Promoter mutant and application thereof in production of isoleucine
By designing and constructing a DNA molecule with the nucleotide sequence SEQ ID No.2 as a promoter, the natural promoters of the NCgl0265 and ilvA genes in Corynebacterium glutamicum were replaced or enhanced, solving the problem of cell homeostasis imbalance during high-density fermentation and achieving a significant increase in L-isoleucine production.
Patent Information
- Application Number
- CN202511834506.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-02-10
AI Technical Summary
During high-density fermentation, the homeostasis of the internal environment of Corynebacterium glutamicum cells is disrupted, leading to intracellular ion imbalance and pH fluctuations, which severely inhibits cell growth and isoleucine production. Improving cell stress resistance and yield becomes a key factor.
DNA molecules and their variants containing the nucleotide sequence SEQ ID No.2 were designed and constructed as promoters to replace or enhance the natural promoters of the NCgl0265 and ilvA genes. Recombinant vectors were constructed using NEBuilder recombination technology and transformed into Corynebacterium glutamicum. The promoters were optimized to improve transcription levels.
It significantly improved the environmental tolerance of the bacteria and the yield of L-isoleucine, extended the stable production period, and improved production efficiency.
Smart Images

Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and relates to a promoter mutant and application thereof in producing isoleucine. BACKGROUND
[0002] L-isoleucine, as an essential branched-chain amino acid, has a wide range of applications in the pharmaceutical, food and feed industries, and its efficient microbial production has attracted much attention. As a generally recognized safe host, Corynebacterium glutamicum has been widely used in the industrial fermentation of L-isoleucine. Through metabolic engineering means to strengthen its biosynthetic pathway, such as relieving the feedback inhibition of key enzymes and enhancing the precursor supply, the yield has been significantly improved. However, in the process of high-density fermentation, with the high-speed consumption of carbon source and the rapid increase of metabolic flow, the intracellular environment homeostasis faces severe challenges, especially the imbalance of intracellular ion balance and pH fluctuation, which seriously inhibits the growth activity of the bacteria and the ability to continuously synthesize the target product. Therefore, under the stress environment in the later stage of fermentation, how to offset the metabolic pressure and improve the stress resistance of the cells has become one of the key factors to improve the yield of L-isoleucine. SUMMARY
[0003] The technical problem solved by the present application is to provide a promoter mutant and application thereof in producing isoleucine.
[0004] To solve the above technical problem, the present application provides, in a first aspect, a DNA molecule, which is any one of the following: A1) the nucleotide sequence comprises the DNA molecule shown in SEQ ID No. 2; A2) in the nucleotide sequence shown in SEQ ID No. 2, substitution, deletion or addition of one or more nucleotides is carried out at other positions except the 66th nucleotide, and the obtained DNA molecule has a variant with equivalent or enhanced promoter activity.
[0005] In some embodiments, A1) is a DNA molecule with a nucleotide sequence shown in SEQ ID No. 2; In a second aspect, the present application provides biological materials related to the DNA molecule of the first aspect, including any one of the following B1) to B7): B1) an expression cassette containing the DNA molecule of the first aspect; B2) a recombinant vector containing the DNA molecule of the first aspect; B3) a recombinant vector containing the expression cassette of B1); B4) a recombinant microorganism containing the DNA molecule of the first aspect; B5) a recombinant microorganism containing the expression cassette of B1); B6) a recombinant microorganism containing the recombinant vector of B2); B7) a recombinant microorganism comprising the recombinant vector of B3); B8) a nucleic acid construct comprising the DNA molecule of the first aspect.
[0006] In the biological material, the expression cassette of the DNA molecule (promoter) of the first aspect refers to a DNA that can drive the expression of a target gene in a host cell. The DNA can include not only the target gene but also a terminator that terminates the transcription of the target gene. Further, the expression cassette can further include an enhancer sequence.
[0007] The recombinant vector comprising the promoter can be constructed using an existing expression vector.
