia nitrogen concentrations in both the experimental and control groups showed a decreasing trend before day 24, with the experimental group showing a significantly lower concentration than the control group. However, at day 60, both groups increased, indicating that the fermentation quality began to become unstable. Lactic acid content at each time point is shown in Figure A. Figure 8 As shown in Figure B, the lactate levels in the experimental group were higher than those in the control group at all four time points. P <0.05, therefore the pH of the experimental group at four time points was significantly lower than that of the control group 1 ( P <0.05, Figure 8 (As shown in C).
[0064] 2.2 Effect of microbial-enzyme synergistic fermentation of highland barley straw on fiber content The contents of crude fiber, neutral detergent fiber, and acid detergent fiber in the experimental group were significantly lower than those in the control group at 16 days, 24 days, and 60 days. P <0.05, Figure 9 As shown in Figures A, B, and C), both groups showed a decreasing trend as fermentation time increased.
[0065] 2.3 Effects of synergistic fermentation of barley straw by bacteria and enzymes on crude protein and crude fat The crude protein content in the experimental group was significantly higher than that in the control group at all four time points. P < 0.05), and the crude protein content in the experimental group showed a gradual increasing trend over time. Figure 10 (As shown in Figure A). The crude fat content of the experimental group was significantly higher than that of the control group at all four time points. P <0.05, Figure 10(As shown in B).
[0066] 3. Conclusion This invention utilizes a composite microbial-enzyme synergistic fermentation technology. Through the synergistic effect of microbial communities and enzyme systems, it effectively degrades the fiber components of highland barley straw, significantly increasing the crude protein and crude fat content, thereby improving its nutritional quality and feed value. Furthermore, the fermentation effect is best after 24 days. This invention provides a reliable microbial-enzyme synergistic strategy and theoretical basis for the high-value feed utilization of straw resources in high-altitude and cold regions.
[0067] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.
Claims
1. A compound bacterial enzyme preparation containing acetylxylan esterase AxeA16138, characterized in that, The compound bacterial enzyme preparation includes a compound enzyme preparation and a compound bacterial agent. The compound enzyme preparation includes acetylxylan esterase AxeA16138 and xylanase. The compound bacterial agent includes Lactobacillus plantarum, Bacillus licheniformis, Bacillus subtilis and Aspergillus niger. The amino acid sequence of the acetylxylan esterase AxeA16138 is shown in SEQ ID No.
1.
2. The application of the compound bacterial enzyme preparation containing acetylxylan esterase AxeA16138 as described in claim 1 in the fermentation of highland barley straw.
3. The application according to claim 2, characterized in that, The nucleotide sequence of the gene encoding the acetylxylan esterase AxeA16138 is shown in SEQ ID No.
3.
4. The application according to claim 2, characterized in that, The method for fermenting barley straw involves mixing a compound enzyme preparation and a compound microbial agent, adding them to the barley straw and mixing thoroughly, and finally venting, sealing, and fermenting at a constant temperature.
5. The application according to claim 2, characterized in that, The acetylxylan esterase AxeA16138 is capable of degrading esters, including at least one of 4-nitrophenylacetate, methyl ferulic acid, and ethyl ferulic acid.
6. The application according to claim 2, characterized in that, The amount of acetylated xylan esterase AxeA16138 used is 10-30 U / g.
7. The application according to claim 2, characterized in that, The amount of xylanase used is 150-250 U / g.
8. The application according to claim 2, characterized in that, The inoculation amount of each bacterium in the compound microbial agent is 1×10⁻⁶. 7 -1×10 8 CFU / g.
9. The application according to claim 5, characterized in that, The fermentation period is 5-65 days, and the fermentation temperature is 25-35℃.
10. The application according to any one of claims 2-9, characterized in that, The acetylated xylan esterase AxeA16138 effectively increased the crude protein, crude fat and lactic acid content of barley straw during fermentation, effectively degraded the fiber components of barley straw, and effectively reduced its ammonia nitrogen content.