[0008] In the biological material, the vector can be a plasmid, cosmid, bacteriophage, or viral vector.
[0009] In the biological material, the microorganism can be yeast, bacteria, algae, or fungi. The bacteria can be Corynebacterium glutamicum (C. glutamicum) (ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex Corynebacterium glutamicum (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex Corynebacterium glutamicum (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex Corynebacterium glutamicum (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex brevibacterium flavum (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex Corynebacterium pekinense (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex Pantoea (Corynebacterium pekinense) CGMCC No. 20437, Corynebacterium glutamicum (C. glutamicum) ATCC 13032), Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Ammonifex
[0010] In some embodiments, the recombinant microorganism can be obtained by replacing the NCgl0265 gene or ilvA the native promoter of the NCgl0265 gene in Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum CGMCC NO. 20437 with the DNA molecule of the first aspect as a promoter.
[0011] In the biological material, the nucleic acid construct comprises the DNA molecule of the first aspect and a gene sequence operably linked to the DNA molecule.
[0012] In some embodiments, the gene sequence can be the NCgl0265 gene or ilvA the gene.
[0013] In a third aspect, the present application provides the use of the DNA molecule of the first aspect as a promoter. or, the present application provides the use of the DNA molecule of the first aspect as a promoter to drive the expression of a target gene.
[0014] In a fourth aspect, the present application provides use of the DNA molecule of the first aspect or the biological material of the second aspect in the production of a biomolecule.
[0015] In the use described above, the biomolecule is at least one of lysine, valine, glycine, glutamic acid, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, a-ketoglutaric acid, citric acid, ornithine, citrulline.
[0016] In a fifth aspect, the present application provides a method for producing an L-amino acid, comprising the following steps: introducing the DNA molecule of the first aspect into a biological cell capable of synthesizing the L-amino acid of interest, allowing the DNA molecule of the first aspect to drive the expression of a gene in the L-amino acid of interest synthesis pathway in the biological cell, to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain the L-amino acid of interest.
[0017] In the above, the gene in the L-amino acid of interest synthesis pathway can be the NCgl0265 gene or the ilvA gene.
[0018] In the method described above, the biological cell is a yeast, a bacterium, an alga, a fungus, a plant cell, or an animal cell capable of synthesizing the L-amino acid of interest.
[0019] In the method described above, the bacterium is at least Corynebacterium glutamicum.
[0020] In the method described above, the L-amino acid of interest is L-isoleucine.
[0021] In the production of various products, the promoter of the present application is used to replace the upstream fragment of the gene in the L-amino acid of interest synthesis pathway and drive the expression of the gene (such as the NCgl0265 gene or ilvA gene in Corynebacterium glutamicum) in the L-amino acid of interest synthesis pathway. ilvA
[0022] In an embodiment of the present application, the gene in the L-amino acid of interest synthesis pathway is NCgl0265, and the sequence of NCgl0265 is NCgl0265 in the genome of Corynebacterium glutamicum ATCC13032 (GenBank: BA000036.3, 2016-10-7) or Corynebacterium glutamicum CGMCC NO. 20437 (GenBank: 1021329, 2024-12-12).
[0023] In another embodiment of the present application, the gene in the L-amino acid of interest synthesis pathway isilvA gene, ilvA The sequence of the gene is in the genome of Corynebacterium glutamicum ATCC13032 (GenBank: BA000036.3, 2016-10-7) or the genome of Corynebacterium glutamicum CGMCC NO. 20437 ilvA (GenBank: 1020078, 2025-2-20).
[0024] In an embodiment of the present application, the target L-amino acid is L-isoleucine, and the bacteria is Corynebacterium glutamicum (Corynebacterium glutamicum) Corynebacterium glutamicum ) CGMCC NO. 20437.
[0025] In an embodiment of the present application, the target L-amino acid is L-isoleucine, and the bacteria is Corynebacterium glutamicum (Corynebacterium glutamicum) Corynebacterium glutamicum ) ATCC13032.
[0026] The bacteria used for producing L-lysine by using the promoter of the present application include but are not limited to Corynebacterium glutamicum (Corynebacterium glutamicum) Corynebacterium glutamicum ) CGMCC NO. 20437, Corynebacterium glutamicum (Corynebacterium glutamicum) Corynebacterium glutamicum ) ATCC13032. The present application can place the promoter of the present application upstream of the genes in the L-isoleucine synthesis pathway of these bacteria, so that the promoter of the present application can synthesize L-isoleucine by driving the expression of the genes in the L-isoleucine synthesis pathway of these bacteria.
[0027] The present application focuses on the rational design and modification of the promoter of the NCgl0265 gene. By constructing a series of promoter mutants with different strengths and regulation characteristics, the natural promoter is replaced, aiming to accurately improve the transcription level of the NCgl0265 gene in the key period of fermentation. The results show that in the high-density fermentation of the engineering strain, the cells show stronger environmental tolerance and longer stable production period, significantly improving the yield and production efficiency of L-isoleucine. This promoter engineering strategy provides a new direction for improving the production performance of industrial microorganisms by optimizing endogenous stress resistance elements.
[0028] Deposit Description Classification name: Corynebacterium glutamicum (Corynebacterium glutamicum) Corynebacterium glutamicum ); Deposit agency: China General Microbiological Culture Collection Center Abbreviation of deposit agency: CGMCC Address: No. 1, Beichen West Road, Beijing City, China Deposit date: August 17, 2020 Registration number at the Preservation Center: CGMCC No. 20437. Attached Figure Description
[0029] Figure 1 For the recombinant bacteria and the original bacteria genome, NCgl0265 and ilvA Comparison of transcriptome data of genes. Detailed Implementation
[0030] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0032] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0033] Corynebacterium glutamicum in the following examples ( Corynebacterium glutamicum CGMCC NO.20437 was deposited at the China General Microbiological Culture Collection Center on August 17, 2020, with accession number CGMCC No. 20437.
[0034] Example 1: Construction of a recombinant vector containing a point-mutated promoter region fragment of the NCgl0265 gene. According to the NCBI's published data on Corynebacterium glutamicum ( Corynebacterium glutamicum The ATCC13032 genome sequence was used to design and synthesize a pair of primers that amplify the promoter region of the coding gene NCgl0265. These primers were then used in Corynebacterium glutamicum via allelic substitution. Corynebacterium glutamicum A point mutation was introduced into the NCgl0265 gene promoter (SEQ ID No. 1) of CGMCC 20437 (which was confirmed by sequencing to retain the wild-type NCgl0265 gene promoter on its chromosome). The point mutation was to change thymine (T) to guanine (G) at the 20th nucleotide of the promoter region upstream of the start codon ATG of the NCgl0265 gene (66th nucleotide of SEQ ID No. 1).
[0035] Vectors were constructed using NEBuilder recombination technology. Primers were designed as follows (synthesized by Invitrogen Shanghai). The bolded bases indicate mutation sites: P1:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG gaggcgagttgtttgtctg 3', P2: 5' gcattatccctaatcgcccCtagaaccctcg 3', P3: 5' agggttctaGgggcgattagggataatgcatg 3', P4: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ggaactgtgcggacttagtg 3'.
[0036] Construction method: Using Corynebacterium glutamicum ATCC 13032 as a template, PCR amplification was performed using primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (NCgl0265 Up and NCgl0265 Down) of the NCgl0265 gene coding region with mutant bases, with sizes of 709 bp and 749 bp, respectively.
[0037] The PCR amplification system consisted of: 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), and Mg... 2+ (25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U / μL) 0.25 μL, total volume 50 μL; The PCR amplification reaction program was as follows: 94 °C pre-denaturation for 5 min, (94 °C denaturation for 30 s; 52 °C annealing for 30 s; 72 °C extension for 90 s; 30 cycles), and 72 °C over-extension for 10 min.
[0038] The two DNA fragments (NCgl0265Up and NCgl0265Down) were separated and purified by agarose gel electrophoresis, and then compared with those digested with enzymes ( Xbal I / BamH I) The purified pK18mobsacB plasmid (purchased from Addgene, containing a kanamycin resistance marker) was ligated with NEBuilder enzyme (purchased from NEB) at 50 °C for 30 min. The ligation product was transformed into DH5α, and the resulting single clones were identified by PCR using M13 primers (M13F: 5'TGT AAAACGACGGCCAGT 3', M13R: 5'CAGGAAACAGCTATGACC 3') (1450 bp was considered positive), yielding the positive recombinant vector pK18-pNCgl0265. * The correctly identified recombinant plasmid pK18-pNCgl0265 *The sample was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-pNCgl0265 containing the correct point mutation was sent to the sequencing company for sequencing and identification. * Save for future use.
[0039] This recombinant vector pK18-pNCgl0265 * pNCgl0265 * Up-Down DNA size 1429 bp, pNCgl0265 * The up-down sequence (as shown in SEQ ID No. 3) contains a mutation site that causes the nucleotide sequence at position 20 (position 66 of SEQ ID No. 1) of the promoter region upstream of the start codon ATG of the NCgl0265 gene in strain Corynebacterium glutamicum CGMCC NO. 20437 to be mutated from thymine (T) to guanine (G).
[0040] In SEQ ID No. 3, positions 1-709 are the NCgl0265 Up nucleotide sequence, and positions 681-1429 are the NCgl0265 Down nucleotide sequence.
[0041] The recombinant plasmid pK18-pNCgl0265 * It is the pK18mobsacB plasmid Xbal I and BamH The fragment (small fragment) between the I recognition sites is replaced with the DNA fragment shown at positions 37-1391 of SEQ ID No. 3 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged, resulting in the recombinant vector.
[0042] The recombinant vector pK18-pNCgl0265 * Nucleotide sequence containing the NCgl0265 gene mutant promoter shown in SEQ ID No.2.
[0043] The nucleotide sequence of the natural promoter pNCgl0265 of the NCgl0265 gene is SEQ ID No. 1.
[0044] NCgl0265 mutant promoter pNCgl0265 * The nucleotide sequence is SEQ ID No. 2.
[0045] Example 2: Constructing a system containing the promoter pNCgl0265 * engineered strains Construction method: The allelic substitution plasmid (pK18-pNCgl0265) from Example 1 was used. * ) were transformed into Corynebacterium glutamicum by electroporation. Corynebacterium glutamicumAfter being cultured in CGMCC NO.20437 and ATCC13032, the cultures were incubated in culture media. The composition and conditions of the culture media are shown in Table 1. Single colonies generated from the culture were picked and cultured on media containing 15% sucrose (adjusting the sucrose content in the media in Table 1 to 150 g / L). The resulting single colonies were then cultured on media containing kanamycin and media without kanamycin. Strains that grew on media without kanamycin but not on media containing kanamycin were further identified by PCR using the following primers (synthesized by Invitrogen Shanghai): P5: 5' cttgatcgagaagcagcggc 3', P6: 5' tgatatcccaggtcagcgcc 3'.
[0046] The obtained PCR amplification product (380 bp) was sequenced. Through sequence alignment, the strains with mutated base sequences were identified as positive strains with successful allelic substitutions and were named YPI-p0265-1 and YPI-p0265-2, respectively.
[0047] The recombinant bacteria YPI-p0265-1 and YPI-p0265-2 contain the mutant promoter pNCgl0265 shown in SEQ ID No. 2. * .
[0048] Recombinant strain YPI-p0265-1 is a strain of Corynebacterium glutamicum (… Corynebacterium glutamicum The promoter (SEQ ID No. 1) of the NCgl0265 gene (GenBank: 1021329, 2024-12-12) in the CGMCC NO. 20437 genome was replaced with the mutant promoter pNCgl0265. * (SEQ ID No.2).
[0049] Recombinant strain YPI-p0265-2 is a strain of Corynebacterium glutamicum (… Corynebacterium glutamicum The promoter (SEQ ID No. 1) of the NCgl0265 gene (GenBank: 1021329, 2024-12-12) in the ATCC13032 genome was replaced with the mutant promoter pNCgl0265. * (SEQ ID No.2).
[0050] Table 1 shows the composition of the culture medium and the culture conditions.
[0051] Example 3: Construction of a mutant promoter regulator for the NCgl0265 gene ilvA Recombinant vectors for gene expression To further demonstrate the mutant promoter pNCgl0265 * The highly efficient promoter (SEQ ID No. 2) was used to replace the gene encoding threonine dehydratase in wild-type Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum CGMCC NO. 20437. ilvA The natural promoter sequence upstream of the start codon (ATG) enhances... ilvA Gene expression. The ilvA gene encodes a threonine dehydratase, which catalyzes the irreversible breakdown of L-threonine into α-ketobutyrate and ammonia. This is the first step in isoleucine biosynthesis and a key step in threonine catabolism.
[0052] Vectors were constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of amplified upstream and downstream homologous arm fragments and the mutant NCgl0265 gene promoter pNCgl0265 were designed and synthesized. * Primers were used to homologously recombine wild-type Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum CGMCC NO.20437. ilvA The original gene promoter was replaced with the mutant NCgl0265 gene promoter.
[0053] The primers were designed as follows (synthesized by Invitrogen Shanghai): P7: 5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG agcatgtcacgcagagtctg 3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector). P8: 5' catttaccctttaaattgacaagctctttgtagaacaatgctatag 3', P9: 5' cattgttctacaaagagcttgtcaatttaaagggtaaatgccctcccg 3', P10: 5' agacacgtatgtttcactcatgcattatccctaatcgcccCtag 3', P11: 5' Ggggcgattagggataatgcatgagtgaaacatacgtgtctgagaaaag3', P12: 5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCggttcgataccaacgatcgcag3' (The underlined nucleotide sequence is the sequence on the pK18mobsacB vector).
[0054] Construction method: Using YPI-p0265-1 as a template, PCR amplification was performed using primers P7 / P8, P9 / P10, and P11 / P12, respectively, to obtain a 687 bp upstream homologous arm fragment (sequence shown in SEQ ID No. 4), and the NCgl0265 gene mutant promoter pNCgl0265. * The fragment is 126 bp (sequence shown in SEQ ID No. 5) and the downstream homologous arm fragment is 744 bp (sequence shown in SEQ ID No. 6).
[0055] The PCR reaction system consisted of: 5 μL of 10×Ex Taq Buffer, 4 μL of dNTP Mixture (2.5 mM each), and Mg... 2+ 4 μL of (25 mM) primers, 2 μL each of (10 pM) primers, 0.25 μL of Ex Taq (5 U / μL), for a total volume of 50 μL.
[0056] The PCR reaction program was as follows: 94 °C pre-denaturation for 5 min, 94 °C denaturation for 30 s; 52 °C annealing for 30 s; 72 °C extension for 60 s (30 cycles); 72 °C over-extension for 10 min.
[0057] After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with pK18mobsacB plasmid (purchased from Addgene, containing kanamycin resistance as a selection marker) purified by Xbal I / BamHI digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α, and the resulting single clones were identified by PCR using M13 primers (M13F: 5'TGT AAA ACG ACGGCC AGT 3', M13R: 5'CAG GAA ACA GCT ATG ACC 3') (1497 bp was considered positive), yielding a positive integration plasmid (recombinant vector). The resulting recombinant vector was pK18-pNCgl0265 *-ilvA. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin selection. The correctly identified recombinant plasmid pK18-pNCgl0265* was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-pNCgl0265*-ilvA containing the correct point mutation was stored for future use.
[0058] The recombinant plasmid pK18-pNCgl0265 * -ilvA is the pK18mobsacB plasmid. Xbal I and BamH The fragment (small fragment) between the I recognition sites is replaced with the DNA fragment shown in positions 37-1438 of SEQ ID No. 7 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged, resulting in the recombinant vector.
[0059] Example 4: Constructing mutant promoter regulation ilvA Engineered strains for gene expression Construction method: The allelic substitution plasmid (pK18-pNCgl0265) from Example 3 was used. * - ilvA The bacteria were transformed into wild-type *Corynebacterium glutamicum* ATCC 13032 and *Corynebacterium glutamicum* CGMCC NO.20437 via electroporation. They were then cultured on solid culture plates (culture medium components are shown in Table 1) for 40 h. Single colonies were identified by PCR using primers P13 / P10. Strains amplified with an 868 bp fragment (sequence shown in SEQ ID No. 8) were considered positive strains; those without amplification were considered the original bacteria. Positive strains were streaked onto solid culture plates containing 15% sucrose (the sucrose content in the culture medium in Table 1 was adjusted to 150 g / L) for 40 h. Single colonies were further identified by PCR using primers P9 / P14. Strains amplified with an 895 bp fragment (sequence shown in SEQ ID No. 9) were considered positive strains. ilvA Positive strains with a mutant promoter inserted before the ATG start codon were named YPI-p0265-3 and YPI-p0265-4, respectively, by Corynebacterium glutamicum CGMCC NO.20437 and wild-type Corynebacterium glutamicum ATCC 13032.
[0060] The recombinant strain YPI-p0265-3 differs from Corynebacterium glutamicum CGMCC NO. 20437 only in that the recombinant strain YPI-p0265-3 has the DNA molecule shown in SEQ ID No. 10 deleted (i.e., knocked out) in the genome of Corynebacterium glutamicum CGMCC NO. 20437. ilvA The gene (GenBank:1020078, 2025-02-20) contains nucleotides 1-59 of its natural promoter, which inactivates the natural promoter. ilvA The strain was obtained by inserting the NCgl0265 mutant promoter sequence (SEQ ID No. 2) before the ATG gene while keeping other sequences unchanged.
[0061] The only difference between the recombinant strain YPI-p0265-4 and wild-type Corynebacterium glutamicum ATCC 13032 is that the recombinant strain YPI-p0265-4 is a clone of Corynebacterium glutamicum ATCC 13032 with the DNA molecule shown in SEQ ID No. 10 deleted (knockout). ilvA The gene (GenBank:1020078, 2025-02-20) contains nucleotides 1-59 of its natural promoter, which inactivates the natural promoter. ilvA The strain was obtained by inserting the mutant promoter sequence NCgl0265 (SEQ ID No. 2) before the ATG start codon, while keeping other sequences unchanged.
[0062] P13: 5' aacgagggttgctagtctaagcag 3', P14: 5'ctccgacacgtttgactgctg 3'.
[0063] Example 5: L-Isoleucine Fermentation Experiment and Transcriptome Data Validation To verify the effectiveness of the genetic modification at the transcriptional level and to validate the effect of the NCgl0265 mutant promoter on L-isoleucine production enhancement, the strains constructed in Examples 2 and 4 above, along with the original strain Corynebacterium glutamicum CGMCC NO. 20437 and wild-type Corynebacterium glutamicum ATCC 13032, were fermented in a BLBIO-5GC-4-H fermenter (purchased from Shanghai Bailun Biotechnology Co., Ltd.) using the culture medium shown in Table 2 and the control process shown in Table 3. Fermentation products were collected uniformly at mid-fermentation (16 h) for transcriptome sequencing analysis. Three batch biological replicates were set for each strain. Data are expressed as mean ± standard deviation and analyzed using a significance test (…). t-test ,*express p <0.05, ** indicates p <0.01).
[0064] The analysis results clearly show that, compared with Corynebacterium glutamicum CGMCC 20437 and wild-type Corynebacterium glutamicum ATCC 13032, the NCgl0265 mutant promoter can significantly increase the expression level of the NCgl0265 gene in recombinant bacteria YPI-p0265-1 and YPI-p0265-2. Figure 1 Compared with the original strain, recombinant strains YPI-p0265-3 and YPI-p0265-4 showed... ilvA Gene expression levels were also significantly upregulated, indicating that the replacement... ilvAThe NCgl0265 mutant promoter (SEQ ID No. 2) of the natural promoter can be efficiently activated. ilvA Gene expression ( Figure 1 ).
[0065] At 32 h of fermentation, 1 mL of fermentation product was centrifuged at 12000 g for 2 min. After centrifugation, the supernatant was diluted 100 times and the L-isoleucine yield was detected by 2,4-dinitrofluorobenzene pre-column derivatization HPLC. The results are shown in Table 4. It can be seen that compared with the original strain, the L-isoleucine yield of recombinant strains YPI-p0265-1 and YPI-p0265-2 was significantly increased. Compared with the original strain, the L-isoleucine yield of recombinant strains YPI-p0265-3 and YPI-p0265-4 was significantly increased. This indicates that the NCgl0265 mutant promoter helps to increase the L-isoleucine yield.
[0066] Table 2 shows the fermentation medium formulation (the rest is water).
[0067] Table 3 shows the fermentation control process.
[0068] Table 4 shows the results of the L-isoleucine fermentation experiment.
[0069] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. A DNA molecule, comprising any of the following: A1) The nucleotide sequence contains the DNA molecule shown in SEQ ID No. 2; A2) A variant in which one or more nucleotides are substituted, deleted or added at positions other than nucleotide 66 in the nucleotide sequence shown in SEQ ID No. 2, and the resulting DNA molecule has equivalent or enhanced promoter activity.
2. A biological material related to the DNA molecule of claim 1, comprising any one of B1) to B7) below: B1) An expression cassette containing the DNA molecule of claim 1; B2) A recombinant vector containing the DNA molecule of claim 1; B3) A recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the DNA molecule of claim 1; B5) Recombinant microorganisms containing the expression cassette described in B1); B6) Recombinant microorganisms containing the recombinant vector described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) A nucleic acid construct containing the DNA molecule of claim 1.
3. The biomaterial according to claim 2, characterized in that: The nucleic acid construct comprises the DNA molecule of claim 1 and a gene sequence operatively linked to the DNA molecule.
4. The use of the DNA molecule of claim 1 as a promoter; Alternatively, the use of the DNA molecule of claim 1 as a promoter in initiating the expression of a target gene.
5. The use of the DNA molecule of claim 1 or the biomaterial of claim 2 or 3 in the production of biomolecules.
6. The application according to claim 5, characterized in that: The biomolecule is at least one of the following substances: lysine, valine, glycine, glutamic acid, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, and citrulline.
7. A method for producing L-amino acids, comprising the following steps: introducing the DNA molecule of claim 1 into a biological cell capable of synthesizing the target L-amino acid, thereby causing the DNA molecule of claim 1 to drive the expression of a gene in the target L-amino acid synthesis pathway in the biological cell, to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain the target L-amino acid.
8. The method according to claim 7, characterized in that: The biological cells are yeast, bacteria, algae, fungi, plant cells, or animal cells capable of synthesizing the target L-amino acid.
9. The method according to claim 8, characterized in that: The bacteria are at least Corynebacterium glutamicum.
10. The method according to any one of claims 7-9, characterized in that: The target L-amino acid is at least L-isoleucine.